ID: 910896484

View in Genome Browser
Species Human (GRCh38)
Location 1:92075339-92075361
Sequence ACCACCTCCTGCTCTGGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 4, 1: 2, 2: 2, 3: 41, 4: 321}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910896484_910896491 13 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896491 1:92075375-92075397 TTTGAAGTGGGAGTGGAGACTGG 0: 1
1: 1
2: 4
3: 37
4: 619
910896484_910896489 1 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896489 1:92075363-92075385 TTGGTTTCTTCTTTTGAAGTGGG 0: 1
1: 1
2: 8
3: 49
4: 626
910896484_910896493 22 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896493 1:92075384-92075406 GGAGTGGAGACTGGCGTTTAGGG 0: 2
1: 1
2: 2
3: 12
4: 111
910896484_910896494 23 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896494 1:92075385-92075407 GAGTGGAGACTGGCGTTTAGGGG 0: 2
1: 1
2: 2
3: 17
4: 147
910896484_910896490 6 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896490 1:92075368-92075390 TTCTTCTTTTGAAGTGGGAGTGG 0: 1
1: 1
2: 5
3: 49
4: 449
910896484_910896488 0 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896488 1:92075362-92075384 CTTGGTTTCTTCTTTTGAAGTGG 0: 1
1: 3
2: 2
3: 45
4: 503
910896484_910896492 21 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896492 1:92075383-92075405 GGGAGTGGAGACTGGCGTTTAGG 0: 2
1: 2
2: 4
3: 11
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910896484 Original CRISPR ACCACCTCCTGCTCTGGGAC TGG (reversed) Exonic