ID: 910896484

View in Genome Browser
Species Human (GRCh38)
Location 1:92075339-92075361
Sequence ACCACCTCCTGCTCTGGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 4, 1: 2, 2: 2, 3: 41, 4: 321}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910896484_910896488 0 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896488 1:92075362-92075384 CTTGGTTTCTTCTTTTGAAGTGG 0: 1
1: 3
2: 2
3: 45
4: 503
910896484_910896489 1 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896489 1:92075363-92075385 TTGGTTTCTTCTTTTGAAGTGGG 0: 1
1: 1
2: 8
3: 49
4: 626
910896484_910896492 21 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896492 1:92075383-92075405 GGGAGTGGAGACTGGCGTTTAGG 0: 2
1: 2
2: 4
3: 11
4: 209
910896484_910896491 13 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896491 1:92075375-92075397 TTTGAAGTGGGAGTGGAGACTGG 0: 1
1: 1
2: 4
3: 37
4: 619
910896484_910896494 23 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896494 1:92075385-92075407 GAGTGGAGACTGGCGTTTAGGGG 0: 2
1: 1
2: 2
3: 17
4: 147
910896484_910896493 22 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896493 1:92075384-92075406 GGAGTGGAGACTGGCGTTTAGGG 0: 2
1: 1
2: 2
3: 12
4: 111
910896484_910896490 6 Left 910896484 1:92075339-92075361 CCAGTCCCAGAGCAGGAGGTGGT 0: 4
1: 2
2: 2
3: 41
4: 321
Right 910896490 1:92075368-92075390 TTCTTCTTTTGAAGTGGGAGTGG 0: 1
1: 1
2: 5
3: 49
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910896484 Original CRISPR ACCACCTCCTGCTCTGGGAC TGG (reversed) Exonic
900290715 1:1922496-1922518 GCCACCTCCTCCCCTGGGACTGG + Intronic
900400652 1:2471645-2471667 TCCTCCCCCTGCTCTGGGGCCGG + Intronic
900415731 1:2533699-2533721 ACCACGTCCTGCTTTGGAGCTGG - Intergenic
900777719 1:4597024-4597046 AACGTCTCCAGCTCTGGGACTGG + Intergenic
902328121 1:15716067-15716089 CCCAGCTGCTGCTCTGGCACTGG - Intronic
902435998 1:16398365-16398387 GCCACCTCCTGCTCTTCCACAGG + Intronic
903127457 1:21257648-21257670 ACGGCCTCCTGCCCTGGGAATGG + Intronic
903240079 1:21976934-21976956 TCCACCACCTGTTCTGGGAGTGG + Intergenic
903243829 1:22001570-22001592 TCCACCACCTGTTCTGGGAGTGG + Intergenic
904263005 1:29301175-29301197 CCCTCCTCCTGCTCTGGGTGAGG - Intronic
904574989 1:31499771-31499793 CCCACCTCCTGCCCTGGGCATGG + Intergenic
905106935 1:35569167-35569189 ATCACCTCCTGCTCCAGGCCAGG - Intergenic
905239564 1:36572889-36572911 CCCTCCTGCTGCTCTGGGAATGG - Intergenic
906709044 1:47915770-47915792 GCCACCTCATGCCCTGTGACAGG - Intronic
906914716 1:49995805-49995827 ACCAGCACCTGCTCTGGTGCAGG - Intronic
907306444 1:53515739-53515761 ATAAACTCCTACTCTGGGACTGG + Intronic
909561673 1:77015232-77015254 ATCTCCTCCTGCTTTTGGACTGG - Intronic
910896484 1:92075339-92075361 ACCACCTCCTGCTCTGGGACTGG - Exonic
913463811 1:119117702-119117724 ACCAGCACCTGCTCTGGTAGAGG - Intronic
913465659 1:119140296-119140318 GCCACCTCCAGTTCTGGGAGCGG - Intronic
915153594 1:153855785-153855807 CCCACCTCAGCCTCTGGGACTGG + Intronic
915686784 1:157642166-157642188 TCCACCTCCTCTACTGGGACCGG + Intergenic
917440243 1:175062560-175062582 ACCACCTCCTGATCTTGGTTGGG - Intergenic
917864795 1:179183891-179183913 ACCACCTCCTGTTCTGAGACTGG + Intronic
919407967 1:197208588-197208610 ACCAGCTCCTGCTCTGGTGTAGG + Intergenic
919471755 1:197987995-197988017 CCCACCTCAGGCTCTAGGACAGG - Intergenic
919520485 1:198582127-198582149 ACCAGCACCTGCTCTGGTAGAGG + Intergenic
919756063 1:201066831-201066853 ACCACCCTCTGCTCTGTGCCAGG - Intronic
920191677 1:204197798-204197820 ACCACCTCCTGCTTCAGGACAGG - Intergenic
920204543 1:204282101-204282123 CCCAGCCCCTGCTCTGGGCCTGG + Intronic
920966247 1:210703865-210703887 ATGCCCTCCTGCTCTGGGGCTGG - Intronic
921731669 1:218586056-218586078 CCCACCTCCTGCTGTGGCTCGGG + Intergenic
922810398 1:228412218-228412240 GCCACCTCGGGCACTGGGACAGG - Intronic
923578288 1:235182025-235182047 GCCACCCCCTCCTCTGGGGCAGG + Exonic
924587404 1:245372083-245372105 GTCACCTCCTGCTCTGCGGCTGG - Intronic
1063127860 10:3151255-3151277 ACCACGTCCAACTCTGTGACAGG + Exonic
1063159281 10:3408127-3408149 ACCTCCTCCTGCTCCAGGACAGG - Intergenic
1064518789 10:16178528-16178550 ACCAGCTCCTTCCCTTGGACAGG - Intergenic
1065488120 10:26254443-26254465 CTCACCTCCTGCTGTGTGACCGG + Intronic
1065806225 10:29395609-29395631 ACCAGCTGCTGCTGTGGGGCGGG - Intergenic
1067637269 10:48010290-48010312 AGCAGCTCCTGATCTGGTACGGG - Intergenic
1069631606 10:69900422-69900444 ACCACCTCTTGCTCTTGAAAAGG - Intronic
1069681786 10:70290723-70290745 AGAAACTCCTGATCTGGGACCGG - Intergenic
1069778644 10:70941331-70941353 CCCACAGCCTGCTCTTGGACAGG - Intergenic
1069786085 10:70988815-70988837 ACTGCCTCCTACTCTGGGCCTGG + Intergenic
1072047749 10:91673572-91673594 TCCACCTCGTGCTGTGGGTCTGG - Intergenic
1072289100 10:93946236-93946258 ACCACCACCTGCTCAGAGCCTGG - Intronic
1073176833 10:101561912-101561934 ACCACCTGCAGCTTTGGGCCTGG - Intergenic
1074115924 10:110457548-110457570 ACCTCCTACTCCTCAGGGACTGG - Intergenic
1074147088 10:110726254-110726276 ACCATCTCCAACTCTGAGACAGG - Intronic
1075339063 10:121631072-121631094 CCCACCACCTGCTTTGGTACAGG - Intergenic
1076138191 10:128059236-128059258 AGACCCTCCTGCTCAGGGACTGG - Intronic
1076346818 10:129785005-129785027 AGCACCTACTGCCCTGGGACAGG + Intergenic
1077497139 11:2891854-2891876 GCCACCTCCTGCCCTGGGCTGGG + Intronic
1077804644 11:5578496-5578518 GGCACCTCTTTCTCTGGGACTGG + Intronic
1078050469 11:7961169-7961191 TCCAGCTCCTGCTCCGGGAAGGG + Exonic
1083277679 11:61606437-61606459 ACCATCCCCAGCTCTGGGAGGGG + Intergenic
1083943501 11:65911459-65911481 GCCAGCTCCTGCTCTGGGCCAGG + Intergenic
1085350531 11:75795503-75795525 CCCACCTCCTGCCCTGGGGCTGG - Intronic
1086361559 11:86065550-86065572 CCCACCTCCAGCTGTGAGACAGG + Intronic
1087587733 11:100143363-100143385 CCTACCTCCTACTCAGGGACTGG - Intronic
1089837017 11:121379482-121379504 ACCAGCACCTGCTCTGGTAGAGG - Intergenic
1089956282 11:122574367-122574389 CCATCCTCCTGCTCTGGGGCAGG + Intergenic
1091603946 12:1934902-1934924 GCCACATCCTGCTCTGTGAGTGG + Intergenic
1092099975 12:5875018-5875040 GCTAACTCCTGCTCTAGGACAGG + Intronic
1092306486 12:7306315-7306337 CCCACCTACTGCTCGGGGAAGGG + Intronic
1095245613 12:39917636-39917658 ATCTCCTCCTGCCCTGGGACTGG + Intronic
1095497365 12:42798977-42798999 ACCACATCATGCTCTGGGGTTGG - Intergenic
1095984533 12:47990725-47990747 GCCAGCTCCTTCTCTAGGACTGG + Intronic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1098268463 12:68746818-68746840 CCCACCTCCTGCACTGGCCCCGG + Intronic
1102473643 12:113174841-113174863 ACAACCTCCTGGGATGGGACAGG + Intronic
1102737582 12:115176842-115176864 AGCAGCTCCTGCTCTTGGAGAGG + Intergenic
1102876063 12:116449665-116449687 ACCTTCTCCTGCTCTTGGACTGG + Intergenic
1103330906 12:120153490-120153512 ACCAAGTCTAGCTCTGGGACAGG + Intronic
1105071124 12:133235290-133235312 ACCCCCACCGGCTCTGGGAGGGG + Exonic
1106480507 13:30133747-30133769 ACCACCTCCTGGGCTGGCACTGG - Intergenic
1108095037 13:46892661-46892683 ACAATTTCCAGCTCTGGGACAGG + Intronic
1108411129 13:50148249-50148271 ACTACCTCCTGCTCTGCAGCAGG + Intronic
1111445201 13:88338763-88338785 CCCACCTCCTGCCCTCTGACAGG + Intergenic
1113523015 13:110953915-110953937 CCCGCCTCCTGCCCTGGGAGTGG + Intergenic
1113587294 13:111474222-111474244 GAGACCTCCTGCTATGGGACAGG + Intergenic
1113639107 13:111944481-111944503 GCCACCTCCTCCCCAGGGACAGG - Intergenic
1113702354 13:112396894-112396916 CCCGCCTCCTGCCCTGGGAGTGG - Intronic
1113910304 13:113838473-113838495 CCCTCCTCCTGCTCCGGGGCTGG - Intronic
1114201880 14:20528888-20528910 ACTACCTCCTGCTCTGAGACTGG - Intergenic
1114627948 14:24141514-24141536 ACCTCCTCCTGGACTGGGCCGGG - Exonic
1115763101 14:36595300-36595322 GCCACCTCCTGGTGTGGGATAGG - Intergenic
1118163731 14:63316044-63316066 ACCTCCTCCTGTTCAGGGACTGG - Intronic
1118747805 14:68786467-68786489 ACCAGCCCCTGCCCTGGAACAGG + Intergenic
1119029603 14:71181502-71181524 CCCACCTCCTGAGCTGGGGCTGG + Intergenic
1120459838 14:84780722-84780744 ACCTACTCCTGCACTTGGACTGG + Intergenic
1121270348 14:92633426-92633448 GCCATCTCCTCCTCTGGGACAGG - Intronic
1122062761 14:99147665-99147687 ACCACCACCAGCGCTGGGATTGG + Intergenic
1122662802 14:103309364-103309386 ACCACCTGCTGGGCTAGGACTGG - Intergenic
1123029871 14:105446560-105446582 ACCTCCCCCTGCTCTGGGAGGGG + Intronic
1123130609 14:105982657-105982679 AACACCACCTGCCCTGGGAGGGG - Intergenic
1123135224 14:106021776-106021798 ACCCACACCTGCTCTGGGGCTGG + Intergenic
1123164595 14:106314496-106314518 ACCTGCACCTGCTCTGGGGCTGG + Intergenic
1123397846 15:19955150-19955172 ACCCCCACCTGCTCTGGGGGTGG + Intergenic
1123585769 15:21759646-21759668 ACCCACACCTGCTCTGGGGCTGG + Intergenic
1123622411 15:22202234-22202256 ACCCACACCTGCTCTGGGGCTGG + Intergenic
1123756505 15:23401251-23401273 CTCACCTCCTGCTGTGGGGCCGG + Intergenic
1123992504 15:25694062-25694084 ACCACCTCCTGGTGAGGGCCAGG - Intronic
1124149611 15:27165824-27165846 ACCACCTCCTCCTTTGCGACAGG - Intronic
1124707522 15:31977938-31977960 ACCACCTCCAGGGCTGGGGCTGG + Intergenic
1127640688 15:60913209-60913231 ACCACCTCGTGCTCAGGCTCAGG + Intronic
1128075116 15:64821070-64821092 ACCTCTTCCAGCTCTTGGACTGG + Exonic
1128334210 15:66775666-66775688 ACTACCCCCTGCTCAGGGCCTGG - Intronic
1128565958 15:68700499-68700521 ACCTCCTCCTGCTCAGGGAGGGG - Intronic
1129002375 15:72345532-72345554 AACAGCCCCTGCTCTGGGCCTGG + Exonic
1129663789 15:77567965-77567987 ACCACCAGCTGCTCTGGAAGAGG + Intergenic
1130401157 15:83555569-83555591 ACCCCCTCCAGCTCTGTGACTGG - Intronic
1130580805 15:85135389-85135411 ACCCCCTCCAGCCCTGGCACTGG + Intronic
1132594007 16:740114-740136 ACCACCTCCTGCTCAGTGCCCGG + Intronic
1132609647 16:808935-808957 TCCTCCTCCTGCCCTTGGACAGG - Intronic
1132710188 16:1262961-1262983 ACCAGGTCATTCTCTGGGACGGG + Intergenic
1132783645 16:1642334-1642356 AACACCTGCTGTGCTGGGACTGG - Intronic
1133092286 16:3413886-3413908 GCCGCCTCCTCCTCTGGGCCTGG + Intronic
1133903219 16:9996548-9996570 ACCACAATCTGCTCAGGGACAGG - Intronic
1134442745 16:14308903-14308925 AACACCTCCTCCTCTGGAATGGG - Intergenic
1134822879 16:17260861-17260883 AAGGCCTCCTCCTCTGGGACTGG + Intronic
1135080648 16:19431768-19431790 CCCATCTCCTGCCCTGGGCCTGG - Intronic
1136279760 16:29201460-29201482 GCCACCTCCTGCCCTGGCCCTGG + Intergenic
1137668625 16:50266510-50266532 ACCACTTCCTGCTCCGGCAGCGG - Exonic
1138530412 16:57631519-57631541 ACCACCTCCTCCTCCCAGACTGG + Intronic
1139515423 16:67449808-67449830 ACCAGTACCTGCTCTGGGCCAGG - Intronic
1139517763 16:67461871-67461893 CCCACTCCCTGCTCTGGGACAGG + Intronic
1142084149 16:88167570-88167592 GCCACCTCCTGCCCTGGCCCTGG + Intergenic
1142162669 16:88566886-88566908 CCCACTTCCTGCTCTGGAAGAGG + Intergenic
1142808152 17:2382417-2382439 ACCAGCTCCTGCTCTGTAAGAGG - Intergenic
1143056645 17:4167686-4167708 GCCAGCTCCTGCTCTGGGTGGGG + Exonic
1143101621 17:4507684-4507706 GCCACCTGCTGCTCTGAGACAGG + Intronic
1143632403 17:8146702-8146724 CCCGCCTCCAGCTCTGGGTCTGG + Exonic
1147282244 17:39371562-39371584 ACCCCATCCTCCTCTGGGATTGG + Intronic
1148149266 17:45386644-45386666 ACCAAGCCCTGCTCTGAGACTGG + Intergenic
1148259955 17:46173016-46173038 ACCCCCTACTGCTCTGGCAAAGG + Intronic
1149410855 17:56405045-56405067 ACCACCACCTCCACTGGAACAGG - Intronic
1149850233 17:60029751-60029773 ACCACCTACTTCTCTGCCACTGG - Intergenic
1149859933 17:60116773-60116795 ACCACCTACTTCTCTGCCACTGG + Intergenic
1151344764 17:73494801-73494823 GCCCCCTCCTGCTTTAGGACAGG - Intronic
1151686332 17:75648980-75649002 ACCATGGCCGGCTCTGGGACGGG + Intronic
1151926864 17:77204115-77204137 ACCATCTTCTTCTCTGGGAGGGG - Intronic
1151945367 17:77316640-77316662 ACGAACTCCTGCTGTGGGGCAGG - Intronic
1152184390 17:78844971-78844993 ACCTCATCCTGCTCTTGGCCTGG - Intergenic
1152232472 17:79120963-79120985 ACCACCCCCTGCCATGGGCCAGG + Intronic
1152342039 17:79730772-79730794 ACCACCTGTTGCTATGGGAGAGG + Intergenic
1152355138 17:79803237-79803259 ATAACGTCCTGCTCTCGGACGGG - Intergenic
1152587974 17:81197552-81197574 ACCACCTCCTGCTGGGGGCCGGG + Intronic
1152697200 17:81803359-81803381 ACCACCTCCTTTCCTGGGAGTGG - Intergenic
1152729267 17:81961662-81961684 CCCACGGCCTGCTCTGGGCCTGG - Intronic
1153162001 18:2216907-2216929 CCCACCTTCTGCCCTGTGACAGG - Intergenic
1155199412 18:23503830-23503852 GCCGCCTCCCGCGCTGGGACGGG - Intronic
1157682734 18:49619576-49619598 ACCACCCCCTGCCCTGGCACTGG - Intergenic
1158146865 18:54323775-54323797 ACCATCTGCTTCTGTGGGACAGG + Intergenic
1158296546 18:56002902-56002924 ACAGCCTCCTGCTCTTGGAGTGG - Intergenic
1158910663 18:62058138-62058160 AGAACCTCCTGGTCTGGGCCAGG - Intronic
1159105049 18:63995460-63995482 ACCACCACCTGCTCTGTCTCTGG + Intronic
1160427547 18:78788341-78788363 ACCTCCTCCTGCTCTCTGGCCGG + Intergenic
1160544812 18:79645850-79645872 ACCACCTCGTGCTAAGGGAATGG + Intergenic
1160992373 19:1864941-1864963 GCGACCTCCTGCTCTGGGTTGGG + Intergenic
1161090998 19:2360112-2360134 AGTACCTCCTGCTCCGGGCCGGG - Intergenic
1161279547 19:3438305-3438327 ACCAGCTTCTGCTCTGTGATTGG + Intronic
1161698862 19:5784394-5784416 AACACCTCTTTCTCTGGGTCTGG + Exonic
1161706949 19:5826652-5826674 ACTGCCACCTGCTCTGGGGCTGG + Intronic
1162199589 19:9010732-9010754 ACCCCCTCCTGCGCAGGGACTGG + Intergenic
1162489947 19:10986094-10986116 ACCAGCTCCTACTCTGAGACAGG - Intronic
1163020262 19:14477831-14477853 CCTCCCTCCTGCTCTGGGCCAGG + Exonic
1163399486 19:17083472-17083494 AGCACCCCCTGCTCTGTGTCTGG + Intronic
1164327017 19:24202954-24202976 AACATCTGCTTCTCTGGGACAGG - Intergenic
1165097078 19:33415281-33415303 ACCACGGGCTGCGCTGGGACTGG + Intronic
1165149462 19:33752231-33752253 ACCACCCCCTGCCCGGGGAGAGG + Intronic
1165311297 19:35030688-35030710 AGCAGCTGCGGCTCTGGGACCGG - Intronic
1165359888 19:35329717-35329739 GCCACAACCTGCTCTGGGACGGG - Intronic
1165912480 19:39237757-39237779 TCCACCTGCTGCTCTGGGTTTGG + Intergenic
1166105154 19:40594543-40594565 ACCACCTCCTACCCTGTGGCTGG - Intronic
1166823912 19:45597775-45597797 ACCACCTCTTCCCCTGGGAATGG - Intronic
1168308462 19:55449470-55449492 ACCACTTACAGCTCTGGGACAGG + Intergenic
1168464266 19:56589401-56589423 ACCACCTGCTGCTCTGGTAGGGG + Intergenic
925045844 2:772546-772568 ACCAGCTGGTGCTGTGGGACCGG + Intergenic
925194674 2:1913458-1913480 AGCACTTCTTCCTCTGGGACAGG - Intronic
926279212 2:11431287-11431309 ACCATCTACTTCTCTGGGAGTGG + Intergenic
927505008 2:23607185-23607207 ACCACCTCCTGGTCTGTGGGTGG - Intronic
929197107 2:39196281-39196303 ACCAGCACCTGCTCTGGTAGAGG - Intronic
931228406 2:60353220-60353242 ACTCCCTCCAGCTCTGGGAAAGG + Intergenic
931735452 2:65189404-65189426 TCCAGCTCCTCTTCTGGGACAGG - Intergenic
932165151 2:69498822-69498844 ACCACCTCCATATCTGGGCCTGG - Intronic
932401169 2:71482083-71482105 TCCACCTCCTCCCATGGGACTGG + Intronic
932570169 2:72934364-72934386 ACCACCCCAGGCTCTGGGGCTGG - Exonic
935079178 2:99775548-99775570 ACCTCCTCCTGCCCTCTGACAGG - Intronic
936140900 2:109939208-109939230 ACCAGCACCTGCTCTGGTAGAGG - Intergenic
936177591 2:110237153-110237175 ACCAGCACCTGCTCTGGTAGAGG - Intergenic
936203793 2:110432278-110432300 ACCAGCACCTGCTCTGGTAGAGG + Intronic
936537015 2:113320379-113320401 GCAACCTCCTGCTCTGAAACGGG + Intergenic
937098727 2:119252383-119252405 ACCCCCTCCTCCTCTGAGTCTGG + Intronic
937242137 2:120468767-120468789 ACCACCTCATGCTGTGGGAGGGG - Intergenic
937911972 2:127080202-127080224 CCCAGCTCCTGTTCTGGGGCAGG - Intronic
938642460 2:133295198-133295220 ACCACCTGCTTCACTGGTACTGG - Intronic
940612097 2:156005758-156005780 ACCAGCTGCTGCTGTGGCACGGG + Intergenic
943758517 2:191584282-191584304 GCCACCTACTTCTCTTGGACTGG + Intergenic
944986743 2:205185819-205185841 ACCACATTCTGCTCTGGGATTGG + Exonic
946159273 2:217826145-217826167 TCCACCCCATGATCTGGGACTGG - Intronic
947235378 2:227935991-227936013 AACAGCTCCTGTTCTGAGACTGG + Intergenic
947864307 2:233385401-233385423 TCCACCTGCTGCTCTCTGACTGG + Intronic
948487824 2:238291859-238291881 ACCACCTCATGTCCAGGGACAGG - Intergenic
948547028 2:238740042-238740064 TCCACCTCCTGCCCTGGCCCAGG - Intergenic
948590105 2:239043940-239043962 ACCACCTTCTTCTCTGGGGAAGG + Intergenic
948803678 2:240443948-240443970 ACTCACTCCTGCTCTGGGCCTGG + Intronic
1168951101 20:1802871-1802893 ATCACTTCCAGCTGTGGGACAGG - Intergenic
1170038493 20:12015702-12015724 ACCAACTGCTGCTCTTGTACTGG + Intergenic
1171486742 20:25491099-25491121 CCCACTTTCTGCTCTGGGCCAGG - Intronic
1173540376 20:43846750-43846772 AGCAGCTGCTGCTCTGTGACAGG - Intergenic
1173620046 20:44429766-44429788 TCCCATTCCTGCTCTGGGACTGG - Exonic
1173721315 20:45260566-45260588 ACCATCTCCTGATCTGCAACAGG - Intergenic
1175268200 20:57715121-57715143 TCCAGCACCTGCTCTGGGTCTGG + Intergenic
1176236205 20:64054667-64054689 ACCCCTTCTTGCTCAGGGACAGG + Intronic
1176681217 21:9820316-9820338 AACACCAACTGCTGTGGGACTGG - Intergenic
1176744534 21:10639872-10639894 ACCCCCAACTGCTCTGGGGCTGG + Intergenic
1177316181 21:19464145-19464167 ATCTCCTTCTGCTCTTGGACTGG - Intergenic
1177660017 21:24070695-24070717 ACCACCTCCCGCTGTGGAACCGG - Intergenic
1179626183 21:42650817-42650839 GCCTTCTCCTGCCCTGGGACTGG + Intergenic
1179791973 21:43761141-43761163 GACATCTCTTGCTCTGGGACAGG - Exonic
1180395173 22:12325222-12325244 ACCACCTCATGCTCATGGATAGG - Intergenic
1180404567 22:12539529-12539551 ACCACCTCATGCTCATGGATAGG + Intergenic
1183212985 22:36462385-36462407 ACCTCCTCCTGCTCTGGAGCTGG - Intergenic
1183454947 22:37917577-37917599 ACCACCTAATGCAGTGGGACAGG - Intronic
1184114729 22:42415877-42415899 AGCCCCTCCTGGTCTGGGACAGG - Intronic
1184612302 22:45612554-45612576 CTCAACTCCTGCTCTGGGACAGG - Intergenic
1184947903 22:47817303-47817325 AACACCTCCTGCCCTGACACAGG + Intergenic
1185006067 22:48277690-48277712 ACCAGCCCCTGGTCTGAGACGGG + Intergenic
949189661 3:1236348-1236370 ACCACCACCTGCTCTGGTGGAGG - Intronic
951996996 3:28741935-28741957 CCAAGCACCTGCTCTGGGACTGG + Intergenic
954716281 3:52528507-52528529 ATCACCTCCTCGTCTGGCACAGG + Exonic
956578695 3:70784674-70784696 TCCACCTTCTGCTCTGGGCCAGG + Intergenic
956786393 3:72646151-72646173 CCCATCTCCTGCTCTGTGGCTGG + Intergenic
957971762 3:87391030-87391052 ACCAACACCTGTTCTGGTACAGG - Intergenic
961383568 3:126511046-126511068 ACCATCTCCTGTTCTGGGGATGG + Intronic
961393387 3:126569977-126569999 ACCAGCTTCTGCTCTGTGTCAGG - Intergenic
961451763 3:127005385-127005407 ACCACCTGCTGGTCTGGGAGTGG + Intronic
961513803 3:127420486-127420508 ACCAGCATCTGATCTGGGACCGG + Intergenic
961865913 3:129953335-129953357 ACCAACACCTGCTCAGGGCCAGG - Intergenic
962743588 3:138381430-138381452 ACTACCTCCTGCTTTGGCCCAGG + Intronic
963957298 3:151269011-151269033 ACTACTTCCTGCTCTGAGACCGG + Intronic
964369737 3:155987354-155987376 ACCACCTCCTGCTCTGTGACCGG + Intergenic
964476726 3:157104251-157104273 ACCACCCCTGGCTCTGGGAGGGG - Intergenic
967241621 3:187445180-187445202 ACCACCTCTAGCTCTGGGTGTGG - Intergenic
968036916 3:195555315-195555337 CCTACCTCCTGCCCTGGGAGGGG - Intergenic
968235278 3:197027573-197027595 CCCACCTCCTGGCCTGGGCCCGG + Intronic
968433554 4:573609-573631 AGTACCTCCTGCCGTGGGACTGG - Intergenic
969298261 4:6282033-6282055 ACCACGGCCTGCCCTGGGCCAGG - Intronic
971711600 4:30120001-30120023 ACCACTCCCTGCACTGTGACTGG - Intergenic
974717379 4:65685900-65685922 ACTACTTCCTGCTTTGGGAAGGG - Intergenic
975634044 4:76428231-76428253 ATCTTCTCCTGCCCTGGGACAGG - Intergenic
975696751 4:77021419-77021441 ACCACCTCCTGGTCGAGGAGAGG + Intronic
977175079 4:93809866-93809888 ACCACCACTTGCTGTGGGAAGGG + Intergenic
979159994 4:117448015-117448037 ACCAGCTCCTGCTCTGTTAGAGG + Intergenic
980519248 4:133909807-133909829 ACCAGCACCTGCTCTGGTAGAGG + Intergenic
981937184 4:150250543-150250565 GCCAACTCCAGCTCTGGGAAAGG - Intronic
982027074 4:151261495-151261517 ACAACCTCCTGCTGGGTGACTGG + Intronic
982829813 4:160044937-160044959 ACCAGCACCTGCTCTGGTAGAGG - Intergenic
983930606 4:173449524-173449546 AGAACCTGCTGCTCTGGCACTGG + Intergenic
985969338 5:3362664-3362686 ACCACCTACAGTTGTGGGACAGG - Intergenic
985995350 5:3594587-3594609 ACCACCTCCTACGCAGAGACGGG - Intergenic
985999443 5:3619084-3619106 ACCAGCTCCTGCTCTTGTCCAGG + Intergenic
986827538 5:11538136-11538158 ACCAACTGCTTCTCTAGGACTGG + Intronic
987259873 5:16192658-16192680 AGCAACTCCTGCTCTGTGGCAGG + Intergenic
988063744 5:26207222-26207244 AGCATCACCTGCTCTGGGGCAGG - Intergenic
988208170 5:28167192-28167214 ACCACCTTCTCCTTTGGGACTGG - Intergenic
989694454 5:44183522-44183544 ACCAGCACCTGCTCTGGTAGAGG + Intergenic
990873601 5:60460667-60460689 AATGCCTCCTGCTCTGGGACCGG - Intronic
993365985 5:87034906-87034928 ACCAGCTCCTGCTCTAGTAGAGG + Intergenic
993846020 5:92944566-92944588 TCCAACTCCTGCTCTAAGACTGG + Intergenic
994207960 5:97057189-97057211 ACCACTTCCTGCTCTGGGACCGG - Intergenic
994207979 5:97057286-97057308 ACCACCTCCTGCTCTGGGACTGG - Intergenic
994604092 5:101944195-101944217 CTCACCTCCTGCTCTGTGGCAGG - Intergenic
995243627 5:109913030-109913052 GCCCCCTTCTGCTTTGGGACAGG + Intergenic
995625390 5:114070559-114070581 ACCAGCTCCCGCTCTGTGAGGGG - Intergenic
997205269 5:132044436-132044458 ACCACTTCCTTGTCTGGGAGAGG + Intergenic
997844606 5:137275482-137275504 AGCACCTCCTGCCCTGGGCCAGG - Intronic
998385688 5:141756037-141756059 ACCACCGTCTGTACTGGGACAGG + Intergenic
998792361 5:145778648-145778670 ACCAGCTGCTGCCGTGGGACAGG - Intronic
1000111662 5:158113841-158113863 ACCCCCAGCTGCACTGGGACAGG + Intergenic
1000142469 5:158418948-158418970 ACCACCCCATGCTTTGGGGCAGG + Intergenic
1000244503 5:159438190-159438212 ACAAGCTCCAGCTCTGAGACAGG - Intergenic
1000338933 5:160262158-160262180 GCCACCTCCTGCTCTGGGGAGGG - Intronic
1001054991 5:168441897-168441919 ATCACCTCCAGTTCTGGGAGAGG - Intronic
1001313054 5:170624836-170624858 TCCTCCTCCTGCCCTGGGCCAGG - Intronic
1001489150 5:172143441-172143463 ACCACACCGTGCTCTGGGCCTGG + Intronic
1001706396 5:173744210-173744232 ACCTACTCCTGCTCTGGCCCTGG + Intergenic
1001733702 5:173981154-173981176 ACCAGCTCCTGCTCTGGTGAGGG + Intronic
1005841208 6:29745615-29745637 AGCTCTTCCTGCTCTGTGACAGG - Intergenic
1006336934 6:33425802-33425824 ACCCCCTACTGATCCGGGACCGG + Exonic
1007370858 6:41426545-41426567 ACCTCCTCCAGCTCTGGCGCTGG - Intergenic
1010017511 6:71122087-71122109 ACCAGCACCTGCTCTGGTAGAGG + Intergenic
1010287265 6:74093342-74093364 ACTACCTCCAGCTCTGGGCTGGG + Intergenic
1011589016 6:88952727-88952749 ACCAGCACCTGCTCTGGTAGGGG - Intronic
1012273505 6:97243944-97243966 ACCACCACCTGCTCTGGTGGAGG + Intronic
1016317499 6:142806944-142806966 CCCAGCTCCTACTCTGTGACAGG + Intronic
1017326360 6:153145660-153145682 ACCAGCACCTGCTCTGGCAGAGG + Intergenic
1021044589 7:15906875-15906897 ACCACCCCCTGCACAGGGAGAGG + Intergenic
1022708593 7:32830655-32830677 CTCACCTCCTGCTGTGAGACTGG - Intergenic
1022914583 7:34934822-34934844 CTCACCTCCTGCTGTGAGACTGG + Intronic
1023627998 7:42135958-42135980 ACCACCTCCTCCCCTGGGTGGGG + Intronic
1023832923 7:44050577-44050599 ACCAGCACCAGTTCTGGGACTGG - Intronic
1023870301 7:44259617-44259639 ACCAGCTCCTGCCCTGCGCCAGG - Intronic
1024021596 7:45375668-45375690 ACCAGCTCCATCTCTGGGTCTGG - Intergenic
1027468029 7:78539771-78539793 ACCAACACCTGCTCTGGCAGAGG + Intronic
1028348001 7:89807591-89807613 ACCAGCACCTGCTCTGGTGCAGG + Intergenic
1029507733 7:100972425-100972447 ATCATCCCCTGCTCTGGGAATGG + Intronic
1030149336 7:106387128-106387150 ACCAGCTGCTGCTGTGGGGCAGG - Intergenic
1030688371 7:112508852-112508874 ACCACCTACTCCTATGGGTCAGG + Intergenic
1032402902 7:131636308-131636330 ACCACCTCCTGTGCTGGCGCGGG - Intergenic
1032755893 7:134890662-134890684 ACCACCCCCTCCTCAGGAACTGG + Intronic
1032841546 7:135717906-135717928 GTCATCTCCTGCCCTGGGACTGG + Intronic
1033221045 7:139526259-139526281 AACACATCGTGCTCTGGGTCTGG - Intronic
1034019564 7:147626931-147626953 ACCAGCACCTGCTCTGGTAGAGG - Intronic
1034840663 7:154392479-154392501 ACATCCTCCAGCTCTGAGACCGG + Intronic
1036280131 8:7393380-7393402 GCCACCTCCTGGCCTGGGCCTGG - Intergenic
1036341392 8:7918503-7918525 GCCACCTCCTGGCCTGGGCCTGG + Intergenic
1036655047 8:10672491-10672513 ACCTGCACCTGCTCAGGGACAGG - Intronic
1039155542 8:34552597-34552619 TCAATCTCCTTCTCTGGGACTGG + Intergenic
1040878015 8:52173492-52173514 ACCCCCTCTTGCTCTGGGAGTGG + Intronic
1041088520 8:54280185-54280207 ATCACCTCCTGCTTTGGGCTTGG + Intergenic
1041319399 8:56597868-56597890 AGCACCTCCTGTGCTGGGTCAGG + Intergenic
1042958314 8:74275818-74275840 CCCACCCCCTGCTCTGAGAATGG + Intronic
1043301142 8:78734552-78734574 ATCACCTCCTGGTCTAGGAAGGG - Intronic
1046186900 8:110734024-110734046 ATCCCCTGCTGCTCCGGGACTGG - Intergenic
1046496070 8:115015107-115015129 ACCACCTCTTGCTCATAGACAGG - Intergenic
1047190318 8:122673603-122673625 ACCACCTGCTCTTCTGGAACTGG - Intergenic
1047572108 8:126110379-126110401 CCCACCCCCTTCTCTGGGAAGGG + Intergenic
1048969716 8:139638693-139638715 CCCACCTCAGGCTCTGGGGCCGG + Intronic
1049224191 8:141441830-141441852 GCCACCCCCTGCCCTGGGAAGGG + Intergenic
1049246766 8:141567052-141567074 ACCGCCTCTTGCTGTGGGGCAGG + Intergenic
1049433089 8:142574276-142574298 ATCACCTGCCGCTCTGGGTCCGG - Intergenic
1049616722 8:143578730-143578752 GCCAGCTCCTGCCCTGGGCCTGG + Intergenic
1050147437 9:2583927-2583949 ACCACCACCTCCACTGGAACAGG + Intergenic
1050504170 9:6330002-6330024 ACCACCTCCAGCTGAGGGGCTGG + Exonic
1055416620 9:76091095-76091117 CCCACCTCCTGCTGTGTGGCCGG + Intronic
1057317170 9:93977016-93977038 ACCACCTCCTGCTGGGGCAGGGG + Intergenic
1057700570 9:97360701-97360723 CTCACCTCCTGGTCTGGGTCGGG + Intronic
1058479244 9:105373964-105373986 ACTACCTCCAGCTCTGGGGATGG - Intronic
1060472157 9:123957085-123957107 ACCAGCGCCTGCTCTGTGGCTGG + Intergenic
1060599598 9:124869202-124869224 ACCGGCTCCTGCTCGGGGGCGGG - Exonic
1060822936 9:126671910-126671932 ACCACCCCCTTCTCCTGGACTGG + Intronic
1061017327 9:127989467-127989489 CCGACCATCTGCTCTGGGACTGG + Intergenic
1061127085 9:128683946-128683968 ACCACCTCCTGCTCTGGGACCGG + Exonic
1061481935 9:130901727-130901749 GCCCTCTCCTGGTCTGGGACAGG + Intergenic
1061750563 9:132774068-132774090 TCCACCTTCTACTCTGGGAGGGG + Intronic
1061791139 9:133059725-133059747 ACCCCCTCCTGCCCTGTCACTGG - Intergenic
1203410224 Un_KI270581v1:1440-1462 ACCACCTCATGCTCATGGATAGG + Intergenic
1185724501 X:2408569-2408591 ACCATCTCCTGCTCTAGGATGGG + Intronic
1187074191 X:15917595-15917617 ACCACTTTCTCCTCTGAGACAGG + Intergenic
1187752144 X:22478568-22478590 ACCAGCACCTGCTCTGGGGGAGG + Intergenic
1188964957 X:36539605-36539627 TCCAATTCCTGCTCTGGGGCAGG - Intergenic
1189639263 X:43050420-43050442 ACCACCACCTGCTCTGGTAGAGG + Intergenic
1189933448 X:46039490-46039512 ACCAGCTCCTTCTGTGAGACAGG - Intergenic
1192052838 X:67742870-67742892 GCTACATCCTGCTCTGAGACTGG - Intergenic
1193032645 X:76915983-76916005 ACCACCACCTACTCTGTGGCTGG + Intergenic
1193700518 X:84755186-84755208 ACCACCTCCTGCTCTGGGACCGG + Intergenic
1194191914 X:90848112-90848134 ACCAGCACCTGCTCTGGTAGAGG + Intergenic
1194262755 X:91717145-91717167 ACCAGCACCTGCTCTGGTAGAGG - Intergenic
1194278283 X:91914014-91914036 ACCAGCACCTGCTCTGGTAGAGG - Intronic
1195113159 X:101667394-101667416 ACCCTCCTCTGCTCTGGGACAGG - Intergenic
1198020100 X:132649218-132649240 ACAAACTGCTGCTCTGGGAGTGG + Intronic
1198043215 X:132874891-132874913 AACACCTCCTCCTCTGGAAGGGG + Intronic
1200079071 X:153566608-153566630 ACCACCCTCTGCAGTGGGACTGG + Intronic
1200216514 X:154370510-154370532 GCCTCCTCCTCCTCGGGGACGGG + Intronic
1200538552 Y:4430547-4430569 ACCAGCACCTGCTCTGGTAGAGG + Intergenic