ID: 910897325

View in Genome Browser
Species Human (GRCh38)
Location 1:92082498-92082520
Sequence TTGAGTGAGCTCTTAGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910897325 Original CRISPR TTGAGTGAGCTCTTAGGGAT TGG Intronic
903059426 1:20659493-20659515 CTGGGTGAGATCTTAAGGATAGG - Intronic
903440272 1:23382864-23382886 CTTATTGAGCACTTAGGGATGGG - Intronic
903858332 1:26350587-26350609 GTGAGTGAGCACTTAGGGTTGGG - Intronic
905036808 1:34923976-34923998 TTGATTGTGCTCTTGGGGATGGG + Intronic
906699089 1:47844487-47844509 TTCATTGAGATCATAGGGATTGG - Intronic
907917374 1:58883331-58883353 TTGGGGGAGCTCTTAGGTTTGGG - Intergenic
907948613 1:59158930-59158952 ATCAGTGATCACTTAGGGATTGG + Intergenic
910897325 1:92082498-92082520 TTGAGTGAGCTCTTAGGGATTGG + Intronic
913270046 1:117084237-117084259 TTAAGTGAAATCTCAGGGATGGG - Intronic
913539745 1:119807434-119807456 TTTAGTGAGATCCCAGGGATAGG + Intronic
916561246 1:165935580-165935602 TTGACTGATCTCTTAGGGAGAGG + Intergenic
918663685 1:187120786-187120808 TTCAGTGTACGCTTAGGGATGGG + Intergenic
918943204 1:191027360-191027382 GGGACTGAGCTCCTAGGGATAGG + Intergenic
923109276 1:230878346-230878368 TTGAGCAAGTTCTTAAGGATGGG - Intergenic
923248172 1:232154109-232154131 TTCAGTGGGCTCTAAGGCATAGG - Intergenic
1065142970 10:22737739-22737761 GTGAGTCAGCTCTTTGGGCTGGG + Intergenic
1065967871 10:30783711-30783733 TTGAGTGGGCTCCTAGAGAAAGG - Intergenic
1066358916 10:34711854-34711876 TTGAGCCAGCTCTGAGGGACAGG - Intronic
1068686111 10:59871534-59871556 CTGGGTCAGCTCTGAGGGATGGG + Intronic
1073446603 10:103584700-103584722 TTGAGTGAGTTCTGCGGGATGGG - Exonic
1073832562 10:107402727-107402749 GTGAGTGAGCTTGTAGGGATGGG - Intergenic
1075858924 10:125656953-125656975 TTCAGGGAGCCCTTAGGGTTGGG - Intronic
1080401631 11:31941728-31941750 TTCAGTGTGCTCTGAGGAATAGG + Intronic
1087828488 11:102793491-102793513 TTTGGTGAGCCATTAGGGATCGG + Intronic
1088139269 11:106595869-106595891 TTGAATGAGATCTTAGGGAGGGG + Intergenic
1090177259 11:124662116-124662138 TTAATTAACCTCTTAGGGATGGG - Intronic
1090232544 11:125119085-125119107 GTGAGTGAGCTCGTAGCTATTGG + Intergenic
1090620083 11:128552894-128552916 GTCAGTGAGCTCTTAGAGACAGG + Intronic
1090734522 11:129599151-129599173 TTGAGTGACATCTCAGGCATGGG + Intergenic
1092812248 12:12282497-12282519 TTGAGTGAGATCTGAGGATTAGG + Intergenic
1094518709 12:31162405-31162427 AGGAGTGAGACCTTAGGGATGGG + Intergenic
1096966152 12:55629685-55629707 TTCAGTGAGCTCTGGGGTATAGG + Intergenic
1098180361 12:67840435-67840457 TGGACTGAGCTCTTAGGTGTTGG + Intergenic
1099249552 12:80236495-80236517 TAAAGTGAACTCTAAGGGATTGG + Intronic
1102747237 12:115259858-115259880 ATCAGTGATCTCTTAAGGATGGG + Intergenic
1104031934 12:125071092-125071114 GTGAGTGAGCTCTTGGGGACGGG - Intronic
1105323751 13:19351792-19351814 TTAAGTGAGATCATAGGGGTGGG - Intergenic
1108311511 13:49196110-49196132 TTGAGCTAGCTCTTAAAGATGGG + Intronic
1109036151 13:57263188-57263210 ATGAGTGAGCTATAAGGTATGGG - Intergenic
1113158740 13:107354952-107354974 TTGAGTGACGTCCTAGGGTTGGG - Intronic
1116510786 14:45743963-45743985 TTCAGTGAGCTCTGAGGACTAGG - Intergenic
1117066365 14:52016077-52016099 TGGAGTGAGCTGTGAGGGAGGGG - Intronic
1118001457 14:61527218-61527240 ATGAATTTGCTCTTAGGGATTGG + Intronic
1118665809 14:68067986-68068008 TTGAATGGGCTCTTAGAGAATGG + Intronic
1118735383 14:68697201-68697223 TTGGCTGAGCCCTCAGGGATGGG + Intronic
1119064231 14:71509898-71509920 TTGACTGGGCTCTTCTGGATTGG + Intronic
1119552977 14:75529726-75529748 ATGAGAGAGCTCTTATGAATAGG + Intronic
1120221708 14:81741671-81741693 TTGAATGAGGTCATAGGGGTAGG + Intergenic
1126542682 15:49840053-49840075 TTTTGTGTGCTCTTAGGGCTTGG + Intergenic
1128159935 15:65416970-65416992 TTCAGTGAATTCTTAGGGAAGGG + Intronic
1128184806 15:65635722-65635744 TTGAGTAAGCTTTGAAGGATTGG - Intronic
1128242382 15:66109802-66109824 CTGAGAGACCTCTTAGGGAGAGG - Intronic
1129659861 15:77547396-77547418 GTGAGTGCTCTCTTAGGGTTGGG + Intergenic
1131705946 15:94996290-94996312 TTAAATGAGGTCTTAAGGATGGG + Intergenic
1131812633 15:96188440-96188462 TTGAGTGCACTCTAAGGGAAAGG + Intergenic
1137908055 16:52346097-52346119 TTGAGTGACATCATAGAGATGGG + Intergenic
1140831178 16:78752997-78753019 TTCAGTAATCTCTTAGGGCTGGG + Intronic
1141616317 16:85211672-85211694 TGGAGTGAGATCCTGGGGATGGG + Intergenic
1141986579 16:87584220-87584242 AGCAGTGAGCTCTGAGGGATGGG + Intergenic
1146647007 17:34582299-34582321 TTGAGCAGGCTCTTAGGGACTGG - Intronic
1148756185 17:49974106-49974128 TTGATTTAGCTGTTAGGGTTAGG - Exonic
1149378281 17:56067510-56067532 TTGACTTAGGTCTTAGGGAAGGG - Intergenic
1151333875 17:73428714-73428736 TTGAGGTAGATCTTGGGGATGGG - Intronic
1151526398 17:74671823-74671845 ATGCGTGAGCTCTTGGGGAAGGG + Intronic
1152693260 17:81731317-81731339 TGGAGACAGCTCTTAGGGCTGGG + Intergenic
1155458016 18:26041882-26041904 GTAATTGAGCTCTTTGGGATTGG - Intronic
1156268715 18:35511890-35511912 TTGAATGAGCTCTCTAGGATAGG - Intergenic
1157392487 18:47314447-47314469 TTAAATGAGTTCTTAAGGATGGG + Intergenic
1159785611 18:72710631-72710653 TTGAGTCAGCACTTAGGGAGCGG - Intergenic
1161066793 19:2242616-2242638 TTGGGTGAGCTCAGAGAGATGGG - Intronic
1162967406 19:14162493-14162515 TCCTGTGAGCTCTTGGGGATCGG - Intronic
1167224418 19:48227915-48227937 GTGTGTGAGCTGTTAGGAATCGG + Intronic
925259665 2:2518580-2518602 TTAAGTGAGCTCTTAGACAGAGG + Intergenic
930847138 2:55918318-55918340 TAGAGTGATTTCTTAGGGAATGG - Intronic
931523665 2:63128282-63128304 TTGAGTGAGTTTCTAGGTATGGG - Intronic
934517454 2:94997798-94997820 TTTAGTGAGGTCATAAGGATGGG + Intergenic
936565143 2:113577175-113577197 CTGAGGGGGCTCTCAGGGATGGG - Intergenic
936663871 2:114572605-114572627 TTGTGTGAGCTTTCAGGGAAAGG + Intronic
937986091 2:127638766-127638788 TTGAGTGAGTGGTGAGGGATTGG + Exonic
942510764 2:176697395-176697417 TTGAGTGAGCACTTAGAAAGAGG - Intergenic
943720485 2:191198915-191198937 TTAAATGAGGTCTTAAGGATGGG - Intergenic
1169366597 20:4997591-4997613 TTAAATGAGTTCTTAAGGATGGG + Intronic
1169414786 20:5406610-5406632 TTGAGAGAGCTATGAGGGAAAGG - Intergenic
1174495182 20:50935700-50935722 GTTAGTGAGCTCTTAGGGTAGGG - Intronic
1177022878 21:15885023-15885045 TTAAGTGAGTTCATAAGGATGGG - Intergenic
1178261675 21:31105755-31105777 TTGGGAGAGCTCTTGGGGATAGG + Intergenic
1178636861 21:34311470-34311492 TTGAGTGGCCTCTTTGGGAGTGG + Intergenic
1181350541 22:22253779-22253801 TTTACTGGGCTCTTAGGGGTGGG + Intergenic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1185103219 22:48852790-48852812 TTGAGGGAGCTTTGAGGAATAGG + Intergenic
951083475 3:18480920-18480942 TTTTGTGATCTCTTAGGGAGAGG + Intergenic
952049411 3:29364971-29364993 TTTAGTTAGCTCTTAGGAACTGG - Intronic
953377174 3:42438355-42438377 TTTAGTGAGCACCTAGGGATTGG + Intergenic
954530694 3:51316468-51316490 TTGAGTGAATACTTAGGAATAGG + Intronic
957781404 3:84822040-84822062 TTGAGTGAGTTCCTTGGTATGGG + Intergenic
958128042 3:89382684-89382706 TTCAGTTAGCTCTGAGGTATAGG + Intronic
961983250 3:131104004-131104026 TTGAGTGATCAGCTAGGGATGGG + Intronic
965928214 3:174009201-174009223 ATGAGGGAGCTCTTATGAATAGG - Intronic
966711211 3:182975091-182975113 TTGATTGTGCTCTTATAGATTGG - Intronic
966843029 3:184104963-184104985 TGCAGTGAGGTCTCAGGGATGGG + Intronic
968823190 4:2872118-2872140 TTGAGTGACATCTGGGGGATGGG + Intronic
971022578 4:22552452-22552474 TTGAGTGAGCTGTTTGGAAGTGG - Intergenic
974500778 4:62698983-62699005 TTAAGTGAGATCTTAAGAATGGG - Intergenic
975492076 4:75000247-75000269 TTGATTGAGCTCTTTGTGTTAGG + Intronic
975545561 4:75557015-75557037 TATTGTGAGCTCTGAGGGATGGG - Intronic
978021714 4:103822939-103822961 TTGAGTGCACTCTGAGGTATGGG + Intergenic
979228039 4:118312833-118312855 TCTAGTGAGCTATTTGGGATAGG - Intronic
982069424 4:151682605-151682627 CTGAATGAGCTCTGAGGGACTGG - Intronic
983302672 4:165947274-165947296 TTCAGTGAAGTCTTAAGGATGGG - Intronic
984056226 4:174932662-174932684 TTGAGTGATCTTTTAGGAAGTGG + Intronic
984288701 4:177765774-177765796 CTTAGTGAGCTATTTGGGATAGG + Intronic
984292359 4:177811661-177811683 TTCAGTGAGCTATTAGAGAAAGG - Intronic
984301593 4:177926654-177926676 TTGAAAGAGCTCTTATTGATTGG + Intronic
985943983 5:3162655-3162677 TTGGGTGACCCCTTAGGGTTGGG - Intergenic
988592010 5:32557322-32557344 TTGACTGAGATCATGGGGATTGG - Intronic
988605494 5:32675443-32675465 TTGACTGAGATCATGGGGATTGG - Intergenic
990456363 5:55992773-55992795 TGGAGTGAGCATTTAAGGATTGG - Intronic
994082342 5:95721169-95721191 CTGAATGAGATTTTAGGGATGGG + Intronic
995531616 5:113096666-113096688 TTGAGTGGGCTCTTAGGTGGTGG + Intronic
1000006731 5:157192312-157192334 ATGAATGAGCTCTTTGGGTTAGG + Intronic
1004397382 6:15257515-15257537 TTGACTCATCTCTTCGGGATGGG + Intronic
1005039240 6:21587159-21587181 TTGGGGGAACTCATAGGGATGGG - Intergenic
1005572011 6:27154429-27154451 TTGATCGAGCTCTGAGGGAATGG - Intergenic
1005870475 6:29971357-29971379 CAGAGGGAACTCTTAGGGATGGG + Intergenic
1006506869 6:34494869-34494891 TTGCCTGAGCTCTGAGGGAGAGG - Intronic
1007086352 6:39149086-39149108 TTCAGTGATCTCTGAGAGATGGG + Intergenic
1007222181 6:40287379-40287401 TTAAGTGAGATCATAAGGATGGG + Intergenic
1008676583 6:53825672-53825694 TTGAGTAAACTCTGAGGGTTAGG + Intronic
1009277251 6:61698865-61698887 TTGAGTGAGCTCTGAAAGAATGG - Intronic
1012609660 6:101200607-101200629 GTGAGTGAGTTCTTATGGTTTGG + Intergenic
1013303007 6:108821714-108821736 TTGTTTAAGCTGTTAGGGATAGG + Intergenic
1015298382 6:131625408-131625430 TTGTTTGGGATCTTAGGGATTGG - Intronic
1020353630 7:7252684-7252706 TTGAGTGATTTCTTTGGGAGGGG + Intergenic
1022271840 7:28815645-28815667 TTGAGTGTTTTCTTAGGGAAGGG + Intronic
1023076354 7:36486282-36486304 TTAAGTGACCTCTCAGGGTTAGG - Intergenic
1023179454 7:37467403-37467425 TTTAGTGATCTCTTAGGCAAAGG + Intergenic
1026678952 7:72450939-72450961 TTGAGAGAACTCTAAGGGACTGG - Intergenic
1033848802 7:145469298-145469320 TTAAATGAGATCTTAAGGATGGG + Intergenic
1037127473 8:15368600-15368622 TTAAATGAGGTCTTCGGGATGGG + Intergenic
1038893888 8:31758772-31758794 TTGAGTGAGTACTTAGAAATGGG + Intronic
1040574447 8:48639144-48639166 TTGAGTGAGCACCTAAGGATAGG + Intergenic
1046021679 8:108672721-108672743 TTCAGAGAGATCTGAGGGATAGG - Intronic
1049929498 9:442659-442681 TTGACTGAGTTCTTAGTGTTTGG - Intronic
1053055335 9:34990252-34990274 TTGAGTAGGTTCTTGGGGATTGG + Intronic
1056570580 9:87811102-87811124 CTGAGAGAGCCCTTAGTGATGGG + Intergenic
1056952331 9:91052016-91052038 TTGAGTAAGATGTTAGTGATGGG - Intergenic
1057335308 9:94150525-94150547 TTCAGTGGGCTCTGAGGCATAGG + Intergenic
1058055436 9:100443977-100443999 TAGACTGAGCTCTGAGGGACTGG + Intronic
1060000193 9:119951622-119951644 TTGAATTAGCCCTTAAGGATGGG - Intergenic
1060032843 9:120230637-120230659 TTGAGAGAGCTCTTAGCAATTGG - Intergenic
1185533829 X:842145-842167 TTGACTGAGCTCCTAGGGGTGGG + Intergenic
1185533909 X:843386-843408 TTGACTGAGCTCCTAGGGGTGGG - Intergenic
1187942087 X:24392178-24392200 TTGTGTGAGCCCTGAGGGAAAGG + Intergenic
1197706224 X:129636511-129636533 CTGAGTGAGCTCAGAGGGATGGG - Intergenic
1200144711 X:153920651-153920673 TTGAGGGAGCTCTTGCGGAGGGG + Exonic
1202068749 Y:20968591-20968613 CTGTGTGTGCTCTTAGGGCTTGG + Intergenic