ID: 910900460

View in Genome Browser
Species Human (GRCh38)
Location 1:92114994-92115016
Sequence GCATCAGAGGGGGCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910900460_910900470 29 Left 910900460 1:92114994-92115016 CCCTTGAGGGCCCCCTCTGATGC 0: 1
1: 0
2: 4
3: 10
4: 144
Right 910900470 1:92115046-92115068 GGCTGGTTTCTCCAGAGAGCAGG No data
910900460_910900469 12 Left 910900460 1:92114994-92115016 CCCTTGAGGGCCCCCTCTGATGC 0: 1
1: 0
2: 4
3: 10
4: 144
Right 910900469 1:92115029-92115051 TTGATGTCATCATATTTGGCTGG 0: 11
1: 12
2: 12
3: 18
4: 178
910900460_910900467 8 Left 910900460 1:92114994-92115016 CCCTTGAGGGCCCCCTCTGATGC 0: 1
1: 0
2: 4
3: 10
4: 144
Right 910900467 1:92115025-92115047 CACCTTGATGTCATCATATTTGG 0: 1
1: 1
2: 13
3: 25
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910900460 Original CRISPR GCATCAGAGGGGGCCCTCAA GGG (reversed) Intronic
900013090 1:132728-132750 GCAGCAGAGCGGGCCCCCTACGG + Intergenic
900043156 1:488715-488737 GCAGCAGAGCGGGCCCCCTACGG + Intergenic
900064593 1:723712-723734 GCAGCAGAGCGGGCCCCCTACGG + Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
906238935 1:44229661-44229683 GCATTAGGGCGGGCCCACAAGGG - Intronic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
907933705 1:59023009-59023031 GCATAAGAGGGGTCATTCAATGG + Intergenic
908101540 1:60796330-60796352 ACATCAGAGGGGGAACTCAGAGG + Intergenic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
911121688 1:94302810-94302832 GCATCGGAGGGGGCCATCGGGGG + Intergenic
912904812 1:113693159-113693181 TCATCAGAGAAGGCCCTCTAAGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913499865 1:119462222-119462244 ACATCAGAGGATCCCCTCAAGGG - Intergenic
913510688 1:119558944-119558966 GCATCAGAGGGTCCCCATAAGGG - Intergenic
913537306 1:119785519-119785541 GCGTGAGAGGGGGACCTGAAGGG - Intergenic
915200254 1:154221458-154221480 GGATCAGAGGAGGCCCGCAGTGG - Intronic
919852052 1:201679394-201679416 TCAGCAGAGGGGGTCCTCAGGGG - Intronic
921096022 1:211887989-211888011 GGATCAGAGGTGGCCCACAAGGG - Intergenic
922820281 1:228479979-228480001 ACATAAGAGGGGGCCCACACAGG - Intergenic
922871092 1:228902480-228902502 GCATCAGTGGTTGCCCTCCATGG - Intergenic
924342693 1:243051400-243051422 GCAGCAGAGCGGGCCCCCTACGG + Intergenic
924553957 1:245103164-245103186 GGATCAGAGGTGGTCCTCTATGG + Intronic
924553974 1:245103252-245103274 GGATCAGAGGTGGTCCTCTATGG + Intronic
924553994 1:245103341-245103363 GGATCAGAGGTGGTCCTCTATGG + Intronic
924554011 1:245103429-245103451 GGATCAGAGGTGGTCCTCTATGG + Intronic
924554031 1:245103518-245103540 GGATCAGAGGTGGTCCTCTATGG + Intronic
924554048 1:245103606-245103628 GGATCAGAGGTGGTCCTCTATGG + Intronic
1066733786 10:38454154-38454176 GCAGCAGAGTGGGCCCCCTACGG - Intergenic
1067251399 10:44589879-44589901 ACATCAGCGGGGGCCATGAAGGG - Intergenic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1069609020 10:69759914-69759936 GCACCAGAGGGGTCTCCCAAGGG + Intergenic
1071763743 10:88638012-88638034 GCAACATAGGCAGCCCTCAAAGG - Intergenic
1073096237 10:100981686-100981708 GCTTCAGAGAGGTCCCTCATGGG - Intronic
1074219350 10:111421023-111421045 GGATCATACAGGGCCCTCAAAGG - Intergenic
1076864792 10:133161244-133161266 GCATGAGAGGTGGCCCCCAGGGG + Intronic
1076969427 11:124932-124954 GCAGCAGAGCGGGCCCCCTACGG + Intergenic
1079340363 11:19606655-19606677 CCCACAGAGGGGGACCTCAAAGG + Intronic
1080317362 11:30965434-30965456 GGATCAGAGAGGGCCTTGAAGGG + Intronic
1080606340 11:33868400-33868422 GGATTAGAGGGGGACTTCAAAGG + Intronic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1083803482 11:65059853-65059875 ACATCTGAGGGGGTCCTCCAAGG + Intergenic
1084962200 11:72722743-72722765 GTATCAGAGGGGGACACCAAAGG + Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1096578462 12:52569474-52569496 CCCTCAGAGGGGGCACCCAAAGG + Intronic
1103716398 12:122947747-122947769 GCATCACAGCGGGCCCGCGATGG + Intronic
1104970068 12:132527135-132527157 GTACCAGATGGAGCCCTCAAAGG - Intronic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1105637338 13:22228165-22228187 GAATGAGAGGTGGCTCTCAAAGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1110235932 13:73218202-73218224 GGATCAGAGGGGGTGCTCAGGGG - Intergenic
1115349876 14:32382320-32382342 GCATCAGAGTGGGACATCACAGG + Intronic
1119198787 14:72737784-72737806 GCATCAGAGGGAGCCCATGATGG - Intronic
1121273273 14:92651830-92651852 GCATCAGAGGTGGGCGGCAAAGG - Exonic
1122829061 14:104386852-104386874 GCAGCAGAGAGGGACCTCAGGGG - Intergenic
1124387516 15:29222726-29222748 GCTTCCGAGGGGGCCCTGCAGGG + Intronic
1125469353 15:39987249-39987271 GCATCAGAGGGGGCCTTGTGAGG + Intronic
1125510221 15:40288712-40288734 GCATCAGAGGCGGCTCTCCTGGG + Exonic
1129185706 15:73905035-73905057 GCAGCAGAGGGGGCCCAGGAGGG + Intergenic
1129851616 15:78797018-78797040 GCCTCACAGGGGGACCTCAAAGG + Intronic
1130068383 15:80626119-80626141 CCATCACAGGGGGCCCTGCAAGG + Intergenic
1130251372 15:82302075-82302097 GCCTCATGGGGGGACCTCAAAGG - Intergenic
1133008902 16:2899399-2899421 GCATCAGAGCTGAGCCTCAAAGG - Intergenic
1134848130 16:17458490-17458512 ACATCAGAGAGGGCCTCCAATGG + Intronic
1140479440 16:75254450-75254472 ACCTCAGAGGTGGCCCTCATGGG + Intronic
1142386735 16:89770118-89770140 CCCTCAGAGTGGGCCCCCAAGGG + Intronic
1142451245 16:90174190-90174212 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
1144725763 17:17501563-17501585 GCATGAGAGGTGGCCATCCAGGG + Intergenic
1145790837 17:27625611-27625633 GGAACAGAGGGGGCCATCATGGG - Exonic
1146931757 17:36782818-36782840 ACATAAGAGAAGGCCCTCAAAGG - Intergenic
1147371576 17:39996471-39996493 GCAGCACAGGGGGCCCAGAATGG + Intronic
1150227814 17:63533367-63533389 GCCTCAGAGAGGGCACTCACTGG + Intronic
1152644942 17:81464444-81464466 AGATCAGAGGGTGCCGTCAAGGG - Exonic
1153341305 18:3977836-3977858 GCATCAGAGGGGACCCTTGAGGG - Intronic
1155844984 18:30695043-30695065 GCTTGAGATGGGGCCCTCACTGG + Intergenic
1160646232 19:194858-194880 GCAGCAGAGCGGGCCCCCTACGG + Intergenic
1166755434 19:45187774-45187796 GCATCAGTGGGGGTCCTGGAAGG - Intronic
925293443 2:2763156-2763178 GGCCCTGAGGGGGCCCTCAAGGG + Intergenic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
927704035 2:25286198-25286220 GCCTCAGAGCCGGCCCTCATAGG - Intronic
934099176 2:88635719-88635741 GCATGCGAGGGGACCCCCAAGGG - Intergenic
937337659 2:121071713-121071735 GGAGCAGAGGAGGCCCTAAAAGG - Intergenic
937486017 2:122315599-122315621 GCACCAGATGGGGGCCTCAAAGG - Intergenic
937702508 2:124879911-124879933 GCTTCAGAGGGGTCCCTATAAGG - Intronic
938370409 2:130764585-130764607 GCCACAGAGGAGGCCCTCACGGG - Exonic
939037083 2:137145590-137145612 GCAGCATGGGGGGCTCTCAATGG - Intronic
945972740 2:216246123-216246145 GCAGCAGGGTGGGCCCTAAAGGG - Intergenic
946321333 2:218956108-218956130 GCTTTAGAGGGGCCCCTGAAAGG - Intergenic
947593881 2:231399209-231399231 ACATCTGAGGGGGCCAGCAACGG - Exonic
948787646 2:240361139-240361161 GCATCTGAAGGCGCCCTCCACGG + Intergenic
1168889338 20:1284117-1284139 GCACCAGAGGGTCCCCTCTAAGG - Intronic
1169279339 20:4253898-4253920 GCATGAGAGGGAGGCCTCGAGGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1171371096 20:24662461-24662483 GCATCAGACGTAGCCCCCAAGGG - Intronic
1175753095 20:61512729-61512751 TCATCAGCGGCGGCCCCCAAGGG - Intronic
1176072214 20:63233138-63233160 GCATCACAGGGGGCCCTCCTAGG + Intergenic
1176279274 20:64291358-64291380 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
1178725014 21:35043759-35043781 GCAGCAGAGGAGGCCCACACAGG - Intronic
1179783314 21:43716348-43716370 GCAACACAGTGTGCCCTCAAAGG - Intergenic
1183829206 22:40409073-40409095 GCATCAGGGGGGGTCCTTACAGG + Intronic
953335117 3:42088012-42088034 GCACAAGAGAGGGCTCTCAATGG + Intronic
953837293 3:46357813-46357835 GCAGCAGAGTGAGCCCACAATGG - Exonic
955648986 3:61172784-61172806 GCATCAGTGGGGGCTCTCAGGGG - Intronic
961524994 3:127490929-127490951 AAATCAGAGGGGATCCTCAAGGG + Intergenic
962271358 3:133980128-133980150 GCATTAGAGGTGGGCCTCAGAGG - Intronic
964163295 3:153671584-153671606 GCAGCAGAGGGTGTCCTGAAGGG - Intergenic
964753119 3:160070309-160070331 GCATGAGAGGGAGACCCCAAGGG - Intergenic
968371449 3:198224668-198224690 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
969401894 4:6961339-6961361 CCATCAAAGGGTGCCCTGAAAGG - Intronic
969879187 4:10158969-10158991 GAATCTGAGGGGACCCACAAAGG - Intergenic
969967812 4:11014818-11014840 ACATCAGTCAGGGCCCTCAAAGG - Intergenic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977291384 4:95168565-95168587 GCACCAGAAGGGTCCCTCCAAGG + Exonic
979260134 4:118637141-118637163 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
979328242 4:119403487-119403509 GCAGCAGAGCGGGCCCCCTACGG + Intergenic
983026971 4:162750035-162750057 GGAACAGAGGAGGCACTCAATGG + Intergenic
990577605 5:57138228-57138250 GAATCAGAGGAGCCCTTCAAGGG - Intergenic
995853908 5:116573812-116573834 GGAGCAGAGCGGGCCCTAAATGG - Intronic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1002730687 5:181330214-181330236 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
1002753843 6:143890-143912 GCAGCAGAGCGGGCCCCCTACGG + Intergenic
1006043014 6:31270910-31270932 AGAGCAGAGGGGGCCCTCAGAGG + Intronic
1006502003 6:34465426-34465448 GCCTAATAGGGGACCCTCAACGG - Intergenic
1007094112 6:39202854-39202876 GAATCAGAGGGGTCTCTCGATGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1017747780 6:157462024-157462046 GCACCAGAGGGGGCTCTGCAGGG + Intronic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1018960343 6:168442920-168442942 TCCCCAGAGGGGGCCCTCAGAGG + Intronic
1020033691 7:4951038-4951060 GCATAAGAGAGTGCCCTGAAGGG + Intronic
1020283264 7:6662237-6662259 GCAGCAGAAAAGGCCCTCAATGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1020603921 7:10311018-10311040 GCATAAGAGATGGCACTCAAAGG + Intergenic
1023401849 7:39796742-39796764 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
1025051608 7:55738407-55738429 GCAGCAGAGCGGGCCCCCTATGG + Intergenic
1025694841 7:63769429-63769451 GCAGCAGAGTGGGCCCCCTACGG - Intergenic
1026616330 7:71908176-71908198 GCAACAAAGGGGGCCACCAAAGG - Intronic
1029906998 7:104102332-104102354 GCATCAGTTGGGTCCCTCACTGG + Intergenic
1032052362 7:128657134-128657156 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
1032759616 7:134927718-134927740 GCAAAAGAGGGGGGCCTTAAAGG + Intronic
1034172378 7:149072138-149072160 GCACCAGAGAGGCCACTCAAAGG - Exonic
1039469123 8:37802737-37802759 GCAGCAGAGGGAGCTCTCAGGGG - Intronic
1041087232 8:54268232-54268254 GCATCTGAGTGGGCCCTCACTGG - Intergenic
1046524637 8:115368984-115369006 TAATCAGTGGGGACCCTCAATGG - Intergenic
1048822912 8:138396186-138396208 GCAGCAAATGGGGCCCTCAGAGG - Intronic
1055328227 9:75154422-75154444 GCAACAGAGGAGACCCACAAAGG - Intergenic
1059021440 9:110580328-110580350 TGATCTGAGGGGGCCCTTAAGGG - Intergenic
1059247983 9:112864577-112864599 GCAGCAGAGGGGGTGCTCACAGG + Intronic
1060589611 9:124808569-124808591 GCATTAGAGGGAGCACTGAAGGG + Intronic
1062015567 9:134289487-134289509 CCACAAGAGGGGGCCCTCAGAGG - Intergenic
1062372803 9:136248870-136248892 GCATCAGAGTGGGCCCTCCTGGG - Intergenic
1062755096 9:138282724-138282746 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
1203579004 Un_KI270745v1:26893-26915 GCAGCAGAGCGGGCCCCCTACGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1196738331 X:119000565-119000587 GCCCCAGAGGTGGCCCCCAATGG - Intronic
1197335033 X:125203115-125203137 GCATCGGGTGGGGCCCTCGACGG + Intergenic
1200143188 X:153912310-153912332 GCATCAGAGGGGGCCAGGCACGG - Intronic