ID: 910905945

View in Genome Browser
Species Human (GRCh38)
Location 1:92178657-92178679
Sequence TTGTTGTTATTGTTGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32967
Summary {0: 3, 1: 205, 2: 512, 3: 2383, 4: 29864}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910905945 Original CRISPR TTGTTGTTATTGTTGAGACA GGG Intronic
Too many off-targets to display for this crispr