ID: 910912538

View in Genome Browser
Species Human (GRCh38)
Location 1:92253056-92253078
Sequence TTCTATATGAATTAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910912538_910912541 5 Left 910912538 1:92253056-92253078 CCTTTCTTCTAATTCATATAGAA No data
Right 910912541 1:92253084-92253106 CCGGCTCTGCAAATATTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910912538 Original CRISPR TTCTATATGAATTAGAAGAA AGG (reversed) Intronic
No off target data available for this crispr