ID: 910916051

View in Genome Browser
Species Human (GRCh38)
Location 1:92290583-92290605
Sequence AGATTCTCAGGGGCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910916046_910916051 -2 Left 910916046 1:92290562-92290584 CCACTCTGAAATTGCCTTAACAG No data
Right 910916051 1:92290583-92290605 AGATTCTCAGGGGCTCCAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 206
910916044_910916051 16 Left 910916044 1:92290544-92290566 CCTTTGAGCTTCACCTGTCCACT No data
Right 910916051 1:92290583-92290605 AGATTCTCAGGGGCTCCAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 206
910916045_910916051 3 Left 910916045 1:92290557-92290579 CCTGTCCACTCTGAAATTGCCTT No data
Right 910916051 1:92290583-92290605 AGATTCTCAGGGGCTCCAGCAGG 0: 1
1: 0
2: 3
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910916051 Original CRISPR AGATTCTCAGGGGCTCCAGC AGG Intronic
900081438 1:861024-861046 TGATCATCAGGGGCACCAGCTGG + Intergenic
900822305 1:4898993-4899015 AGACACTCAGGGACTCCTGCAGG + Intergenic
901544250 1:9943525-9943547 AGTTTCTCAGGGGCTCCTTGCGG - Intronic
904159349 1:28511294-28511316 AGATTCTTAGGGTCTCTAGATGG + Intronic
905376526 1:37525020-37525042 AGGTTTTCAGGGACTCCAGCTGG + Intergenic
905851719 1:41279709-41279731 AGAGCTTCAGGGGCCCCAGCTGG - Intergenic
910478011 1:87628189-87628211 AAATTATCAAGGGCCCCAGCTGG + Intergenic
910593711 1:88955481-88955503 GGAGTGTCAGGGGCACCAGCAGG + Intronic
910916051 1:92290583-92290605 AGATTCTCAGGGGCTCCAGCAGG + Intronic
913021741 1:114795130-114795152 AGACTATCTGGGACTCCAGCTGG - Intergenic
915071722 1:153274139-153274161 AGGTTTTCTGGGACTCCAGCTGG + Intergenic
915646957 1:157279255-157279277 AGATTCTCTGGGTCTTCGGCAGG + Intergenic
918853618 1:189722695-189722717 ATATTCTCAGGGTCTCCTGAGGG + Intergenic
919855568 1:201703995-201704017 AGTTTCCAAGAGGCTCCAGCTGG - Intronic
920520983 1:206626085-206626107 AGATTCTCAGAGTCTCCAGAAGG + Intergenic
920931044 1:210388315-210388337 TGATTCTCAGAGGTTCCCGCAGG + Intronic
922000788 1:221476203-221476225 ACATGCTCAGGGTCTTCAGCTGG - Intergenic
922412814 1:225392234-225392256 TGAGTCTCAGGGCCTCCTGCTGG - Intronic
1067840190 10:49669577-49669599 AGAGCCTCAGTGGCTCCAGCTGG + Intergenic
1068596625 10:58909019-58909041 ACACTCTCAGTGGATCCAGCAGG - Intergenic
1070637239 10:78139395-78139417 AGCGCCGCAGGGGCTCCAGCAGG - Intergenic
1071057184 10:81525363-81525385 AGGTTTTCTGGGACTCCAGCCGG + Intergenic
1071345082 10:84684851-84684873 GCATTCTCAGGGGCTCCTGTTGG - Intergenic
1073117407 10:101099329-101099351 AGCTTCCCTGGGTCTCCAGCAGG - Intronic
1074109380 10:110411573-110411595 ACATTCCCAGGGGCTCCCTCTGG - Intergenic
1075271876 10:121059486-121059508 AGAGTCTCCCTGGCTCCAGCAGG - Intergenic
1075342873 10:121661457-121661479 ACTTTCTCAGAGGCTGCAGCAGG - Intergenic
1075649541 10:124118663-124118685 AGAATCTCTGGGGCTGGAGCTGG + Intergenic
1076109550 10:127850370-127850392 TGATTGTCACGGGCTCCAGGGGG - Intergenic
1077927323 11:6694786-6694808 ACCTCCTCAGGGGCTCCACCTGG - Intergenic
1080233841 11:30046554-30046576 AGATCAACAGGGGCCCCAGCGGG + Intergenic
1080581807 11:33650549-33650571 GGCTTCTCAGGGACACCAGCTGG - Intronic
1080804164 11:35636604-35636626 AGATTCTCAGGTGTTTCTGCAGG - Intergenic
1081600000 11:44486348-44486370 AGATTCCCATGGGCTCCCCCAGG + Intergenic
1082846665 11:57731543-57731565 ATATTCTCAGGACCTCCAGAGGG + Intronic
1084234071 11:67775052-67775074 AGAGTCCCAAGGCCTCCAGCTGG + Intergenic
1085765514 11:79278500-79278522 AGGTTCTCAGCGGCTCCTGCTGG - Intronic
1089618556 11:119709303-119709325 AGATTCTCAGGGGCTGAGACAGG - Intronic
1090824066 11:130371245-130371267 AGGTTCTCAGGCGCTCCTCCTGG + Intergenic
1093152267 12:15636483-15636505 AGACTCTCAGGGACACCAGGTGG + Intronic
1094142117 12:27192122-27192144 AGATTCTAAGGGTCAGCAGCTGG - Intergenic
1096244904 12:49979130-49979152 TGAATCTCAGTAGCTCCAGCTGG + Intronic
1096685933 12:53288303-53288325 AGATCCTCAGGGGCTCTGACGGG + Exonic
1099795019 12:87388628-87388650 AGGTTTTCTGGGACTCCAGCTGG + Intergenic
1099958160 12:89371360-89371382 AGATGCACAGAGGCTCCAGTTGG - Intergenic
1102614178 12:114138665-114138687 GGCTTATGAGGGGCTCCAGCAGG - Intergenic
1102960989 12:117093161-117093183 AGAAGCTCAGGGGTTCCAGGGGG - Intronic
1103851694 12:123937532-123937554 AGAAGCTCATGAGCTCCAGCGGG - Exonic
1103959983 12:124603383-124603405 GCATTCTCAGGGCCTCCAGGAGG + Intergenic
1104026747 12:125033023-125033045 AGCTGCTCTGGGGCTGCAGCGGG - Intergenic
1104519625 12:129461327-129461349 AGAATCTCAGGGGATGCAGATGG + Intronic
1104546513 12:129718061-129718083 AGCTGCTCAGGGGCCCTAGCAGG - Intronic
1104591517 12:130087799-130087821 AGATTCTCATCATCTCCAGCTGG - Intergenic
1108623285 13:52204499-52204521 AGTTTAGCAGGGGCTCCTGCCGG + Intergenic
1108663443 13:52606538-52606560 AGTTTAGCAGGGGCTCCTGCTGG - Intergenic
1109459955 13:62643607-62643629 AGATTTCCTGGGTCTCCAGCTGG + Intergenic
1115476716 14:33821460-33821482 ATGTTCTCAGGGGCTCCTGAGGG + Intergenic
1117019296 14:51552908-51552930 AGGTTCTCAGTGGCTCCTGCAGG + Intronic
1118600759 14:67470206-67470228 ACTTTCTCAGGGGCTCCTGGAGG - Intronic
1118860138 14:69656482-69656504 ATATACTCAGAGGCCCCAGCTGG - Intronic
1119647312 14:76357035-76357057 AGCTTGGCAGGGGCACCAGCAGG - Intronic
1119781137 14:77277555-77277577 AATTTCTCTGGAGCTCCAGCAGG - Intronic
1122406806 14:101505651-101505673 AGAGTCTCAGAGGATCTAGCAGG + Intergenic
1202890949 14_KI270722v1_random:156881-156903 AGGTTTTCTGGGACTCCAGCTGG + Intergenic
1125487638 15:40123394-40123416 AGATCCTCTGGGGCTCAGGCAGG - Intergenic
1125920663 15:43523646-43523668 ACATGCTCAGTGGCTCCTGCAGG - Exonic
1125971122 15:43912670-43912692 AGATTCTGACGGGCTCCCCCTGG - Intronic
1126358494 15:47821565-47821587 AGACTCTGAGGGTTTCCAGCAGG - Intergenic
1128082341 15:64864143-64864165 AGAGCCTCAGAGGCCCCAGCAGG - Intronic
1128318756 15:66678193-66678215 AGATCGTCAGGGGCTCCTGGGGG - Intronic
1128787317 15:70407262-70407284 TGATTCTCCCAGGCTCCAGCAGG + Intergenic
1129965926 15:79735539-79735561 GGAGTCTCATTGGCTCCAGCTGG - Intergenic
1130071651 15:80651436-80651458 AGATTCTCAGGGGCTAAGGAAGG + Intergenic
1131872706 15:96778231-96778253 GGAGTCTCAGGGGCTCCTGAAGG - Intergenic
1131888513 15:96946959-96946981 TGACTCTCAAAGGCTCCAGCTGG + Intergenic
1132844559 16:1993840-1993862 AGAGGCCCAGAGGCTCCAGCTGG + Exonic
1133916954 16:10117703-10117725 AAAAGCTCAGGGGCTACAGCTGG + Intronic
1136254411 16:29028765-29028787 CCATTCTCAGGGGCTCTGGCTGG + Intergenic
1140259518 16:73365266-73365288 AGATTGCCTGGGGCTGCAGCAGG + Intergenic
1140916799 16:79501123-79501145 AGTTTCTCAGGGTCTCCAGAGGG - Intergenic
1143473104 17:7188444-7188466 TGATTCTCAGGTGCTCCAGTGGG - Intergenic
1143914046 17:10275813-10275835 GGAGTCACAGGGGCTCCATCAGG - Intergenic
1144764930 17:17727468-17727490 AGCCTGTCTGGGGCTCCAGCTGG - Intronic
1144848875 17:18234090-18234112 AGATTCTCATTGGCTACAGCCGG + Exonic
1145127772 17:20316029-20316051 AGCTGCTCAGGAGCTCCCGCAGG - Intronic
1146492573 17:33292889-33292911 AGCTTCTCAGGGCGTCCTGCGGG + Exonic
1147459756 17:40560688-40560710 AAATCCTCAGGGGCTCTAACCGG + Intronic
1148989126 17:51650138-51650160 AGGTTTCCAGGGGCTTCAGCAGG + Intronic
1150173790 17:63028308-63028330 CTACTCTCAGGGTCTCCAGCTGG + Intronic
1151364121 17:73606212-73606234 ACGTTCTCAGGGGCAGCAGCAGG + Intronic
1152574679 17:81134798-81134820 AGGGTCTCAGGGGCTACAGGGGG + Intronic
1157035485 18:43968124-43968146 ACAATCTCCAGGGCTCCAGCCGG - Intergenic
1158493108 18:57928312-57928334 AGGTTGTCATCGGCTCCAGCAGG + Intergenic
1159443841 18:68514883-68514905 ATATTCTTTGGGGATCCAGCAGG - Intergenic
1161016861 19:1987517-1987539 AGAGTCGCTGGGGCTACAGCGGG - Exonic
1161221609 19:3120515-3120537 AGACATCCAGGGGCTCCAGCAGG - Intronic
1161739771 19:6013699-6013721 AGCTACTCAGAGGCTGCAGCAGG - Intronic
1163061060 19:14762094-14762116 ATGTTCTCAGGGGCTCCTGAGGG + Intronic
1164120605 19:22261916-22261938 AGACTCGCTGGGCCTCCAGCAGG - Intergenic
1164519665 19:28969008-28969030 AGTTTCTCCAGAGCTCCAGCTGG - Intergenic
1166259841 19:41630093-41630115 AGGTTTTCTGGGGCTCCAGCTGG - Intronic
1166985961 19:46660268-46660290 GGAATCTCAGGGCCTCCAGAGGG - Intronic
1167953730 19:53047799-53047821 AGATTCCAAGGGGATCCAGGAGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1202666370 1_KI270708v1_random:123719-123741 AGGTTTTCTGGGACTCCAGCTGG + Intergenic
926763896 2:16305409-16305431 AGATTCTCAAGGTCTCCACTTGG + Intergenic
928373999 2:30760415-30760437 AGATACTCAGGGGCTCCAGTGGG + Intronic
929054687 2:37865834-37865856 GGATTCGCTGGGGCCCCAGCTGG + Intergenic
929677697 2:43953813-43953835 AGATTCTCAGAGCTTCTAGCTGG + Intronic
929849666 2:45573841-45573863 ATTTTCTCAGTGGCTCCAGCAGG - Intronic
930619535 2:53629657-53629679 AGAGGCTCAGGGTTTCCAGCTGG - Intronic
932890843 2:75596351-75596373 AGCTTCTCATGGGTTCCAGGGGG + Intergenic
935399045 2:102641197-102641219 AGTTTGTCAGGGGCCTCAGCAGG + Intronic
935625272 2:105167287-105167309 AGATTCTCAGGGGCTCATGAGGG - Intergenic
936160848 2:110083268-110083290 GGCTTCTCAGAGGCCCCAGCAGG - Intergenic
936183815 2:110288086-110288108 GGCTTCTCAGAGGCCCCAGCAGG + Intergenic
936625978 2:114149876-114149898 TGATTCTCTGTGGCTCCACCTGG + Intergenic
938724836 2:134098132-134098154 AGTTTCTCAGGGGCTCTTGTTGG + Intergenic
938892754 2:135722140-135722162 AGATTATCACTGGCTCCATCAGG + Intronic
943440172 2:187917978-187918000 AGATTTTCTGGGACTCCAGCTGG + Intergenic
946147081 2:217739168-217739190 AGAATCTCAGTTTCTCCAGCTGG + Intronic
946455335 2:219821018-219821040 AGATTAGCAGGGGCTGCAGATGG - Intergenic
947581918 2:231325532-231325554 AGAGCCTCAGAGGCCCCAGCTGG - Intronic
947761430 2:232606365-232606387 AGATTCTCTGGGAGACCAGCCGG - Intronic
948460924 2:238129536-238129558 AGATTCTCAGTGGCTCCCCACGG - Intronic
1171374883 20:24685634-24685656 AGGTTCCCTGGGGCTCCAGCTGG + Intergenic
1173113063 20:40213483-40213505 AGCTACTCAGGGGCTGAAGCAGG + Intergenic
1173115705 20:40241002-40241024 AGTCTCTCAGGGGCCCCAGTGGG + Intergenic
1173815619 20:45985921-45985943 AGATAGCCAGGGGCTTCAGCAGG + Intergenic
1174048894 20:47753763-47753785 GGAGCCTCTGGGGCTCCAGCAGG - Intronic
1175504928 20:59475390-59475412 AGATTCACACGGACTCCCGCAGG + Intergenic
1176100779 20:63363533-63363555 CGTGTCACAGGGGCTCCAGCAGG - Intronic
1177160239 21:17539366-17539388 AGATTCTCAGGGGATCTACAAGG + Intronic
1179543861 21:42101349-42101371 AGATTCACAGGGGCCCCAACTGG + Intronic
1179589411 21:42396349-42396371 AAATCCACAGGGGCTCCAGCAGG + Exonic
1180121692 21:45755124-45755146 CGATTGTCAGGGGCTTCAGAAGG - Intronic
1180125898 21:45790159-45790181 AGTCTCTCAGGGGATCCAGTGGG + Intronic
1180157668 21:45985987-45986009 AGATGCTCAGCGTCCCCAGCAGG + Intronic
1182477355 22:30583386-30583408 AGATTATCAGGGGCTCCAGGGGG - Intronic
1183500367 22:38175212-38175234 GGATGAGCAGGGGCTCCAGCAGG - Intronic
1184837929 22:47035123-47035145 AGATACTCAGTTGCTACAGCAGG - Intronic
1185316321 22:50180776-50180798 AGACTCTCAGGGTCACCTGCCGG - Intergenic
952979949 3:38726626-38726648 AGATGCTCAGAGCTTCCAGCAGG - Exonic
954235639 3:49255185-49255207 TGATTCTCAGAGTCCCCAGCAGG + Intronic
954600690 3:51865509-51865531 AGGTTTTCTGGGACTCCAGCTGG + Intergenic
957933734 3:86915338-86915360 CTATTCTCAGGGTCTCCAACAGG + Intergenic
959017737 3:101154838-101154860 AGCATCTCAGGGTCTCCAGCTGG - Intergenic
959999488 3:112715650-112715672 AGTTTTTCCGGGTCTCCAGCTGG + Intergenic
960785717 3:121371528-121371550 AGACTCTCATTGGCTGCAGCAGG + Intronic
960987909 3:123292460-123292482 ACATTCCCAGGGACTCCAGGAGG - Intronic
961668446 3:128508947-128508969 AGATTCTCATTAGCTTCAGCTGG + Intergenic
963433233 3:145235919-145235941 ATGTTCTCAGGGCCTCCTGCGGG + Intergenic
969584107 4:8082145-8082167 AATTACTCAGGGGCTCCTGCAGG - Intronic
969945937 4:10783190-10783212 AGATTCTCAGAGCCTCCAAAAGG + Intergenic
970398515 4:15695659-15695681 GGACTCTCTGGGCCTCCAGCCGG + Intronic
973343699 4:49031641-49031663 AGATTCTCAGGGGCAAGAGTGGG + Intronic
973571348 4:52242909-52242931 ACATACTTTGGGGCTCCAGCAGG - Intergenic
973766758 4:54169950-54169972 AGATACTTAGGGGTTCCAGGAGG - Intronic
974362755 4:60903497-60903519 AGATACTCAGGGGCTGAGGCGGG - Intergenic
977431736 4:96938874-96938896 AGCTTCTCAAGGGATCCAACTGG - Intergenic
979777120 4:124603827-124603849 AGATTCACAGAGCCTCCAGGAGG - Intergenic
980294109 4:130887990-130888012 AGATTTTCTGGGACTTCAGCTGG - Intergenic
982202442 4:152973686-152973708 AGTTTCTGTGGGGCTCTAGCCGG - Intronic
984455667 4:179965276-179965298 GGGTCCTCAGGGTCTCCAGCAGG - Intergenic
984620208 4:181944198-181944220 AGCTTTCCTGGGGCTCCAGCTGG - Intergenic
985069150 4:186151081-186151103 TGATTCTCAGGGGAGCCGGCAGG + Intronic
988226696 5:28422243-28422265 AGGTTTTCTGGGACTCCAGCTGG - Intergenic
999392332 5:151202622-151202644 AGATGCTCATGGGCCCCAGCAGG - Intronic
1000177082 5:158767600-158767622 AGATTCTCAGGGGTGGCACCAGG + Intronic
1000252303 5:159507099-159507121 TCATTCTCAGCGGCTCCAGCAGG + Intergenic
1002595423 5:180318722-180318744 AGAGTGTCAGGAGCTCCACCAGG + Intronic
1005123453 6:22417902-22417924 ACATGCTCAGGGGCTACAGTGGG + Intergenic
1005796581 6:29368953-29368975 AGATGCTCAGGGGTTGAAGCAGG - Intronic
1007777629 6:44232718-44232740 AGATCCTGAGGGGCCCCAGATGG + Intronic
1008828612 6:55730575-55730597 AATTTCTCATGGGCTCCATCAGG + Intergenic
1018005393 6:159617401-159617423 AGATTCTCAGTGAGTCTAGCAGG - Intergenic
1018362101 6:163081320-163081342 AGATTATCAGGGACTACAGCAGG + Intronic
1019505554 7:1388784-1388806 AGCCTCACAGGGTCTCCAGCTGG - Intergenic
1020061521 7:5156020-5156042 ACATCCTCAGAGGCTCCTGCAGG + Intergenic
1020166636 7:5812640-5812662 ACATCCTCAGAGGCTCCTGCAGG - Intergenic
1020502146 7:8936996-8937018 GAACTCTCAGGGGCTGCAGCTGG - Intergenic
1021311880 7:19106867-19106889 AGGTTATCAGCGGCTCCAGATGG + Intronic
1021349869 7:19578737-19578759 AAATTCACAGGGACTCCATCTGG + Intergenic
1022360865 7:29655881-29655903 AGCTACTCAGGGGCTGAAGCAGG + Intergenic
1022740472 7:33115110-33115132 ATATTATCTGGGACTCCAGCTGG + Intergenic
1022993343 7:35729679-35729701 ATAATCTCAGAGCCTCCAGCAGG + Intergenic
1023725105 7:43135264-43135286 GCATTCTCAGGAGCTCCACCTGG - Intronic
1024205274 7:47153952-47153974 AGAGGCTCAGGTGCTCGAGCTGG - Intergenic
1030396282 7:108990682-108990704 ATATTCTCAGGAGCTCCTGAGGG - Intergenic
1031081030 7:117257054-117257076 ACATTCTCAAGGACTCCAGAGGG + Intergenic
1031922813 7:127613947-127613969 TGAGTCTCTGGGGCTGCAGCCGG + Intronic
1032185020 7:129717326-129717348 AGCTTCTCAGGAGATGCAGCAGG + Exonic
1033131522 7:138749536-138749558 AGATTGTCAGAGACTCCAGAGGG - Intronic
1033258033 7:139818753-139818775 ACGTTCTCAGAGGGTCCAGCTGG + Intronic
1034887177 7:154806829-154806851 GTGGTCTCAGGGGCTCCAGCAGG + Intronic
1035097216 7:156365415-156365437 AGATTCTCCGTGGCACCACCGGG + Intergenic
1035523824 8:296449-296471 TGATCATCAGGGGCACCAGCTGG - Intergenic
1035959604 8:4122668-4122690 AGACCCTCAGGGGCTGCAGCTGG + Intronic
1039395385 8:37221075-37221097 AGACTCCCAGGGGCTCCCTCTGG + Intergenic
1039606353 8:38884047-38884069 AGACCCTCAGGGGCTCCCTCGGG + Intergenic
1040500185 8:47998603-47998625 AGATTCTCTGGGACTTCGGCAGG + Intergenic
1040921896 8:52629948-52629970 ATGTTCTCAGGGGCTCCTGAGGG + Intronic
1040933587 8:52760786-52760808 AGATTTTCTAGGACTCCAGCTGG + Intergenic
1041003083 8:53470866-53470888 AGATTTTCAGGGGCTCCAGGTGG + Intergenic
1043022940 8:75027159-75027181 AGTTTCTCAAGGGCAGCAGCTGG + Intronic
1043749023 8:83911743-83911765 AGATTTTCTGGGACTCCAGCTGG + Intergenic
1044908089 8:97026672-97026694 AGCTTCTCAAGGGCTTGAGCAGG + Intronic
1045553479 8:103193310-103193332 AGATACTAAGGGGCCCCAGGAGG - Intronic
1047775704 8:128068606-128068628 AGCTTCTCAGGGGCTGAGGCAGG - Intergenic
1048309723 8:133311784-133311806 AGATTCTCCAGGGCCCCAACTGG - Intergenic
1048368110 8:133756256-133756278 AGATCCACAGAGGCTCCTGCAGG - Intergenic
1053013430 9:34648175-34648197 AGGGTGTCAGGGGCTCCAGTGGG + Intronic
1053294021 9:36900464-36900486 AGATGCTCAGGGTCTCCAAGAGG - Intronic
1055086357 9:72318106-72318128 AGATACTCAGGGGCTTAGGCAGG - Intergenic
1056937470 9:90927386-90927408 AGATTCCCCTGGCCTCCAGCTGG + Intergenic
1060949171 9:127590037-127590059 AGATTGTCAGGAGCAACAGCAGG - Intergenic
1062062792 9:134505514-134505536 AGACGCTCATGGACTCCAGCAGG - Intergenic
1062478167 9:136739788-136739810 CGATTCTCAGGGGCGGCAGGAGG + Intronic
1203488053 Un_GL000224v1:76056-76078 AGGTTTTCTGGGACTCCAGCTGG + Intergenic
1203500674 Un_KI270741v1:17949-17971 AGGTTTTCTGGGACTCCAGCTGG + Intergenic
1186167569 X:6843243-6843265 ACATTCCCAAGGGCTCCAGGAGG - Intergenic
1187056235 X:15743755-15743777 AGATGCCCAGGGGATGCAGCAGG - Intronic
1189386202 X:40539014-40539036 AGAGTCTCAGGGGATCCTGGTGG - Intergenic
1193617555 X:83708951-83708973 GGATTTTCAGGGTCTCCAGTGGG + Intergenic
1194080917 X:89464733-89464755 AGATACTCACAGTCTCCAGCTGG + Intergenic
1195510871 X:105713671-105713693 ACAAGCTCAGGGGCTCTAGCAGG - Intronic
1196144807 X:112305004-112305026 AGCTTCTCAGGGGCAGAAGCAGG - Intergenic
1197168552 X:123406340-123406362 AGATACTGAGAAGCTCCAGCTGG + Intronic
1198154162 X:133941522-133941544 TGATCCTCAAGAGCTCCAGCAGG + Intronic
1200433591 Y:3120938-3120960 AGATACTCACAGTCTCCAGCTGG + Intergenic
1200940332 Y:8773983-8774005 AGATTTTTAGGGGCTCAAGTAGG - Intergenic