ID: 910921715

View in Genome Browser
Species Human (GRCh38)
Location 1:92355637-92355659
Sequence CTAGAAAGAGAAGGCATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910921715_910921718 4 Left 910921715 1:92355637-92355659 CCCAAGATGCCTTCTCTTTCTAG No data
Right 910921718 1:92355664-92355686 GACTTTAGTTGACATTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910921715 Original CRISPR CTAGAAAGAGAAGGCATCTT GGG (reversed) Intronic
No off target data available for this crispr