ID: 910934824

View in Genome Browser
Species Human (GRCh38)
Location 1:92479216-92479238
Sequence GTGTGGATATGTATTTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910934824_910934830 29 Left 910934824 1:92479216-92479238 CCATGGCAAATACATATCCACAC 0: 1
1: 0
2: 4
3: 15
4: 239
Right 910934830 1:92479268-92479290 ACTTCTCCACCCTCCTCAACAGG 0: 1
1: 0
2: 0
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910934824 Original CRISPR GTGTGGATATGTATTTGCCA TGG (reversed) Intronic
902915551 1:19636958-19636980 CTGTGGATATGTGTGGGCCACGG + Intronic
904843730 1:33392073-33392095 GTGTGGCTGTGTACTTGCCAGGG + Intronic
905838715 1:41154246-41154268 CTGAGAATATGTATTTTCCAAGG + Intronic
907860520 1:58348174-58348196 GTTAGGAGGTGTATTTGCCAGGG - Intronic
908350325 1:63280497-63280519 GTGTGGATATTTATTTTCATTGG - Intergenic
909173134 1:72319820-72319842 GAGTGGCTATGTATTGGACAGGG + Intergenic
909477209 1:76094341-76094363 GTGTGGATTTATATATCCCAAGG + Intronic
910743152 1:90544115-90544137 TTGTGGCTATGTCTTTGCTAAGG + Intergenic
910934824 1:92479216-92479238 GTGTGGATATGTATTTGCCATGG - Intronic
912333546 1:108842027-108842049 GTAAGGATATTTATTTTCCAAGG - Intronic
913264056 1:117027190-117027212 GTGTGTATATGTATGTGCAGCGG - Intronic
915319039 1:155046104-155046126 GTGTGGACATTTGTTTTCCAGGG + Exonic
915851738 1:159331558-159331580 GTGTGGTTAAGTACTAGCCAAGG - Intergenic
916408298 1:164519393-164519415 GTGTGTATGTGTGTGTGCCATGG - Intergenic
919281681 1:195497287-195497309 TTGTGGAATTGTGTTTGCCATGG - Intergenic
919433611 1:197529390-197529412 GTGTGCATATGCGTGTGCCAGGG + Intronic
921258235 1:213361880-213361902 GTGTGGATGTGTCTGTGACAGGG + Intergenic
924393204 1:243586509-243586531 GTGTATATATATATATGCCATGG + Intronic
1063009616 10:2009710-2009732 GTGTCGATATGTATCTGATATGG - Intergenic
1063542224 10:6945329-6945351 TTATGGAAATGTATTTTCCATGG + Intergenic
1063747414 10:8900451-8900473 GTGTAAATATGTAGGTGCCATGG - Intergenic
1064082877 10:12322704-12322726 GTTTGGATAGGTCTCTGCCAGGG + Intergenic
1064927873 10:20589718-20589740 GTGTGGATGTGTATTTTAGATGG - Intergenic
1073310384 10:102535809-102535831 GTGTTCATATGCATATGCCAAGG - Intronic
1074517338 10:114182318-114182340 GTGTAGATGTCTATTTGCCCTGG + Intronic
1075829848 10:125399425-125399447 ATTTGGATAAGTACTTGCCAGGG - Intergenic
1075836877 10:125461794-125461816 GTGTGGACATGGTTTTCCCATGG - Intergenic
1076118642 10:127918810-127918832 GCGTGGATGTGTATTTCTCAAGG + Intronic
1077640076 11:3873456-3873478 TTGTGGAGATGGATTTGCCCAGG + Intronic
1077947228 11:6913126-6913148 AAGTAGATATGTATTTCCCATGG - Intergenic
1078249791 11:9607547-9607569 GGGTGGATATGTCTTTGTCATGG + Intergenic
1085819940 11:79781496-79781518 GTGTGTGTATATATTTGGCAGGG + Intergenic
1086093103 11:83023620-83023642 TTTTGGATATGTATTAGCCAAGG - Intronic
1086835734 11:91619716-91619738 GGGTGTATATGTATTTACAATGG - Intergenic
1087494738 11:98876719-98876741 ATGTGGATATGAAGTTGACAAGG - Intergenic
1087613517 11:100462064-100462086 GTGTGGATATGAATATGACAAGG - Intergenic
1087704594 11:101475835-101475857 GTGTGTATATATATGTGCAATGG - Intronic
1089080753 11:115774392-115774414 GAGTGGGTATGTAGTTTCCAAGG + Intergenic
1090163423 11:124519370-124519392 ATTTGGAAATGTAGTTGCCATGG - Intergenic
1090641253 11:128730708-128730730 GTGTATTTATTTATTTGCCAGGG + Intronic
1091995877 12:4993553-4993575 GAGTGGCTTTGTATTTGCCAAGG + Intergenic
1096052879 12:48626910-48626932 GTGTGGAAATGGCTTTACCAAGG + Intergenic
1097234078 12:57528024-57528046 GTGTGGGCATATATTTGTCAGGG + Intronic
1097629093 12:62037576-62037598 GTGGGCATATGTATTTGTAAAGG - Intronic
1097978695 12:65715045-65715067 GTGGGGTTATTTATTTGCCTGGG - Intergenic
1098677428 12:73307708-73307730 GTGTATGTATGTATTTTCCATGG - Intergenic
1099092081 12:78324880-78324902 GTGTGGATATGAACCTGACATGG + Intergenic
1099383581 12:81986027-81986049 GTGAGGCTATGTATGTGTCAGGG + Intergenic
1100743855 12:97624072-97624094 GTGGGATTAAGTATTTGCCATGG - Intergenic
1100790435 12:98124385-98124407 GTTTCAATATGGATTTGCCAAGG + Intergenic
1101249751 12:102920713-102920735 GTGCGTATATGTATTTTTCATGG + Intronic
1101425646 12:104586043-104586065 CAGTGGATATGTATTTGGAAGGG + Intronic
1102025302 12:109711219-109711241 GTGTCAAGATGGATTTGCCACGG - Intergenic
1104625451 12:130350067-130350089 GTGTGTAAATGTATTTGTTAGGG + Intronic
1106625206 13:31413690-31413712 TTGTGCATATGTATTAGTCAGGG - Intergenic
1107421587 13:40252466-40252488 GTGTGCACATGTATTTGCCATGG + Intergenic
1107741763 13:43457917-43457939 ATGTGTATATGTATGTACCAAGG + Intronic
1110154737 13:72302415-72302437 GTGATGAGATGTATTTGCCAAGG - Intergenic
1111321401 13:86634536-86634558 GTGAGGAATTGAATTTGCCAAGG - Intergenic
1111331830 13:86768326-86768348 GTGTGCATATGTATGTGCATTGG + Intergenic
1111476035 13:88749034-88749056 ATGTAGATATGTATTTGTTAAGG - Intergenic
1111541629 13:89675274-89675296 GATTGGAAATGTATTTACCATGG + Intergenic
1114711441 14:24782396-24782418 GTATGGATATATACTTGCCCAGG + Intergenic
1117490021 14:56237349-56237371 GTGTGGATGCGTTTCTGCCATGG - Intronic
1118012869 14:61627930-61627952 CTGAGCATGTGTATTTGCCAGGG - Intronic
1118120209 14:62831252-62831274 GTTTGGATAGGTATTTCCCAAGG + Intronic
1123184121 14:106498296-106498318 GTGTGTGTATATATTTACCATGG - Intergenic
1130077633 15:80703305-80703327 ATGTTGAAATGTAATTGCCATGG - Intronic
1130841972 15:87709299-87709321 GTGTGTATGTGTGTGTGCCAGGG + Intergenic
1131513868 15:93064876-93064898 ATGAGGATATGCATTTTCCAAGG - Intronic
1133687486 16:8179811-8179833 GTGTGGATATGTACTCGACACGG + Intergenic
1134166439 16:11933777-11933799 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1134494274 16:14719952-14719974 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1134499655 16:14759072-14759094 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1134526203 16:14945699-14945721 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1134546205 16:15110674-15110696 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1134580921 16:15369972-15369994 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1134713781 16:16344170-16344192 GTGTGGAAATGAGTTTGCCCTGG + Intergenic
1134721651 16:16387524-16387546 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1134945775 16:18324351-18324373 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1134953036 16:18364487-18364509 GTGTGGAAATGAGTTTGCCCTGG - Intergenic
1135311830 16:21411194-21411216 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1135364779 16:21843646-21843668 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1135447061 16:22527691-22527713 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1135613095 16:23885704-23885726 GTGTGAATCTGTATTTGCACTGG + Intronic
1136150998 16:28349094-28349116 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1136167232 16:28462934-28462956 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1136195745 16:28652082-28652104 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1136212083 16:28766207-28766229 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1136256802 16:29046135-29046157 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1136308534 16:29390201-29390223 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1136321949 16:29491727-29491749 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1136436630 16:30231700-30231722 GTGTGGAAATGAGTTTGCCCTGG - Intronic
1138406644 16:56800520-56800542 GTGTGCATATGTGTTTGTGAGGG + Intronic
1139148141 16:64346597-64346619 GTGTGGTTATGAATCTGTCAGGG + Intergenic
1139856235 16:69982610-69982632 GTGTGGAAATGAGTTTGCCCTGG - Intergenic
1140366494 16:74385467-74385489 GTGTGGAAATGAGTTTGCCCTGG + Intronic
1140846146 16:78890074-78890096 GTGTGTATGTGTATTTCCCTAGG - Intronic
1141328884 16:83089687-83089709 GTCTGAATGTTTATTTGCCATGG + Intronic
1143243959 17:5467720-5467742 GTGTGGAGAAGTTTTTGGCAGGG - Intronic
1144468907 17:15519465-15519487 GTGTGTATATTTATTTGAGATGG - Intronic
1146147603 17:30434794-30434816 GTGTGGTTATTTATTTGTCTTGG - Intronic
1150695724 17:67403499-67403521 GTGTGGACATTTATTTACCAAGG + Intronic
1152221124 17:79067268-79067290 GTGTGTGTGTGTGTTTGCCAGGG - Intergenic
1154117707 18:11625836-11625858 GTGTGGAAATGAGTTTGCCCTGG - Intergenic
1155292599 18:24356696-24356718 GTTTTGATATGTCTTGGCCATGG - Intronic
1155768558 18:29669174-29669196 GTGTGTATATATATTTGAGATGG - Intergenic
1156044973 18:32867892-32867914 GATTGGATACGAATTTGCCATGG + Intergenic
1158429344 18:57370390-57370412 GTGTGTGTGTGTATTTGCCAGGG - Intronic
1159132620 18:64296869-64296891 GTGTGGAATGGTAGTTGCCAAGG - Intergenic
1160562279 18:79766141-79766163 GTTGGGTTATGTATTTGTCAAGG + Intergenic
1161666098 19:5578036-5578058 GTGTGCATCTGTGTTTGTCATGG - Intergenic
1161755759 19:6133012-6133034 GTGTGCATATGTATGTGTCTTGG + Intronic
1162777988 19:12991156-12991178 GTGTGTATGTGTGTGTGCCAGGG - Intergenic
1166206817 19:41275532-41275554 GTGGGGATGTGTATTTGCTAGGG - Intronic
1168696425 19:58406402-58406424 TTGAGGATATGTATTAGCCCAGG + Intronic
925580281 2:5403148-5403170 GTGTGGATATGTATTAGTGGGGG + Intergenic
926282137 2:11458404-11458426 GTGTGAAGATGTATATGGCATGG + Intronic
926916236 2:17894667-17894689 GTGTGCATTTGTATTTGCTGTGG + Intronic
928534497 2:32227008-32227030 GTGTGGCTAAATTTTTGCCAAGG + Intronic
929624418 2:43391791-43391813 GCGTGGCTATGGATGTGCCAAGG - Intronic
930950152 2:57131552-57131574 GTGTGTATATATATTTCTCATGG + Intergenic
931438865 2:62273020-62273042 GTGTGTGTATGTATTAGTCAGGG + Intergenic
933857104 2:86426376-86426398 CTATGGGTATGTATGTGCCAAGG + Intergenic
934033621 2:88069435-88069457 GTGTGTATGTGTATGTGTCAGGG + Intronic
935446266 2:103159627-103159649 GTGTGCATGTGTATGTGCCTGGG + Intergenic
936374296 2:111927473-111927495 GTCTGGCTATGTATGTGCCCAGG - Intronic
939143002 2:138377899-138377921 ATGTAGGTATGTATGTGCCATGG + Intergenic
940511114 2:154616517-154616539 ATGTGGATTTCTATTTGACAGGG - Intergenic
942052261 2:172150929-172150951 GTGTGTATATATATATACCATGG - Intergenic
945502439 2:210592805-210592827 GTGTGGCTATGTATTATTCAGGG - Intronic
947908746 2:233787025-233787047 GTGTGCATCTGTGATTGCCAAGG - Intronic
1171108168 20:22455946-22455968 GTGTGAATGTGTATTTGCATGGG + Intergenic
1171979359 20:31616675-31616697 GTGTGAATGTGTATTTGTCTTGG - Intergenic
1173760195 20:45553145-45553167 GTGTGGCTTTGTTTGTGCCAGGG - Exonic
1175717644 20:61266089-61266111 CTGTGGATATTTATCTGTCATGG - Intronic
1176888840 21:14289503-14289525 GTGTGTGTGTGTAATTGCCATGG - Intergenic
1177039367 21:16088032-16088054 ATGACTATATGTATTTGCCAAGG - Intergenic
1178537242 21:33420465-33420487 GTGTGGCCATGTATTTGGCAAGG + Intronic
1179022792 21:37655530-37655552 GTGTGTGTATGTATTTGAGAAGG + Intronic
1179306940 21:40163062-40163084 GTGTGTGTGTGTGTTTGCCATGG - Intronic
1182010431 22:26996247-26996269 GTGTGTTTATGAATTTGCCCTGG + Intergenic
1182992414 22:34780924-34780946 GTGAGTATATATATTTGGCAAGG - Intergenic
1183802314 22:40177098-40177120 GAGTGGAGATGTATATGCGAAGG + Intronic
1184034697 22:41912939-41912961 GCCTGGATATGTCTTTGACAGGG - Intronic
1185285607 22:49998482-49998504 GTGTGGATATGCATGTGCATGGG + Intronic
950977672 3:17266306-17266328 GTGTGCATATGTATTTTAAAGGG - Intronic
951205524 3:19922433-19922455 CTGTGGATGTGTTTTTGCAAAGG + Intronic
953440450 3:42911546-42911568 GTAGGGACATGTATGTGCCAAGG - Intronic
956364717 3:68488058-68488080 GTATGCGTATGTATTAGCCAGGG + Intronic
960924625 3:122781823-122781845 GTGTGTATATATATATGCCATGG - Intronic
961565545 3:127761004-127761026 GTGTGGGTATGAATTTGGCCTGG - Intronic
964022329 3:152028086-152028108 GTGTGTGTGTGTATTTACCATGG + Intergenic
964121673 3:153190899-153190921 GATTTGATATGTATCTGCCAGGG - Intergenic
966553994 3:181237870-181237892 TTGTGGATATCTAATTCCCATGG + Intergenic
967371703 3:188753785-188753807 GTGTGTATATGTATTTGTAGAGG + Intronic
969171887 4:5370626-5370648 GTGTTGCTATGTACTGGCCATGG + Intronic
969698031 4:8746374-8746396 GTGTGCATATGTGTTTGAGATGG - Intergenic
970186063 4:13455093-13455115 GCCTGGGGATGTATTTGCCAGGG + Intronic
970701715 4:18749215-18749237 TCTTGGATATGTATTTGTCATGG - Intergenic
970793189 4:19883693-19883715 GTGTGGGTATGAAATTGCAATGG - Intergenic
972344818 4:38183786-38183808 GTGTGGAAAGATATTTACCATGG + Intergenic
972765196 4:42146353-42146375 CTGTGAAGGTGTATTTGCCAAGG + Intronic
973206000 4:47560802-47560824 GTGAGGATATGGATCTGACATGG + Intronic
975240180 4:72048113-72048135 GTGTGTATATATATATGGCAGGG - Intronic
976094261 4:81490582-81490604 ATGTATATATGTATATGCCAGGG + Intronic
977015631 4:91690056-91690078 GTGTGCATATATATTTGGGATGG + Intergenic
978169895 4:105657477-105657499 GTGTAGATATGTATTACTCATGG - Intronic
979098997 4:116591149-116591171 GTGTGTATATATATATCCCATGG + Intergenic
979416157 4:120441367-120441389 GTGTGAATTGATATTTGCCAGGG + Intergenic
979416199 4:120442184-120442206 GTGTGAATTGATATTTGCCAGGG - Intergenic
980223069 4:129945641-129945663 GGGTGCATATATATTTGGCATGG + Intergenic
980954214 4:139411642-139411664 GTGTGGATAAGTATATAACAAGG + Intronic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
984591839 4:181625948-181625970 CTGTGGACATTTATTTGCCAAGG + Intergenic
984984071 4:185310479-185310501 GTATGTATATGTATTTATCATGG + Intronic
985261318 4:188117729-188117751 GTGTGGATTTGTATTTGCCGAGG - Intergenic
986834251 5:11617073-11617095 CTGTGGCTATGCATGTGCCAAGG + Intronic
987012013 5:13776412-13776434 GTATGGAAATGTTTATGCCAGGG - Intronic
987689903 5:21253036-21253058 GTGAGTATATCTATTTGCTAGGG - Intergenic
988546742 5:32164741-32164763 GTGTGGTAATGTCATTGCCAAGG - Intronic
988775991 5:34478509-34478531 GTCTGGATACGGATTTGCCCTGG - Intergenic
989268233 5:39502474-39502496 GTGTGACTATGTATTTGCTCTGG - Intergenic
989659307 5:43781706-43781728 TTGTGCATATATATATGCCATGG + Intergenic
990578201 5:57143992-57144014 GGGTGGATATATATTTACAATGG + Intergenic
990698667 5:58451702-58451724 GTGTTGATAAATCTTTGCCATGG - Intergenic
991094475 5:62724862-62724884 ATGGGGATATGTATGTGCCATGG + Intergenic
991513693 5:67410286-67410308 GTGTGCATGTGTATTGGTCAGGG + Intergenic
993077574 5:83253510-83253532 GTGTGTATATGTATTTGAGGGGG + Intronic
993210498 5:84944403-84944425 GAGGGGAAAGGTATTTGCCAGGG - Intergenic
993236187 5:85313264-85313286 GTGTGGATATTTATTTCTCGTGG + Intergenic
993491057 5:88550164-88550186 GTTTGGATATGTATATGCCATGG + Intergenic
994227002 5:97264490-97264512 GTGTGAATAGGTATTAACCATGG - Intergenic
994263088 5:97682947-97682969 GGGTGGATATATATTTGGGATGG + Intergenic
994523189 5:100868343-100868365 GTGTGCATGTGTAGTAGCCAGGG + Intronic
997740206 5:136246352-136246374 GTGTGGATATGGCTTCCCCAGGG + Intronic
1000293070 5:159889330-159889352 GTGTAGATGTGTATTTGTGATGG - Intergenic
1000536651 5:162486248-162486270 GCTTGCATATGTATTTGCCTGGG - Intergenic
1000826431 5:166050728-166050750 GTGTGGATTTATATATCCCAAGG - Intergenic
1001658529 5:173373062-173373084 TTGTGGATATGTATGTTACATGG + Intergenic
1001673823 5:173496167-173496189 AAGTGGAAATGTATCTGCCACGG - Intergenic
1003460959 6:6327887-6327909 GTGAGGATATGTATATGTAAGGG + Intergenic
1003482368 6:6545816-6545838 GTGTGGGAATGTATGTACCAAGG - Intergenic
1004134269 6:12951364-12951386 GTATGGAGATCTTTTTGCCAAGG - Intronic
1005626731 6:27669498-27669520 GTGTGGGCATTTATTTGCCTTGG - Intergenic
1007006950 6:38373104-38373126 TTGTGAATATGTATCTACCAAGG - Intronic
1007331406 6:41112751-41112773 GTGTTAACATGTATTTGCCTTGG - Intergenic
1008207923 6:48686009-48686031 GTGTGTGTGTGTATATGCCATGG - Intergenic
1008421903 6:51310842-51310864 TTGGGGATTTGTATTTTCCATGG + Intergenic
1008751091 6:54735266-54735288 GTGTGGATTTGATTTTGTCATGG + Intergenic
1010621035 6:78075238-78075260 GTGTGGCTATGTTTTTGTAAAGG - Intergenic
1010715669 6:79226803-79226825 GACTGAATATGTATTTGCCTTGG + Intronic
1012101813 6:95099007-95099029 GTGTGTATATGTGTTGGTCATGG + Intergenic
1012528941 6:100211397-100211419 GGCTGGATATGTATTTGCATGGG + Intergenic
1014141166 6:117944892-117944914 GTCTGGATCTGTCTTTGACAAGG + Intronic
1014288037 6:119525387-119525409 GTGTGCATATGTGTTTCTCAAGG + Intergenic
1014322414 6:119946582-119946604 GACTGTATATTTATTTGCCAGGG - Intergenic
1015982880 6:138856841-138856863 GTGTGAAAATGAATTTACCAAGG - Intronic
1016142005 6:140624569-140624591 GTGTGTATATGTATGTGAGATGG + Intergenic
1016657150 6:146532752-146532774 GTGTGCATAAGTATATGCCTAGG + Intergenic
1019959372 7:4445916-4445938 GTGTGTATATGTATGTGCAGAGG - Intergenic
1021569247 7:22047954-22047976 GTGTGGGCATGTGTTTGCGAGGG + Intergenic
1021607402 7:22422190-22422212 GTGTGCACATGTATGTGCCTGGG + Intronic
1022044227 7:26610593-26610615 GGGTGGGGATGTAATTGCCAGGG + Intergenic
1024395609 7:48863052-48863074 GTGTGGAAATGTATTTGGATGGG + Intergenic
1024399622 7:48909225-48909247 GTGTGGAAATGTATTTGGATGGG - Intergenic
1030109907 7:106018214-106018236 ATGTGGATCTTTATTTCCCAGGG - Intronic
1030454178 7:109751893-109751915 GTGTGTATATATATTTGAGATGG - Intergenic
1031772314 7:125859895-125859917 CTTTGGATATGTATTCCCCATGG - Intergenic
1031888600 7:127267239-127267261 GTGTGTATATATATATGTCATGG - Intergenic
1032949471 7:136890885-136890907 GTGTGTATATGTGTGTGGCAGGG + Intronic
1035184378 7:157114454-157114476 TTGTGGCTATGATTTTGCCATGG + Intergenic
1036537365 8:9663382-9663404 GTGTGTATATGTATGTGTAAAGG + Intronic
1036715090 8:11114763-11114785 GTGTGTGTGTGTATGTGCCAGGG + Intronic
1038940914 8:32304314-32304336 GCATGGATATGTATCTGCAAAGG + Intronic
1041165533 8:55089001-55089023 GTATGCATGTTTATTTGCCAAGG + Intergenic
1044338052 8:91012861-91012883 AGGTAGATATGTATGTGCCATGG - Intronic
1045031403 8:98139957-98139979 GTGTGGAAATGTATGTGTTATGG - Intronic
1046537338 8:115532134-115532156 GTGCAAATATGTATTTTCCAAGG - Intronic
1046626833 8:116584278-116584300 GTGTGGAGATGTCTCTTCCAGGG - Intergenic
1046643886 8:116764128-116764150 ATGTGGATTTCTATTTGGCATGG + Intronic
1046788662 8:118296083-118296105 CTGTGGATATGCATTTAGCAAGG + Intronic
1047020132 8:120766798-120766820 GTAAAGCTATGTATTTGCCATGG + Intronic
1048440971 8:134458700-134458722 GTGTGGATGTGTGTTTGCCAAGG + Intergenic
1051488479 9:17634795-17634817 GTGTGGTTCTGTAATTCCCAGGG - Intronic
1053221022 9:36313325-36313347 GGGTGGATTGGTGTTTGCCAGGG + Intergenic
1054699810 9:68401923-68401945 GTGTGTGTATATATTTGTCAAGG + Intronic
1057913790 9:99040347-99040369 GTGAGGGTCTGGATTTGCCAAGG - Intronic
1058743960 9:107971637-107971659 GAGTGGATATGAATTATCCAAGG - Intergenic
1059985409 9:119815994-119816016 GTGTGGGTATGAATTTATCATGG + Intergenic
1059986868 9:119828894-119828916 GTGTGGATAGTTATTTTTCATGG + Intergenic
1060023532 9:120151992-120152014 GTGTGGAGCTGTAGCTGCCAGGG + Intergenic
1060702759 9:125773182-125773204 GTGACGATATGTATTTGTAATGG + Intronic
1186444307 X:9613455-9613477 GTGTGCATCTATATTTTCCAGGG + Intronic
1189372424 X:40439479-40439501 GTGTGGATATGTGTTATTCAAGG - Intergenic
1189662800 X:43320791-43320813 GTGTGTATATATATATACCATGG - Intergenic
1191918587 X:66229234-66229256 ATGTAGATATATATGTGCCATGG + Intronic
1192801453 X:74468287-74468309 AAGTGGATTAGTATTTGCCAAGG - Intronic
1195080890 X:101369183-101369205 TTGTGGATAAATATTTCCCAAGG - Intronic