ID: 910934970

View in Genome Browser
Species Human (GRCh38)
Location 1:92480258-92480280
Sequence ACTTCCAGGCAGAGAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 345}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910934970 Original CRISPR ACTTCCAGGCAGAGAGTGGC TGG Intronic
900506744 1:3033059-3033081 ATTTCCGGGCCGGGAGTGGCGGG + Intergenic
900508661 1:3044891-3044913 ACTTGAAGGTAGAGAGTGGAAGG - Intergenic
900864270 1:5255976-5255998 ACTTCCAGGAGAAGAGTGGAGGG + Intergenic
901037847 1:6347072-6347094 ACTTCCAGCCACAGACTGGAAGG + Intronic
901071287 1:6520021-6520043 CCTGCCAGGCAGAGAGGGGCTGG + Intronic
901567558 1:10131178-10131200 ACTTAAAGGCAGAGAAGGGCCGG + Intronic
902193490 1:14780464-14780486 CCATCCAGGCAGTGAGTGGGAGG - Intronic
902313069 1:15596829-15596851 ATTTCCAGGTAGATAGTGTCAGG + Intergenic
902518877 1:17004782-17004804 AGTCCCAGGCAGAGGATGGCCGG - Exonic
903859743 1:26357390-26357412 GCTTCCAGGCATAGGGTGACTGG + Intergenic
904032925 1:27544352-27544374 AACACCTGGCAGAGAGTGGCAGG - Intronic
904048444 1:27623467-27623489 ACTCCCAGTCTGAGAGGGGCAGG - Intronic
905588875 1:39144539-39144561 AATTCCAATGAGAGAGTGGCAGG - Intronic
907386196 1:54127175-54127197 GCTTCCAGACACTGAGTGGCAGG + Intergenic
910452184 1:87358564-87358586 AGGTACAGACAGAGAGTGGCTGG - Intergenic
910617017 1:89209519-89209541 ACTTCCAGCCAGAAATGGGCAGG - Intergenic
910721142 1:90287412-90287434 TCTTCCAGGCTGAAAGTGGAAGG - Intergenic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
911469948 1:98305918-98305940 AATTTCAGGCAGAGTGAGGCTGG - Intergenic
911990216 1:104686657-104686679 ACTTGAGGGCAGAGAGTGGGAGG - Intergenic
913181050 1:116321853-116321875 ACATCTAGGCAAAGACTGGCTGG + Intergenic
914464627 1:147915596-147915618 CATTCCAGGGAGAGAGTGACTGG - Intergenic
915009445 1:152671639-152671661 AATTCCAGGCAGAGAGCTGCTGG - Intergenic
916265055 1:162882306-162882328 ACAGCCAGGCTGAGAGAGGCTGG + Intergenic
917138062 1:171806813-171806835 TCTTTCAGGCAGAGATTGGTAGG + Intronic
918082404 1:181217778-181217800 CCTTCCTGGAAGAGAGGGGCTGG + Intergenic
918792548 1:188847422-188847444 AATTCTAGGCAGACAGGGGCGGG - Intergenic
922229464 1:223673198-223673220 ACTTGCAGGTAGAGGGTGGGAGG + Intergenic
922236868 1:223728553-223728575 ACTTCTAGATGGAGAGTGGCAGG + Intronic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
923125205 1:231028459-231028481 CCTTCCAGAAAAAGAGTGGCTGG + Intronic
923817234 1:237394744-237394766 AGTTCCAGAAAGATAGTGGCAGG - Intronic
1063148743 10:3318783-3318805 AATTCCAGACACAGTGTGGCAGG - Intergenic
1063181051 10:3600574-3600596 TCTTCCAGGCAGAGTGCTGCTGG - Intergenic
1065064617 10:21948462-21948484 AATTCCAGGCAGAGTGTGTTTGG + Intronic
1065737321 10:28765850-28765872 ACTTCAAGGCATAAAGTGGGAGG + Intergenic
1065979473 10:30878073-30878095 AATTCTAGGCAGACAGGGGCGGG + Intronic
1066373971 10:34840799-34840821 AGTTCCAGACAGGGAGAGGCAGG + Intergenic
1067177696 10:43961806-43961828 CCTTCCAGCCTGCGAGTGGCTGG + Intergenic
1067213673 10:44282383-44282405 TCTTCCAGCCAGTAAGTGGCTGG + Intergenic
1067508099 10:46873475-46873497 ACTTCTAGGCAGAGAATGCTTGG - Intergenic
1067511314 10:46897136-46897158 TCTCCCAGCCAGTGAGTGGCAGG - Intergenic
1067650935 10:48154726-48154748 TCTCCCAGCCAGTGAGTGGCAGG + Intergenic
1067654151 10:48178370-48178392 ACTTCTAGGCAGAGAATGCTTGG + Intronic
1069663094 10:70136851-70136873 TGTTCCAGGCTGAGAGTGGCAGG - Intergenic
1070734106 10:78851827-78851849 ACATCCAGGGAGAGGGTGCCGGG + Intergenic
1072208695 10:93226560-93226582 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1072472967 10:95731480-95731502 GCCATCAGGCAGAGAGTGGCAGG - Intronic
1072623813 10:97098368-97098390 GCTGCTAGGCAGAGAGGGGCAGG + Intronic
1073080536 10:100857346-100857368 ACATCCATGCAGAGATGGGCAGG - Intergenic
1073616768 10:105004242-105004264 GCTCCCAGGCAGAGCCTGGCTGG - Intronic
1073691318 10:105812383-105812405 ATTTCCCGTCAGAGAGTAGCTGG + Intergenic
1074563295 10:114553634-114553656 ACATCTAGGCAGAGAGTGGGAGG - Intronic
1075104155 10:119526680-119526702 GCTCCCAGGGAGGGAGTGGCAGG - Intronic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1076371967 10:129961103-129961125 AATTGCATGCAGAGAGTGGGAGG + Intronic
1076682568 10:132181400-132181422 ACTTCCAGGCTGAGAAGGGCCGG - Intronic
1076898738 10:133326803-133326825 GCCTCCAGGCAGGGGGTGGCAGG - Intronic
1077096052 11:799618-799640 ACTCCGAGGCAGAGTGTGGTGGG - Intronic
1077355440 11:2114669-2114691 AATCACAAGCAGAGAGTGGCGGG + Intergenic
1077657092 11:4029719-4029741 AGTTCAAGGTTGAGAGTGGCTGG - Intronic
1078397550 11:10994615-10994637 ATTTCCAGGCAGAGTGTTGAAGG - Intergenic
1078778895 11:14418677-14418699 GCTCCTAGGCAGAGAATGGCCGG - Intergenic
1078812164 11:14778539-14778561 ATATCCAGGCAAAGAGTGTCTGG + Intronic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079134403 11:17768255-17768277 TTTTCCAGACAGAGACTGGCAGG + Intronic
1079461506 11:20683461-20683483 ACTTCCAGCGGGAGAGTGGGAGG - Intronic
1079502143 11:21113170-21113192 ACATACAAGCAGAGAGGGGCTGG + Intronic
1079573705 11:21976669-21976691 AATTCTAGGCAGAGAGGGGTGGG - Intergenic
1080773424 11:35363641-35363663 AATTCCGTGCAGAGAGTTGCTGG - Intronic
1083939713 11:65889013-65889035 ACTTCCAGGCAGAGCTCGGAGGG - Intergenic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1085334246 11:75678977-75678999 GCTTCTGGGCAGAAAGTGGCGGG - Intergenic
1085372018 11:76017437-76017459 AATTTCAGGCACAGAGAGGCTGG + Intronic
1085384144 11:76147068-76147090 ACTACAAGGGGGAGAGTGGCAGG + Intergenic
1085534105 11:77207895-77207917 ACTTCCAGGGACAGAGGTGCTGG - Intronic
1085553972 11:77402701-77402723 ATGTTCAGGCAGAGATTGGCTGG - Intronic
1089015191 11:115159661-115159683 ACTTCCTGGCTCAGGGTGGCTGG + Intergenic
1089622267 11:119728842-119728864 TCTTCCACGCAGAGCGGGGCTGG + Exonic
1090399969 11:126442862-126442884 GCTTCCAGGCAGAGAAAAGCTGG - Intronic
1091386808 12:101164-101186 GCTTGCAGGCTGAGAGTGGATGG - Intronic
1092019149 12:5185935-5185957 ACTGCCAGGCAGGGAGGGGACGG - Intergenic
1092058829 12:5531422-5531444 AATTCCAGCCAGAGGGTGGAGGG + Intergenic
1093235616 12:16605684-16605706 ACTCCCGGGGAGAGAGGGGCAGG - Intronic
1093731291 12:22568458-22568480 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1094717523 12:33027930-33027952 ACTAAAAGGCAGAGTGTGGCAGG + Intergenic
1096194325 12:49639955-49639977 ACTTTTAGCCACAGAGTGGCTGG + Exonic
1096414321 12:51400444-51400466 ACTGCCAGGCAGGGAGTTGGTGG + Intronic
1096679118 12:53243025-53243047 ACATCCAGGCAGAGGGTTCCTGG - Intergenic
1097794194 12:63844516-63844538 AACTCCAGCCAGCGAGTGGCGGG - Exonic
1098873805 12:75845948-75845970 ATTTCCAGGCAGAGAGAAGGAGG - Intergenic
1099074300 12:78085812-78085834 ACTACAAGACAGAGAGTAGCTGG + Intronic
1100025590 12:90123747-90123769 AATCCCAGGCAGATAGTGGCAGG + Intergenic
1101148820 12:101866300-101866322 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1102024653 12:109707391-109707413 TCTCCCAGGCTGTGAGTGGCAGG - Intergenic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102542899 12:113635139-113635161 TCTTCCAAGCAGAGAGTGGGGGG - Intergenic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1107217217 13:37935229-37935251 AATTCCAGGCAGAAAACGGCAGG - Intergenic
1108316505 13:49242355-49242377 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1108523025 13:51261813-51261835 ACTCACAGGCACAGAGTGGTTGG - Intronic
1108766100 13:53631339-53631361 ATTTCCAGGCACACAGTTGCAGG - Intergenic
1108862008 13:54872471-54872493 ATTTCCAGGCAGAGATGTGCTGG + Intergenic
1109882983 13:68506596-68506618 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1110004942 13:70254961-70254983 ATTCCCAGGCAGAAAGGGGCAGG + Intergenic
1110374628 13:74778154-74778176 GCTTTCAGACAGAGAGTGTCTGG + Intergenic
1111348358 13:86994197-86994219 AATTCCAGCCAGCCAGTGGCAGG + Intergenic
1112508757 13:99990792-99990814 GCTGCCAGGCAGAGAGTGTGTGG + Intergenic
1113028200 13:105964481-105964503 ACTTCCAGGTAGAGAATGGAAGG - Intergenic
1114670319 14:24407694-24407716 AGGACCAGGGAGAGAGTGGCTGG + Intronic
1114744287 14:25131196-25131218 ACTTGCAGGCTGTGAGTGACAGG - Intergenic
1115856529 14:37635488-37635510 ACTGAAAGGCAGAGATTGGCAGG + Intronic
1116716408 14:48431753-48431775 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1116787043 14:49299278-49299300 ACTTCTAGGCTGAGAGTCACTGG + Intergenic
1117639798 14:57786033-57786055 ATTTCCAGGCAGAGGGTGAGGGG - Intronic
1118123107 14:62868129-62868151 CCTTCCAGGCATAGAGGGTCAGG - Intronic
1118238225 14:64031258-64031280 TCTGCCAGGCAGAGAGAAGCAGG + Exonic
1118278221 14:64405062-64405084 CATGCCAGGCAGAGAGTGACAGG - Intronic
1118673156 14:68152749-68152771 ACTTGAAGGAAGAGAGTGGGAGG - Intronic
1121102297 14:91258280-91258302 AGTTTCAGGCAGAAAGAGGCTGG + Intergenic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1122198760 14:100109167-100109189 ACTTCAGGGGAGAGAGTGTCAGG - Intronic
1122286748 14:100656931-100656953 ACTTCCTGGCAGGGAGGGCCTGG - Intergenic
1124202027 15:27686867-27686889 TCTTCCAGGGAGAGCGGGGCTGG - Intergenic
1124240254 15:28022303-28022325 AGCTCCAGGGAGACAGTGGCGGG - Intronic
1124412217 15:29445874-29445896 AATTCCAGGCAGACAGTGTCAGG + Intronic
1125610142 15:40964151-40964173 TATGCCAGGCAGAGGGTGGCAGG + Intergenic
1127067419 15:55255243-55255265 GCTTCCAGGGTGAGAGTGGAAGG - Intronic
1127308130 15:57728126-57728148 AATTCCAGGCAGTTAGTGCCTGG + Intronic
1129166356 15:73780479-73780501 ACTTCCAGGCAGAAAGAAGATGG + Intergenic
1131694344 15:94859095-94859117 ACTGCCAGGTAGAGGGTGGAGGG - Intergenic
1131933460 15:97473647-97473669 CCTTCCAGCCATTGAGTGGCAGG + Intergenic
1132803592 16:1765788-1765810 ACCTCCAGGCAGAGGGTCGTGGG + Intronic
1132945815 16:2530972-2530994 GCTCCCAGGCAGGGAGAGGCAGG + Exonic
1137493790 16:48953263-48953285 ACTTCCAGGCACAGTGTGTAAGG - Intergenic
1138181237 16:54941530-54941552 ATTTGCAGGAAGAGAGTGCCAGG + Intergenic
1139555157 16:67703571-67703593 AATTCCAGACAGAAAGGGGCAGG - Intronic
1139629445 16:68219841-68219863 ACAACCAGGTAGAGAGGGGCAGG - Intronic
1139706311 16:68743059-68743081 ACCACCTGGCAGAGAGGGGCAGG - Intronic
1140745517 16:77977077-77977099 GCTCTCAGGCAGAGAGGGGCAGG - Intronic
1141523479 16:84596762-84596784 TCTCCCAGGGAGAGAGTGTCAGG - Intronic
1142202710 16:88768701-88768723 CCTTCCTGGCAGTGAGGGGCTGG + Intronic
1142301813 16:89263019-89263041 AATTCTAGGCAGACAGGGGCAGG - Intergenic
1143404778 17:6670064-6670086 GCTTCCAGACAGGGAGCGGCAGG + Intergenic
1143660585 17:8322272-8322294 ACAGCAAGGCAGACAGTGGCTGG + Exonic
1143788182 17:9272352-9272374 ACTACCCGGCAGGGAGTGGCTGG + Intronic
1145285576 17:21503791-21503813 ATTTCCAGGCAGACAGAGGATGG + Intergenic
1147456204 17:40539727-40539749 ATTGGCTGGCAGAGAGTGGCTGG - Intergenic
1148468160 17:47877337-47877359 ACCTGCAGGCAGAGAGAGCCTGG - Intergenic
1149441771 17:56680124-56680146 GCTTCCTGGCATAGGGTGGCGGG - Intergenic
1149603617 17:57909609-57909631 ACACCCAGGCAGAGAGAAGCTGG + Intronic
1150108911 17:62480394-62480416 TCTTCCAAGCAGGGAGGGGCAGG - Intronic
1151256223 17:72878793-72878815 ACCTCCAGGTAGATAGTGTCTGG - Intronic
1151383017 17:73738443-73738465 AGTTCCATGGAGAGAGGGGCTGG - Intergenic
1151826711 17:76527866-76527888 ACTTCCAGGCAGAAAGGAGTGGG - Exonic
1152103821 17:78317682-78317704 ACTTGCAGGCAGGGAGGGGAGGG + Intergenic
1153049132 18:884672-884694 AGTCCTACGCAGAGAGTGGCAGG - Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1155235435 18:23813912-23813934 ACTTCCAGGCACAGAATGGATGG + Intronic
1155840268 18:30633964-30633986 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1155928305 18:31680750-31680772 AATTCCTGGCAGAGAGAGACTGG - Intronic
1156651728 18:39233873-39233895 AATTCTCGGCAGACAGTGGCAGG - Intergenic
1156670933 18:39468608-39468630 AGTTCCAGACAGGGAGTAGCAGG + Intergenic
1156946970 18:42844832-42844854 AATTCTAGGCAGATAGGGGCAGG - Intronic
1158252703 18:55507343-55507365 ACTTATAGGCAGGGAGTGTCTGG + Intronic
1158558949 18:58497975-58497997 CCTTCCAGGCAGACACTGTCAGG - Intronic
1161129264 19:2578737-2578759 GCTTCCTGGCAGGGAGTGGGTGG - Intronic
1161541195 19:4852371-4852393 ACTTCCAGGGAGACCGAGGCGGG + Intronic
1161541226 19:4852467-4852489 ACTTCCAGGGAGACTGAGGCAGG + Intronic
1164751388 19:30657586-30657608 CCTTCCAGGAAGAGAGTGCAGGG - Intronic
1164887821 19:31797951-31797973 CCTTCCAGGCACAGAGTGGGTGG + Intergenic
1166031453 19:40133617-40133639 ACAGCCTGGCAGAGAGGGGCTGG + Intergenic
1167467404 19:49657633-49657655 ACTTCCAGCCTGAGAGCAGCTGG + Intronic
1167529335 19:50005186-50005208 ACATCAAGGCACAGAGTGCCTGG + Intronic
1168640715 19:58029537-58029559 AGTTCCAGGCGGAGGGTGGAGGG + Intergenic
1168712944 19:58512151-58512173 AGCGCCAGGCAGAGAGGGGCTGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925869897 2:8261041-8261063 CCTTCCATGCAGAGAGTGGTAGG - Intergenic
925901317 2:8511240-8511262 AACTCCATGCAGAGAGTGGCTGG + Intergenic
925958547 2:8993678-8993700 ACTTCCTGGTAGAGAGGGCCAGG - Intronic
927189935 2:20510629-20510651 AATTCCAGGCAGGAAATGGCAGG - Intergenic
927613599 2:24566646-24566668 ACTTCTGGGCAGAAAGGGGCAGG - Intronic
929507541 2:42540021-42540043 ATTTCCAGCCAGAGAGAGGGAGG - Intronic
929941499 2:46337401-46337423 TATTCCAGGCAGGGAGTGGGAGG + Intronic
931215098 2:60234670-60234692 ACTTCCTGGCTAAGAGTGGCTGG + Intergenic
932719813 2:74130844-74130866 ACTTCCAGGCAGCCAGAGCCCGG - Exonic
933634236 2:84689802-84689824 TCTTCTAGTCAGTGAGTGGCAGG + Intronic
934060192 2:88285409-88285431 ATTTCCAGGGAGGGAGAGGCTGG + Intergenic
934949490 2:98566621-98566643 GGTTCCAGGCAGGGATTGGCAGG + Intronic
935128501 2:100244084-100244106 AGTTACAGTCAGAGAGTGGCTGG + Intergenic
935363621 2:102267943-102267965 AATGCCAGGCAGAGTGGGGCTGG - Intergenic
937016145 2:118607771-118607793 ACTTGGAGGCAGTGAGCGGCAGG + Intergenic
937379329 2:121362437-121362459 GCTACCTGGTAGAGAGTGGCAGG - Intronic
937782962 2:125860335-125860357 ACTTGGGGGCAGAGAGTGGGAGG - Intergenic
937839213 2:126508790-126508812 ACTTACAAGTAGAAAGTGGCAGG + Intergenic
938732582 2:134158224-134158246 ACTCCCAGGCAAAAAGGGGCAGG - Intronic
941551339 2:166919067-166919089 ATCTCCAGGAAGAGAGTGGATGG - Intronic
941992615 2:171571854-171571876 ATTTGCAGGCAGAGAGGAGCTGG - Intergenic
942108984 2:172661203-172661225 ACCTCCAGGCAGAGGGGTGCAGG + Intergenic
945976261 2:216273566-216273588 GCTCCCTGGCAGAGAGTGGGTGG - Intronic
946015857 2:216603261-216603283 GCTTCCAGGGAGAGAAAGGCTGG + Intergenic
948212829 2:236207708-236207730 ACTGCCAGGAAGAGGGTAGCAGG - Intronic
948254088 2:236553257-236553279 CCTTCCAGGCAGACAGTAGGTGG + Intergenic
948337480 2:237221751-237221773 ACACACAGCCAGAGAGTGGCTGG + Intergenic
1168967113 20:1905432-1905454 ACATCCTGGCCCAGAGTGGCAGG - Intronic
1169077178 20:2768378-2768400 AGTGCCAGCCTGAGAGTGGCTGG - Intergenic
1169270452 20:4195357-4195379 GCTTCCCTGCAGACAGTGGCAGG + Intergenic
1169325134 20:4669658-4669680 ACACCCAGGCAGAGAGAGTCAGG - Intergenic
1171049506 20:21842213-21842235 ACTTCCAGGTATGGGGTGGCTGG + Intergenic
1171464721 20:25319498-25319520 ACTTCCTGGAAAAAAGTGGCAGG - Intronic
1171561944 20:26134573-26134595 ACTACCAGGCAGGGAGTAGTGGG - Intergenic
1172554188 20:35826533-35826555 ATTTCCAGGAAGAGAGTGGCAGG + Intronic
1173774724 20:45694833-45694855 ACTTCCTGGAGGAGAGTGGGTGG - Intronic
1174191506 20:48743818-48743840 ACTTTCACGTAGAGAGTGGCTGG + Intronic
1174442647 20:50568217-50568239 ACCACCAGGCAGAGAGAGGTGGG + Intronic
1175057758 20:56213768-56213790 ACATCCAGGCAGGGAATGCCTGG + Intergenic
1176145722 20:63564578-63564600 ACGTCCTGGCAGAGGCTGGCCGG + Exonic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1177048512 21:16201865-16201887 ACCCTCAGGCAGAGAGTGGCAGG + Intergenic
1177541031 21:22494023-22494045 TCTTCCAGGGACAGAGTGCCTGG + Intergenic
1177801532 21:25833411-25833433 AATTCCAGGCAGACAGGGACGGG + Intergenic
1177968408 21:27758724-27758746 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1178892684 21:36533234-36533256 CCAGCCAGGCAGAGAGTGGCTGG + Intronic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1180028679 21:45185557-45185579 ACACCCAGGCACAGAATGGCTGG - Intronic
1180061350 21:45386550-45386572 GCTTCCAGGCAGGCAGCGGCTGG + Intergenic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1180946578 22:19697122-19697144 CATTCCAGGCAGACAGTGGCTGG - Intergenic
1180981156 22:19878623-19878645 ACGTGCAGGCAGCCAGTGGCTGG + Intronic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1181471990 22:23146093-23146115 ACTCCCAGGCAGGGTGGGGCAGG + Intronic
1182001927 22:26926791-26926813 ACTTCATGGCAGAGAATGCCGGG + Intergenic
1182418783 22:30238521-30238543 TCTCCCAGGCTGAGAGAGGCAGG + Intergenic
1183315327 22:37133853-37133875 ACTTCCAGGAACAGAGTGCAGGG - Intronic
1183766068 22:39876047-39876069 ACTTCAAGGTTGAGAGTAGCAGG - Intronic
1184187063 22:42871923-42871945 ACTTCCAGGCTGCGAGGGGAAGG + Intronic
1184330498 22:43824154-43824176 GCTCCCAGGCAGAGACTGGGAGG + Intergenic
1184488671 22:44796496-44796518 ACCTCCAGGAAGGGAGGGGCTGG + Intronic
1184533170 22:45069973-45069995 CCTCCCAGGCAGAGAGGGACTGG + Intergenic
1185160701 22:49227910-49227932 ACTCCCAGGAAGAGAGAAGCTGG + Intergenic
950521663 3:13501297-13501319 AAGGCCAGGCACAGAGTGGCAGG - Intronic
951453199 3:22862643-22862665 AGTTCCAGTCAGAAGGTGGCAGG + Intergenic
952181401 3:30920396-30920418 AATTCTAGGCAGACAGGGGCAGG + Intergenic
952189203 3:31004497-31004519 AGTTGCAGGCAGACAGTGGCTGG + Intergenic
952581459 3:34838255-34838277 ATTTCCAAGCAAAGAGTGGAAGG - Intergenic
952947643 3:38490132-38490154 ATTTTTAGGCAGAGAGTGGATGG + Exonic
953460396 3:43077377-43077399 GCTTCCTGGGAGACAGTGGCGGG + Intergenic
954427364 3:50450379-50450401 AGCTCCTGGGAGAGAGTGGCGGG - Intronic
956444359 3:69311330-69311352 ACTTCTAGCAAGAGAGTTGCTGG - Exonic
959409960 3:106008837-106008859 ACTTCCAGGCACAGAACAGCTGG + Intergenic
960960731 3:123068355-123068377 ACTTCCAACCAGAGAGTACCAGG - Intronic
964870346 3:161306926-161306948 AATTCCAAGCAAAGTGTGGCAGG + Intergenic
965726160 3:171718706-171718728 TCTTACAAGCAGTGAGTGGCAGG - Intronic
966110469 3:176394927-176394949 ATTTCAAGACAGAGAGTGGTTGG + Intergenic
968066224 3:195761306-195761328 TCCTCCAGGTAGAGAGAGGCAGG + Intronic
968285448 3:197505913-197505935 ACTCACCGGCTGAGAGTGGCCGG + Intergenic
968317309 3:197736039-197736061 AATCCCTGTCAGAGAGTGGCAGG - Intronic
968641863 4:1718770-1718792 ACAGGCAGGGAGAGAGTGGCCGG - Intronic
969515972 4:7648464-7648486 ACTCCCAGGCAGAGGAAGGCGGG - Intronic
969641800 4:8403290-8403312 ACATCCAGGCAGAAACTGGCTGG + Intronic
973022504 4:45220792-45220814 AATTCTAGGCAGACAGGGGCAGG - Intergenic
973295224 4:48511732-48511754 ACTTCCAGGATGAGAGAGACTGG + Intronic
976505559 4:85842330-85842352 TCACCCAGGCAGAAAGTGGCAGG - Intronic
976637911 4:87306609-87306631 ACTGAAAGGAAGAGAGTGGCTGG + Intronic
978616068 4:110597359-110597381 ACTTCCAGTCAGAGTTTGGAAGG - Intergenic
979946759 4:126842862-126842884 AATTCTAGGCAGATAGGGGCAGG + Intergenic
981573824 4:146182546-146182568 ACTTCCATTCAGTGAGTGGTTGG - Intronic
983462700 4:168047432-168047454 AATTCCAGGCAGAAAAGGGCAGG - Intergenic
983697927 4:170554989-170555011 AATTCTAGGCAGACAGGGGCAGG - Intergenic
984359682 4:178712032-178712054 AATTCCAGGCTGACAGGGGCAGG - Intergenic
985044231 4:185924245-185924267 ACTGCCAGGGAGTGAGTGGGTGG + Intronic
985654206 5:1121612-1121634 GCTTACAGCCAGTGAGTGGCAGG + Intergenic
985654999 5:1126633-1126655 ACTTGAGGGCAGAGAGTGGGAGG - Intergenic
985754038 5:1702556-1702578 ACTATCAGTCAGAGAGTGGGAGG - Intergenic
987122318 5:14778743-14778765 ATTTGCAGGCAGTGAGTTGCAGG - Intronic
988926818 5:35998542-35998564 AGTCCCAGCAAGAGAGTGGCTGG - Intergenic
989824862 5:45840774-45840796 ACTTGAAGGTAGAGAGTGGGAGG - Intergenic
990293402 5:54378139-54378161 AATTCTAGGCAGACAGGGGCAGG + Intergenic
992017884 5:72594427-72594449 ACCCTCAGGCAGAGAGAGGCTGG - Intergenic
992956156 5:81910664-81910686 ACTTCCCTGCAGAGAGTGGCAGG - Intergenic
995473051 5:112523496-112523518 GTTTCCAGGCAGAGAGTGATAGG + Intergenic
996118757 5:119647875-119647897 AATCCAAGGGAGAGAGTGGCTGG + Intergenic
996164344 5:120206618-120206640 ACTTTCACCCAGAAAGTGGCAGG - Intergenic
996396018 5:123014875-123014897 GGTTTCAGGCAGAGACTGGCAGG - Intronic
997439456 5:133898996-133899018 ACTCCCAGGCAGCGAGTAGTGGG + Intergenic
999647406 5:153731931-153731953 ACTTACAGGAAGAGAGTAGAAGG - Intronic
999748288 5:154608558-154608580 ACTCCCAGGCAGGAAGAGGCAGG - Intergenic
999924451 5:156360057-156360079 ATGTCCAGGCAGACAGGGGCGGG + Intronic
1000265605 5:159633326-159633348 ACTCCCAGGAAAAGAATGGCAGG - Intergenic
1000348924 5:160337550-160337572 AGTAACAGGAAGAGAGTGGCAGG - Intronic
1001612705 5:173016243-173016265 ACCTCCAGGCAGATAATGTCAGG + Intronic
1001969633 5:175944112-175944134 AATTCCAGGCAGAAAAGGGCAGG - Intronic
1002146609 5:177188018-177188040 TCTTCCAGGCTTAGACTGGCAGG - Intronic
1002247801 5:177899641-177899663 AATTCCAGGCAGAAAAGGGCAGG + Intergenic
1003903274 6:10675175-10675197 AGTTGCAGGGAGAGAGTGGTAGG - Intronic
1004025366 6:11813080-11813102 ACTTCTTGGCATGGAGTGGCAGG + Intergenic
1005103131 6:22195342-22195364 ACTTACATGCAGAGACTGCCTGG - Intergenic
1006242471 6:32696826-32696848 ATTTCCATGCAAACAGTGGCAGG - Intergenic
1006523378 6:34584938-34584960 ACCTCCAGGCAGAGCGCAGCGGG - Intergenic
1007937996 6:45750856-45750878 ACTTCCAGGTAGATGGTGTCAGG + Intergenic
1008645001 6:53504839-53504861 TCCTCTTGGCAGAGAGTGGCTGG - Intronic
1011156670 6:84341023-84341045 ATTTCCAGGCAGCGATGGGCAGG + Intergenic
1011962631 6:93110057-93110079 ACTTCAAAGCAGAGAGTGGCTGG + Intergenic
1012111048 6:95234108-95234130 ACTTCAAGGCTGTGGGTGGCCGG - Intergenic
1012758400 6:103263571-103263593 ACTTCTAGGCAGACAGGGGTGGG + Intergenic
1013587250 6:111590669-111590691 ACTGCCAGTCTTAGAGTGGCTGG + Intronic
1013588111 6:111597332-111597354 GATTCCAGGCAGGGAGTTGCTGG + Intronic
1015272011 6:131346076-131346098 CCTTCCTGGTAGAGAGGGGCAGG - Intergenic
1016937017 6:149455102-149455124 ACTCCCAGCCAGTAAGTGGCAGG + Intronic
1019090808 6:169531469-169531491 ACTTCCTGGCAGAGAGCAGATGG + Intronic
1019764119 7:2837098-2837120 TCTTCCAGGCAGAGAATGGGAGG - Intronic
1021413445 7:20354685-20354707 TGTTCCAGGCAGAAAGAGGCAGG + Intronic
1022444669 7:30460395-30460417 TCTTCCAGGCAAAGAGAGGACGG + Intronic
1023037562 7:36146941-36146963 CCTTATAGCCAGAGAGTGGCTGG - Intergenic
1023411791 7:39895131-39895153 ACTTCCAGGGAAAGAATGGAGGG - Intergenic
1023760477 7:43461192-43461214 AGTTGCAGTCAGAGGGTGGCCGG + Intronic
1024084837 7:45884535-45884557 AATAACAGGCAGGGAGTGGCAGG - Intergenic
1026324637 7:69298351-69298373 AGTTCCATTCTGAGAGTGGCAGG - Intergenic
1026435195 7:70390660-70390682 AAGTCCAAGCAGAGAATGGCCGG + Intronic
1028504584 7:91557179-91557201 ACTTACAGGAAAAAAGTGGCCGG - Intergenic
1028650660 7:93147123-93147145 ATTTCCAGAGAGAGACTGGCTGG - Exonic
1029444034 7:100603107-100603129 ACTGCCAGGCAGAGTGAGGCGGG + Intronic
1030112444 7:106038370-106038392 CCTTCCAGGCAGTGAGTGCAAGG + Intergenic
1031246563 7:119320748-119320770 AGTTCCAGGAAGGGAGTGGATGG + Intergenic
1031480725 7:122275470-122275492 ACATCCAGGGAGAGAGAGGGGGG - Intergenic
1032037927 7:128532916-128532938 TCTTCCAAGCAGGGAGGGGCAGG - Intergenic
1032440122 7:131936251-131936273 ACTTTGAGGCAGTGAGGGGCTGG + Intergenic
1032458546 7:132092598-132092620 ACTCACAGGGACAGAGTGGCGGG - Intergenic
1033023737 7:137753282-137753304 ACTTCCAGACAGAGAGTCTCTGG + Intronic
1033422550 7:141216777-141216799 ACTTCAAGCCAGATAGTGGGTGG - Intronic
1034571383 7:151959129-151959151 ATTCCTAGGCAGAGAGGGGCAGG - Intronic
1036912509 8:12768911-12768933 ACAGTCAGGCAGAGTGTGGCAGG + Intergenic
1038503425 8:28063939-28063961 ACTTGCAGGAAGAGAGGGACTGG - Intronic
1039422632 8:37456102-37456124 ACTTTCAGACAGAGAGGGACAGG + Intergenic
1040683440 8:49841910-49841932 AATTCTAGGTAGACAGTGGCAGG + Intergenic
1040683480 8:49842165-49842187 ACTTCAAGGAAGAATGTGGCTGG + Intergenic
1040977573 8:53211336-53211358 ACTTGCAGGTGGAGAGTGGGAGG - Intergenic
1047163376 8:122407410-122407432 ATTTCAAGGCAAAGAGTGGTTGG - Intergenic
1047710843 8:127550747-127550769 ACTACCCTGCAGAGAGTGGAGGG + Intergenic
1048445261 8:134488517-134488539 ACTCCAAAGCAGAGAGTGGGTGG - Intronic
1048525170 8:135195950-135195972 TGTGACAGGCAGAGAGTGGCTGG - Intergenic
1048980347 8:139700226-139700248 GCTGCCAGGCACAGTGTGGCCGG - Intronic
1049306041 8:141904828-141904850 CCTGCCAGGCAGGGAGGGGCAGG + Intergenic
1049423371 8:142526520-142526542 CCTGCCGGGCAGAGAGTGGTGGG - Exonic
1051236578 9:15006479-15006501 ACTCCCAGGAAGAAAGTTGCAGG - Intergenic
1053463034 9:38285256-38285278 ATTTGCAGGCAAAAAGTGGCAGG + Intergenic
1053481820 9:38421804-38421826 ACTTCAGGACAGAGAGTGACAGG + Intronic
1054727551 9:68667414-68667436 TCTTCCAGGCAGCCTGTGGCAGG - Intergenic
1055482843 9:76726875-76726897 CCTTCCAGGCAGAGAATACCTGG + Intronic
1055993661 9:82134116-82134138 AGTTCCAGGAAGAAACTGGCAGG - Intergenic
1056947304 9:91009656-91009678 ACATACAGGCAGACAGAGGCTGG - Intergenic
1057763269 9:97893185-97893207 ACTTCAAGTCAGACAATGGCAGG + Intergenic
1058681564 9:107444875-107444897 ACTTCCTGGCACATAGTGACGGG + Intergenic
1060886869 9:127160659-127160681 GATTCCAGGCAGAGAGTTGGGGG - Intronic
1061116972 9:128619908-128619930 GCATTCAGGCAGAGCGTGGCTGG + Intronic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061570148 9:131473093-131473115 ACTACCAGGAACAGACTGGCGGG - Intronic
1062353403 9:136150048-136150070 GCTTCCAGGGTGAGGGTGGCCGG - Intergenic
1062400401 9:136370209-136370231 CCTTCCAGGCACGGAGTGGGCGG + Intronic
1186179929 X:6963461-6963483 AACTCCAGGCAGACAGTGTCAGG + Intergenic
1186904970 X:14101060-14101082 ACTTGAAGGTAGAGAGTGGGAGG - Intergenic
1186963652 X:14764111-14764133 AAATCCAGGCAGAGATTAGCTGG + Intergenic
1187724250 X:22186074-22186096 AGTTACAGTCAGATAGTGGCTGG + Intronic
1189249054 X:39585910-39585932 GCCACCAGGCAGAGAGTGGTGGG + Intergenic
1189546971 X:42051418-42051440 AATTCCAGTAAGAAAGTGGCAGG - Intergenic
1191811918 X:65198021-65198043 ATGTCCAGGCAGAGAGCTGCGGG - Intergenic
1194960730 X:100232482-100232504 ACAGCCTGGCAGAGAGTGGGCGG - Intergenic
1195295635 X:103473712-103473734 AGATCCAGGCAGAGACTTGCAGG + Intergenic
1195853274 X:109305862-109305884 AATTCTAGGCAGATAGCGGCAGG - Intergenic
1196168730 X:112564412-112564434 AAGTCCAGGCACAGTGTGGCTGG + Intergenic
1200219642 X:154384750-154384772 ACTTTCAAGAAGAGAGTGCCAGG + Intergenic
1201294505 Y:12452162-12452184 ACTTGAAGGCAGAGGGTGGGAGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic