ID: 910938525

View in Genome Browser
Species Human (GRCh38)
Location 1:92507370-92507392
Sequence ACCCAAAATGTCTCCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 3, 2: 33, 3: 94, 4: 295}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910938525_910938533 7 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938533 1:92507400-92507422 ACTAAAGGAGGGGGTGTTACTGG 0: 1
1: 0
2: 1
3: 10
4: 129
910938525_910938535 18 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938535 1:92507411-92507433 GGGTGTTACTGGCATCTACTGGG 0: 1
1: 18
2: 158
3: 572
4: 1267
910938525_910938529 -3 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938529 1:92507390-92507412 GGTTGTCCCAACTAAAGGAGGGG 0: 1
1: 0
2: 0
3: 29
4: 218
910938525_910938537 29 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938537 1:92507422-92507444 GCATCTACTGGGTAGAGGCCAGG 0: 7
1: 186
2: 628
3: 1131
4: 1519
910938525_910938527 -5 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938527 1:92507388-92507410 TGGGTTGTCCCAACTAAAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 115
910938525_910938528 -4 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938528 1:92507389-92507411 GGGTTGTCCCAACTAAAGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 101
910938525_910938538 30 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938538 1:92507423-92507445 CATCTACTGGGTAGAGGCCAGGG 0: 9
1: 208
2: 753
3: 1158
4: 1460
910938525_910938534 17 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938534 1:92507410-92507432 GGGGTGTTACTGGCATCTACTGG 0: 1
1: 10
2: 103
3: 431
4: 1045
910938525_910938530 -2 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938530 1:92507391-92507413 GTTGTCCCAACTAAAGGAGGGGG 0: 1
1: 0
2: 4
3: 26
4: 275
910938525_910938526 -8 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938526 1:92507385-92507407 TTTTGGGTTGTCCCAACTAAAGG 0: 1
1: 1
2: 7
3: 90
4: 391
910938525_910938536 24 Left 910938525 1:92507370-92507392 CCATGTTTGGAGACATTTTGGGT 0: 1
1: 3
2: 33
3: 94
4: 295
Right 910938536 1:92507417-92507439 TACTGGCATCTACTGGGTAGAGG 0: 9
1: 205
2: 647
3: 1089
4: 1473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910938525 Original CRISPR ACCCAAAATGTCTCCAAACA TGG (reversed) Intergenic
900312013 1:2038153-2038175 ACCCACAATGACCCCAAACCAGG + Intergenic
900317044 1:2062210-2062232 ACCCAAAATATATTCAAAAAGGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905506280 1:38482109-38482131 ATACAGGATGTCTCCAAACAGGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
910324042 1:85983524-85983546 ACCCAAATTGTTTGCAAATAGGG + Intronic
910435169 1:87199007-87199029 ATCCATAAAGTGTCCAAACAAGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
914330889 1:146670253-146670275 ACCCAGACTCTCTGCAAACATGG - Intergenic
915075313 1:153303788-153303810 CCCAAACATGACTCCAAACATGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
917425711 1:174910787-174910809 ACCCAAAATAACTGAAAACAGGG - Intronic
917547620 1:175987937-175987959 ACACATAATGTCTCCAAAATTGG + Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
920854422 1:209651613-209651635 ACCCAAAATGTCTTCAATGATGG + Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922271767 1:224042079-224042101 ACCCAAAAAGTCTACAAAAATGG - Intergenic
923402813 1:233631520-233631542 AACCATAATGTCTACAAGCAGGG - Intronic
924388983 1:243530250-243530272 AACCATACTGTCTGCAAACATGG + Intronic
1063529452 10:6817301-6817323 CCCTAAAATGTTTCCATACATGG + Intergenic
1063959556 10:11295868-11295890 ACCCAAACTCCCTCCACACAAGG - Intronic
1064467777 10:15601870-15601892 CCTCAAACTGTTTCCAAACAAGG + Intronic
1065093304 10:22255929-22255951 AACAAAAATGTTTTCAAACAAGG - Intergenic
1066314945 10:34235867-34235889 AGCTGAAATGTTTCCAAACATGG + Intronic
1068240878 10:54299582-54299604 ACCCAGCAGGTTTCCAAACAGGG + Intronic
1068578042 10:58707079-58707101 TGCCAAATTGTCTCCAAACCAGG - Intronic
1068984417 10:63094085-63094107 AACAAAAATGTCCCCAAACATGG + Intergenic
1069054863 10:63834171-63834193 TGCCAAAATGTTTGCAAACACGG - Intergenic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070542884 10:77429419-77429441 AACTAAAATGTCTCCCAACATGG + Intronic
1070950243 10:80425439-80425461 ACAGAAAATGTCACCAAACAGGG + Intronic
1072894115 10:99350963-99350985 AACCAGATTGTCTCCATACATGG + Intronic
1072971507 10:100021510-100021532 ATTCAAAATGTGTCCAAATAAGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076269799 10:129141824-129141846 ACCAAAACTGTTTCAAAACAGGG + Intergenic
1076817395 10:132921619-132921641 ACCCAAATTACCTCCAAAGAAGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079649245 11:22906246-22906268 ACACAAAATCTGTACAAACATGG - Intergenic
1081022488 11:37964475-37964497 TCCCAAATTGTCTTCCAACATGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085060772 11:73444689-73444711 AACCTAAATGTCTACCAACAGGG + Intronic
1086102352 11:83114324-83114346 AGCCAAAATGTCTATCAACAGGG + Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1086987278 11:93263993-93264015 ACCCAGCAAGTTTCCAAACAGGG + Intergenic
1087740346 11:101880180-101880202 ACACAAAATGACACCTAACAGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089182155 11:116590503-116590525 TCCCAAAATGTCTGCCACCAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090064600 11:123492011-123492033 ACCTACAATATCTCCAAACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094090319 12:26642788-26642810 ACCCAAAATGTTTCCAATCAGGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095513716 12:42982720-42982742 CACCAAAATGTCTCTAAATAAGG + Intergenic
1098708019 12:73715964-73715986 AACAAAGATGTCCCCAAACAAGG - Intergenic
1098833737 12:75394811-75394833 ACCCAAAATGTTACAAATCAAGG - Intronic
1099506205 12:83479212-83479234 GCCTAAAATGTCTCCTAAGATGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102444355 12:112990345-112990367 AGGCAAAATGTCTCAAAGCAGGG + Intronic
1102476036 12:113189147-113189169 ACCCCAAATGTCTCTACACTTGG - Intronic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106173740 13:27310441-27310463 ACACAAAATATCTCCTAATAGGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1110185598 13:72671343-72671365 AACCCAAATGTCCCCCAACAGGG + Intergenic
1110760382 13:79224460-79224482 ATCCAATGTGTCTGCAAACAGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112551502 13:100425031-100425053 ACCCATAATCTTTCAAAACAGGG - Intronic
1113039579 13:106090358-106090380 AACCAAAATGTTCCCAAATAGGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116687829 14:48064393-48064415 AGCCAAAATGTTTACAACCAAGG + Intergenic
1116755790 14:48946441-48946463 ACCTAAAATTCCTCCAAACCAGG - Intergenic
1116822366 14:49637943-49637965 ACCCAGAAGCTCTCCCAACATGG - Intergenic
1117995621 14:61475015-61475037 ACCCAAAATATCTTCCCACATGG + Intronic
1118899863 14:69977539-69977561 ACTGAATATGGCTCCAAACATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1122057244 14:99109621-99109643 AGCCAAAATTTCTCCAAATTTGG - Intergenic
1122296788 14:100710298-100710320 ACCCAAAAATTATCCACACATGG - Intergenic
1122390518 14:101378649-101378671 ACCCAAAAGGTATCCAGAAATGG + Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1123928208 15:25139717-25139739 ACCCAAACTGTAACCACACAGGG - Intergenic
1128959301 15:71984504-71984526 AACCATTATGTCTTCAAACACGG + Intronic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130833045 15:87621247-87621269 ACCCAAGAATTCTCCATACATGG - Intergenic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131529319 15:93178660-93178682 AGCCTAAATGTCTCCAGCCACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135565011 16:23505366-23505388 ACCTAAGATGTCTACCAACAGGG + Intronic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1139212256 16:65090882-65090904 ACTTAAAATATCTCCAAACCTGG - Intronic
1139782939 16:69366775-69366797 CCCCAAAATTTCTACAAAGAAGG + Intronic
1140002665 16:71040653-71040675 ACCCAGACTCTCTGCAAACATGG + Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140773943 16:78232555-78232577 ACCCAAAATCTGTAGAAACAAGG - Intronic
1140934502 16:79658024-79658046 AACAAATATGTCCCCAAACATGG + Intergenic
1140954117 16:79846742-79846764 AACAAAAATGTCTCCATGCATGG - Intergenic
1141371930 16:83495740-83495762 AGCCAAAAAGTCTCAAAAGAGGG - Intronic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141644505 16:85360112-85360134 TCCCCAAAGGTCTCCAAAAAGGG - Intergenic
1141743017 16:85906777-85906799 CCAAAAAAGGTCTCCAAACATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1142479797 17:212007-212029 CCTCAAAATGTCTACAAAGAAGG - Intergenic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144268303 17:13593049-13593071 ACCCAAAGTGTCTACAACAAAGG + Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1145211757 17:21018554-21018576 ACACAAAAATTATCCAAACATGG + Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150480108 17:65502686-65502708 AGCCTAAATGTCTGCAAATAGGG + Intergenic
1150801962 17:68290259-68290281 ATATAAAATGTCACCAAACATGG - Intronic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154167569 18:12027521-12027543 AAGCAAAATGACTCCAAACTGGG - Intronic
1154286467 18:13061850-13061872 ACCAGTAACGTCTCCAAACATGG + Intronic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156545516 18:37960298-37960320 AGCCATAATGTCTGGAAACAGGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159159609 18:64626222-64626244 CCCCAAAATGTATCAAAAGATGG + Intergenic
1160615191 18:80120966-80120988 ACCCAAAATAACTGAAAACAGGG - Intronic
1160721056 19:597065-597087 AACCACAATGCCTCCAAGCAGGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163977044 19:20862546-20862568 ACCCAAACTTTTTCCAAATAGGG + Intronic
1164015054 19:21248232-21248254 ACCTACAAGGTCTCCAAAAAGGG + Intronic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1165348084 19:35261594-35261616 ACCCCAAAGGGCTCCAACCACGG - Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1167572262 19:50296226-50296248 ACCCAAAAGGCCTAGAAACAGGG + Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925362926 2:3292141-3292163 ACCCAGAATATTTCCCAACAGGG - Intronic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
927422667 2:22949355-22949377 ACTCAACATCTCTGCAAACAAGG + Intergenic
928441758 2:31297870-31297892 ACCCTGCATGTCTCCTAACAGGG + Intergenic
928469119 2:31555965-31555987 ACCCAAAATCTCACCAATGATGG - Intronic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
932145085 2:69309118-69309140 ACCCAACATGTCTAAAAAGACGG + Intergenic
932146425 2:69322822-69322844 ACACAATATGCCCCCAAACATGG + Exonic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937415286 2:121709878-121709900 TCCCACAGTGTCTCCAAACTCGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937954237 2:127410895-127410917 AACCAAAATGTCACCAGAAAAGG - Intergenic
939614996 2:144352575-144352597 AACCTAAATGTCTCTCAACAGGG + Intergenic
939885314 2:147675199-147675221 ACCCAGAATGTCTCCTAGTATGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940234283 2:151492941-151492963 CCCCAAAATATATCCAAAGAAGG + Intronic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
943417121 2:187621505-187621527 AACTAAAATGTCCCCAAATATGG - Intergenic
943859848 2:192847774-192847796 ACCCAGAAGAGCTCCAAACATGG + Intergenic
945034378 2:205691679-205691701 TCCCCAAATGTCTCCTAAAATGG + Intronic
947041282 2:225923705-225923727 ACCCAAAATGTCTCCATCGCTGG + Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1169809935 20:9599344-9599366 ACCCAAAATAGTTCAAAACAAGG - Intronic
1169849075 20:10031133-10031155 ACCAACTTTGTCTCCAAACATGG + Intronic
1169983467 20:11413607-11413629 AACCAAAATGTCATCTAACAGGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1171001611 20:21421722-21421744 AACTAAAATATCTCCAAATAGGG - Intergenic
1171164794 20:22960210-22960232 TCCCAAAATGTGTCCTTACAAGG - Intergenic
1171363558 20:24607758-24607780 ACCTAAAAAGTCTACAAAAACGG - Intronic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172453804 20:35049875-35049897 ACCCAAAATATCTTCAATGAGGG + Exonic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174832196 20:53823295-53823317 CCCCAAAGTGGCTCCAAGCAAGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1175641783 20:60636193-60636215 ACCTGAAATGTCACCATACATGG - Intergenic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1181089962 22:20465762-20465784 ACCCAGTATGTTTCCAAACCAGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182792183 22:32962011-32962033 AACCAAAGTGTCTCAAAATATGG + Intronic
1182853842 22:33499927-33499949 ATACAAAATGTAGCCAAACATGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184269021 22:43367152-43367174 ACCCTAAATGTCCATAAACAGGG + Intergenic
1184848329 22:47102695-47102717 TCACAAGATGTCTCCAACCAGGG - Intronic
1184880253 22:47300028-47300050 ACCCAAGATGACTCCAAAGCCGG - Intergenic
949106976 3:211111-211133 ACCCCAAATGTCAGGAAACAAGG + Intronic
951064269 3:18246232-18246254 ACCCAAAATAACTGAAAACAGGG - Intronic
951284160 3:20788891-20788913 ACCGAAAAGGTCTTCAAACATGG + Intergenic
951846864 3:27093932-27093954 AACCCAAATGTCTCTCAACAAGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952218231 3:31298919-31298941 ACCCAAAATATCCCCAAATGTGG - Intergenic
953294336 3:41698162-41698184 AACCAAAAAATCACCAAACAAGG + Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957139283 3:76332161-76332183 TCTCAAAATGTCTCCAATCATGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
958636746 3:96755040-96755062 ACCCAAATTCTCTGGAAACAAGG - Intergenic
959706689 3:109344484-109344506 AACCAAAATTTATCCAAAAAAGG - Intergenic
959780089 3:110220960-110220982 AACCAAAATATATCCAAACATGG + Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961308660 3:125978316-125978338 CCCCAAAACGTCTCCAAATGTGG - Intronic
961398686 3:126617462-126617484 ACCCACAAGGTCTCCATGCAAGG + Intronic
961865258 3:129949172-129949194 ACCCCAAATGTCTTCCCACAGGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962947435 3:140184777-140184799 CCCCAAAATGTATCTAATCATGG + Intronic
963749901 3:149165826-149165848 ACTCAAAAGGTCTCCCAACATGG - Intronic
964193218 3:154030716-154030738 ACCCAAAATATCTCCAACAGTGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964781182 3:160340001-160340023 AGCCAAAATCTCTCCATAAAGGG + Intronic
965139669 3:164817263-164817285 ACCCAGAAGGTTTCCTAACAGGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970105744 4:12581297-12581319 AACCAAAATGTCCACAAATATGG - Intergenic
970110438 4:12631481-12631503 ACCAAAAATGTTTTCAATCATGG - Intergenic
970239101 4:13989486-13989508 AGCCAAACTCTATCCAAACATGG - Intergenic
970307570 4:14749313-14749335 ACCCAAATTATTTCCAAATAAGG + Intergenic
970906056 4:21217768-21217790 AATCAAAGTTTCTCCAAACAGGG - Intronic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
971262771 4:25071934-25071956 ACACAACATGGCACCAAACATGG + Intergenic
972385286 4:38559898-38559920 ACCCAAAGTTTCTCCAAAGATGG + Intergenic
974066541 4:57083020-57083042 CTGCAAAATGTCCCCAAACATGG + Intronic
976320006 4:83703169-83703191 ACACAAAATCTTTCAAAACATGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977335386 4:95691911-95691933 AGAGAAAATATCTCCAAACACGG - Intergenic
977648328 4:99439752-99439774 AGCCAGAATGGATCCAAACATGG + Intergenic
977854338 4:101871045-101871067 AACCAAAATATCACCAAAAAGGG + Intronic
978314715 4:107422871-107422893 ACCTAAAATTTCTCCACACCAGG + Intergenic
978319161 4:107475367-107475389 AACAAAAATGTCACCAAAAATGG + Intergenic
979062724 4:116084361-116084383 ACCCAAAATATCTCAAAATTTGG + Intergenic
979928125 4:126593580-126593602 TGCCAAAATGTCTTCAAAAATGG - Intergenic
980085605 4:128387207-128387229 ACCCAAACTGGCTCCACACCAGG - Intergenic
981180619 4:141739091-141739113 ACCCAAAATGACTCAAAGGAAGG + Intergenic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
981742017 4:148012566-148012588 AACCGAAATGTTTCTAAACAAGG - Intronic
983010944 4:162546354-162546376 AACCATATTGTCTGCAAACAGGG + Intergenic
983426271 4:167587889-167587911 TCCCAAAATGTTTTCAAATATGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985632021 5:1018743-1018765 ACACAAGATGCCTCCAAGCAAGG - Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989438466 5:41441834-41441856 ACCCAGGTTGTCTCCACACATGG + Intronic
990366164 5:55071876-55071898 AATCAAAATGCCGCCAAACAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990934751 5:61136075-61136097 ATCCTAAATGTTTGCAAACAGGG - Intronic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
992370062 5:76134496-76134518 CCTCAAAATGCCACCAAACATGG - Intronic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993912719 5:93704072-93704094 ACTCAAAATGGCTTCAAAGAAGG + Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
996029757 5:118692214-118692236 ACCCCAACTGTCTCCATGCAAGG + Intergenic
996193441 5:120573729-120573751 ACTCAAAATGTCTGCAGCCATGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998189054 5:140007043-140007065 AACAAAAATGTCTCTAAACATGG - Intronic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
1000102733 5:158032189-158032211 ACTGAAAATGTCTTCAAATATGG + Intergenic
1000915455 5:167075689-167075711 ACCAAAAATGTTTCCAATTATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001193348 5:169650700-169650722 ACCCAAGATGGCTCCATACTTGG + Intronic
1001262049 5:170238885-170238907 AGCCTATATGTCACCAAACAAGG + Intronic
1001778331 5:174345893-174345915 AATCAAAATGTCCCCAAATAGGG - Intergenic
1002286588 5:178166425-178166447 ACCCAAAAAGTCTGCAACCCAGG + Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003737215 6:8890244-8890266 ACACAAAATACCTCCAAAAATGG - Intergenic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005354000 6:24964537-24964559 AACCAAAATGTCTCCCAGTAGGG - Intronic
1005422066 6:25661603-25661625 ACCCAAGATGCCTCTAAAGATGG + Exonic
1006222282 6:32501470-32501492 AGCCAAAATGTCCCTCAACAGGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008486784 6:52044987-52045009 AGCCAACATGTCTCCAAATATGG + Exonic
1009014369 6:57880699-57880721 ACCCAAAATGTATACACAGAAGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013584245 6:111564710-111564732 AACCAAACTGTCGCCAAACTTGG - Intronic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1019811451 7:3168198-3168220 ACACCAAAAGTCTTCAAACAAGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022438400 7:30411877-30411899 ATCTAAAATGTCTCCTTACAGGG + Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025758979 7:64372699-64372721 AGCCAAAAAGTCTCAACACAGGG - Intergenic
1025970659 7:66321260-66321282 ACACAAAATGTTTCCAATCAAGG + Intronic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030202339 7:106918355-106918377 ACCCAAAAGTTCCCCAAACCTGG + Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030550225 7:110949059-110949081 AGCCGAAATGTCTCAAAACAAGG - Intronic
1031092809 7:117381419-117381441 ACTCAAGATTTCTCCAAATAGGG + Intronic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032981277 7:137286093-137286115 ACCCTAAATGACTCTAAACTAGG - Intronic
1033474157 7:141674688-141674710 ACCCCAAATGTCTCAAATAAGGG + Intronic
1033858624 7:145596939-145596961 ACCCAAAGTGCCCCCAAACAAGG + Intergenic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1036047857 8:5164135-5164157 TACCAAACTGTCTCCCAACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1038374105 8:27020928-27020950 AACCAAAATAGATCCAAACAAGG - Intergenic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1038447346 8:27613050-27613072 TCCCAAAACGTTTCCAAGCAGGG + Intronic
1039346012 8:36706465-36706487 ATCCATTATGTCTTCAAACATGG + Intergenic
1040357615 8:46634876-46634898 ACCCAAAAAGTCTCAACACCTGG - Intergenic
1040594665 8:48825543-48825565 AACCCAAATGTCTCCCAGCAAGG - Intergenic
1041299415 8:56395174-56395196 AACTAAAATGGCTCCAAACCTGG + Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047322881 8:123804784-123804806 AACCAAAATGTCCACCAACAGGG - Intronic
1047646270 8:126873823-126873845 ACCAAAAAAGGCTTCAAACAAGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1052252713 9:26418400-26418422 ACACCATATGTCTCCAAACAGGG - Intergenic
1052848552 9:33360149-33360171 ACACAGAAGGTCTCCAAACATGG + Intronic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1055124356 9:72702142-72702164 ACCCATAAAGTCCCCAAACTTGG + Intronic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056621517 9:88218649-88218671 ACCCAAAAAGTGGCCAAAAAAGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1059759143 9:117321875-117321897 ACCAAAACTGGCTCCAAATATGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061787127 9:133036222-133036244 ACCCAGCAGGTCTCCTAACAGGG - Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187767622 X:22660735-22660757 ATCCAGAATTTCTGCAAACAGGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189550506 X:42087645-42087667 ACCAATCATGTCACCAAACAAGG - Intergenic
1190464724 X:50714884-50714906 TCTCAAAATGTCTCTGAACATGG - Intronic
1192745948 X:73939104-73939126 ACCCAAGATATCTGCAAACGTGG + Intergenic
1195323450 X:103739562-103739584 ACACAATATTTCCCCAAACAGGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195704752 X:107730726-107730748 AAACAAAATGTCACCAATCACGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1197273256 X:124449000-124449022 ACCCAGACTGGCTCAAAACAAGG - Intronic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200904241 Y:8465050-8465072 ATCCAAAATGTCTCAACACCTGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic