ID: 910943077

View in Genome Browser
Species Human (GRCh38)
Location 1:92558121-92558143
Sequence CAGGAGTCCCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 1, 2: 5, 3: 66, 4: 517}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910943077_910943083 18 Left 910943077 1:92558121-92558143 CCTTCCTCCTTCTGGGACTCCTG 0: 1
1: 1
2: 5
3: 66
4: 517
Right 910943083 1:92558162-92558184 TTTCCCGCCTATCTCCCTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 117
910943077_910943086 24 Left 910943077 1:92558121-92558143 CCTTCCTCCTTCTGGGACTCCTG 0: 1
1: 1
2: 5
3: 66
4: 517
Right 910943086 1:92558168-92558190 GCCTATCTCCCTGGTGGTTTTGG 0: 1
1: 0
2: 1
3: 9
4: 116
910943077_910943082 15 Left 910943077 1:92558121-92558143 CCTTCCTCCTTCTGGGACTCCTG 0: 1
1: 1
2: 5
3: 66
4: 517
Right 910943082 1:92558159-92558181 CAGTTTCCCGCCTATCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910943077 Original CRISPR CAGGAGTCCCAGAAGGAGGA AGG (reversed) Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
900136929 1:1121679-1121701 CAGGAGTCCCAGATGGGGTGGGG - Intergenic
900347094 1:2215105-2215127 CGGGAGTCCCACTAGGAGGAGGG + Intergenic
901380132 1:8867650-8867672 CTGTAGTCCCAGCAGGAGAATGG - Intronic
901902823 1:12380591-12380613 CAGGGGTCTGAGAAGTAGGAAGG + Intronic
902741961 1:18445089-18445111 CAGGAGTCCCCTTAGGAAGAAGG + Intergenic
902937100 1:19772423-19772445 CAGGAGTCCCCAGGGGAGGATGG + Intronic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
904312101 1:29635550-29635572 GAGGGGTCCCAGAAGGGGGCTGG + Intergenic
904463118 1:30692274-30692296 AAGGAAGCCCAGAGGGAGGAGGG + Intergenic
904756259 1:32770404-32770426 CAGGTGTCACTGGAGGAGGATGG - Exonic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905004449 1:34698599-34698621 GGGGAGCCCCACAAGGAGGAAGG + Intergenic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905260240 1:36712154-36712176 TAAGAATCACAGAAGGAGGAAGG - Intergenic
906239991 1:44236960-44236982 CTGGAGTCCCTGGAGGAGGTGGG - Intronic
906288265 1:44602628-44602650 CGGGAGTCAGTGAAGGAGGAGGG - Intronic
906318394 1:44802463-44802485 CAGGAGTGCAGGAAGGGGGAAGG + Intronic
906510071 1:46405742-46405764 CAGATGCCGCAGAAGGAGGAGGG - Exonic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906927376 1:50133089-50133111 CAGGAGTCTAACAAGGGGGATGG - Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
910351786 1:86307051-86307073 CAGGAGTACTGGAAGGAGGCTGG - Intergenic
910459034 1:87428379-87428401 CAGGAGTCCCAGAAGGTCCGGGG + Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
911866664 1:103034294-103034316 TAGGAGTCCCAGAAAAAGTAAGG - Intronic
914316318 1:146515297-146515319 CAGGAGTCCCAGAAGGTCCAGGG + Intergenic
914498038 1:148218064-148218086 CAGGAGTCCCAGAAGGTCCAGGG - Intergenic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
914948370 1:152087006-152087028 CAGCAGTCCCACAGAGAGGAAGG - Exonic
914988326 1:152478359-152478381 CATGTGTCCTAAAAGGAGGAGGG + Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915135556 1:153728717-153728739 CAGGAGCCCCAGGAGGGGGGAGG + Exonic
915211480 1:154312898-154312920 CAGGAGTCCAACAGGGAGAAAGG - Intergenic
915598503 1:156908437-156908459 CAGGTGTCACAGAAGGGGAAAGG + Intronic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
915929215 1:160048378-160048400 CAGTTGGCCCAGAAGGAGCAGGG - Intronic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916512652 1:165486369-165486391 GATGGGTCCCAGAAGGAGTAGGG - Intergenic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
920274682 1:204795358-204795380 GAGGAGTTCTAGAAGGAAGAAGG + Intergenic
920697119 1:208189406-208189428 CAGGAGGCCCAGAATAGGGAGGG + Intronic
922821188 1:228486999-228487021 CAGGAGTTACTGAAGTAGGAAGG + Intergenic
922822322 1:228493140-228493162 CAGGAGGCTGAGAAGGAGGAGGG + Exonic
923191864 1:231627279-231627301 CAGGTGTCCCAGGACGGGGACGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
1063993630 10:11594930-11594952 GATGGGTCCCAGAAGGAGGCAGG + Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064961908 10:20974452-20974474 CAGGAGTTCGAGAAGCAGCATGG - Intronic
1065313432 10:24438528-24438550 CAGGAGTACAAGCAAGAGGAGGG - Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG + Intergenic
1067808538 10:49409683-49409705 CAGGAGGGCAGGAAGGAGGAAGG - Intergenic
1067840161 10:49669315-49669337 GAGAAATCCCAGAAGGAGGTGGG - Intergenic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1068332722 10:55592378-55592400 CAGCATTCCTAGAAGCAGGAGGG - Intronic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068899535 10:62251411-62251433 CAGGAATCCAGGAAGGATGATGG + Intronic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069541484 10:69297508-69297530 CAGGACTCTCACAATGAGGAGGG + Intronic
1069957878 10:72062800-72062822 GAGGAGGCCGAGGAGGAGGAGGG - Exonic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071666223 10:87561525-87561547 GAGGATTCCCAAAAGAAGGATGG + Intergenic
1073088617 10:100913029-100913051 CCGGAGTCCCAGCAGCAAGACGG + Exonic
1073455455 10:103634135-103634157 CAGGGATCCCGGATGGAGGATGG - Intronic
1073498289 10:103913899-103913921 CAGGCCCCCAAGAAGGAGGAGGG + Intronic
1074432576 10:113406494-113406516 CGGGAATCCCAGAAGTAGCAAGG + Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1075688201 10:124378391-124378413 CCTGAGTCCAAGAAGGAAGAAGG + Intergenic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1075995643 10:126874093-126874115 CTGGAGTTCCAGGAGGAGGTGGG - Intergenic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1077102567 11:828635-828657 GATGAGGCCCAGGAGGAGGAGGG + Exonic
1077147407 11:1052342-1052364 CAGGTGCCCCAGGAGGGGGAGGG - Intergenic
1077224294 11:1433363-1433385 CAGGAGACCCCAAAGGATGAAGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1079481987 11:20890884-20890906 CTGGAGTACCAGAAGGAGACAGG + Intronic
1080863144 11:36167996-36168018 CGGGAGTCTAAGAAAGAGGAGGG - Intronic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083097711 11:60268547-60268569 CAGTAGTCCAAGAGAGAGGATGG - Intergenic
1083621987 11:64053728-64053750 CAGCAGTCCCAGAGAGCGGAAGG - Intronic
1083679407 11:64344297-64344319 CAGGAGTCCCCGGAGAAGGCTGG + Exonic
1083809520 11:65095982-65096004 CTGCTGTCCCAGAAGGGGGACGG - Intronic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1084195964 11:67523718-67523740 CCTGGGTCCCAGGAGGAGGAAGG + Intergenic
1084680788 11:70665063-70665085 GAGGGGTCCCTGTAGGAGGAAGG - Intronic
1085084168 11:73655768-73655790 CAGAAACCCAAGAAGGAGGAGGG - Intronic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1087204026 11:95375133-95375155 CAGAACTCCAAGATGGAGGAGGG + Intergenic
1089280188 11:117368669-117368691 AAGGACTCCAAGAAGGAGGTGGG - Intronic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1089647692 11:119890902-119890924 CAGGAGACCAAGAAGCAGGTGGG + Intergenic
1089849363 11:121482953-121482975 CAGGAGACCAAGAAGGAAGTGGG - Intronic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090051126 11:123380832-123380854 CTCCAGTCCCAGAATGAGGAGGG - Intergenic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094344631 12:29453587-29453609 TATGAGTCCCAAAAGGTGGAAGG - Intronic
1094800376 12:34026260-34026282 CAGAAATCCCAGAAGGATGTAGG - Exonic
1095113165 12:38320558-38320580 CAGAAATCCCAGAAGGATGTAGG - Exonic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1096668537 12:53183388-53183410 CCAAAGTCCCAGAAGGTGGAGGG + Intronic
1097410223 12:59243334-59243356 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097749118 12:63332129-63332151 CTGGAGTACCAGAAGGAGACAGG + Intergenic
1099862481 12:88237637-88237659 CAGGAGTTCAATAAGGAGAAGGG - Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101427631 12:104600898-104600920 AAGGAAGCCGAGAAGGAGGAAGG - Intronic
1101789031 12:107911524-107911546 CATTAGTCCCAGAGGGTGGAGGG + Intergenic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102113991 12:110387123-110387145 CAGGAGGCTGAGCAGGAGGATGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1103798757 12:123523494-123523516 GAGGAGTTCCAGAAGCATGAAGG - Exonic
1103841603 12:123869706-123869728 GAGGAGCCTGAGAAGGAGGAAGG - Intronic
1104110394 12:125699033-125699055 TAGGAGACCCAGCAGAAGGAAGG + Intergenic
1104685220 12:130780508-130780530 CAGGAGTCGCTGGTGGAGGAGGG - Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1106194293 13:27480202-27480224 CAGCAGGCCGAGAAGCAGGAAGG + Intergenic
1108160568 13:47633848-47633870 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1112258700 13:97858234-97858256 CAGCAGGCCTGGAAGGAGGAAGG + Intergenic
1112522270 13:100106993-100107015 CAGGAATCCGGGAAGGAGAAAGG - Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113378980 13:109786248-109786270 CAGGAGCCCCAGAGCGCGGAGGG - Exonic
1113464592 13:110504467-110504489 CAGGTGTCCCAGGAAAAGGAGGG - Intronic
1113592795 13:111512733-111512755 CCTGGGTCCCAGGAGGAGGAGGG + Intergenic
1113788601 13:113015785-113015807 CAAGTGGCCCAGGAGGAGGAAGG + Intronic
1114451719 14:22830794-22830816 CTGGAGTCTCATAAGGAGAATGG - Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115084094 14:29492727-29492749 CAAGAATCCCAGAGGGAGAATGG - Intergenic
1115365965 14:32557335-32557357 TAGGAGGCCAAGATGGAGGATGG - Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1116962693 14:50982492-50982514 CTAGAGTCCTAGATGGAGGAGGG + Intronic
1117443719 14:55782869-55782891 CAGATGTCCCTGAAGGAGCAGGG + Intergenic
1118269132 14:64325704-64325726 GAGTAGTCTGAGAAGGAGGAAGG - Intronic
1118839350 14:69499560-69499582 CCTGAGTCCCAGAAGGAGACTGG + Intronic
1119323735 14:73746430-73746452 CAGGGATCCCAGCAGGAGTAGGG + Intronic
1119586682 14:75842394-75842416 GAGGAGGCCGAGAAGCAGGAGGG + Intronic
1120286100 14:82504005-82504027 CAGGAGTTCCAGGAGGTGAAAGG - Intergenic
1121682638 14:95806673-95806695 TAGGAATCCCAGAAGGAGAATGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1122274682 14:100585486-100585508 CAGGAGTGCCTGCAGGAGTAGGG + Intronic
1122546335 14:102524701-102524723 CAGGAGTCCCTGCAGGAGTTGGG + Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123625375 15:22223472-22223494 CAGGAGGCCGAGCAGAAGGAGGG - Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124075196 15:26437668-26437690 AATCAGTCCCAGAAGGACGATGG - Intergenic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1124218817 15:27832011-27832033 CAGGAGTCTCTGACGGAGCAGGG - Intronic
1124653127 15:31487349-31487371 CAGCTGTCCCAGGAGGAGCAGGG + Intronic
1126168922 15:45677945-45677967 CAGGAGGCCGAGCAGGTGGATGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126598476 15:50405165-50405187 GTGGAGTCCTTGAAGGAGGAAGG - Intergenic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128583825 15:68829841-68829863 CAGGAGAGCCAGAAGGATAAAGG - Intronic
1129410950 15:75349962-75349984 CAGGAGGCTAAGAAGGTGGAGGG + Intronic
1129882979 15:79019179-79019201 CAGGAGGCCCAGTCTGAGGAGGG + Intronic
1130106295 15:80931139-80931161 CCTGAGACCCAGAAGGAGGTGGG - Intronic
1130586863 15:85189948-85189970 CAGCAGTGCTAGCAGGAGGAGGG + Intergenic
1131902875 15:97107927-97107949 CTGGAGTCCCTGAAGGAGATGGG + Intergenic
1132207141 15:99993927-99993949 CAGGATTCCCAGCAGCAAGAAGG + Intronic
1132230902 15:100183276-100183298 CAGGAATCCCAGAAGCATGGTGG - Intronic
1132557787 16:580023-580045 AAGCAGTCCCAGTAGCAGGAGGG - Intronic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133064248 16:3194911-3194933 CAGAAGTCACAGAAGAAGGGCGG - Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133777006 16:8904407-8904429 CCGGAGTCCCAGAAGGGCGGGGG + Intronic
1134368660 16:13603307-13603329 CAGAGCTCCCAGAAGGAGAAAGG - Intergenic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135942665 16:26836180-26836202 CAGGAGTCCACGGAGGAGGCGGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136172445 16:28497053-28497075 CAGAAGTCCCAGAGGCAGGCGGG + Exonic
1136285405 16:29237554-29237576 CAGCAGCCCCAGAAGCTGGAAGG - Intergenic
1136448339 16:30337573-30337595 CCTGAGACCCAGAAAGAGGAAGG - Intergenic
1136999517 16:35216786-35216808 CAGGAGCCCAGGAAAGAGGAAGG - Intergenic
1137003433 16:35251220-35251242 CAGGAGCCCAGGAAAGAGGAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1139401437 16:66684919-66684941 CAGGGCTCCAGGAAGGAGGAAGG - Intronic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1140452705 16:75083858-75083880 CAGGAGTACTAGAAAGAGAAAGG + Intronic
1140721159 16:77773514-77773536 CTTGAGTCCCAGAGGTAGGAAGG + Intergenic
1141231374 16:82170485-82170507 AGGGAGTCCCCGAGGGAGGATGG - Intergenic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141769803 16:86082929-86082951 CAGGTGTCCGAGGAGGAGGCAGG + Intergenic
1142047534 16:87935258-87935280 CCTGAGACCCAGAAAGAGGAAGG + Intronic
1142090730 16:88207686-88207708 CAGCAGCCCCAGAAGCTGGAAGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142642050 17:1289861-1289883 CCTGAGTCCCAGCTGGAGGAAGG + Intronic
1142688042 17:1589055-1589077 AACGGGTCACAGAAGGAGGAGGG + Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1143100699 17:4503209-4503231 CAGGAGCCCCAGGTGGAGGTAGG + Intronic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1145890051 17:28407845-28407867 CAGGAGTCCGAGACTCAGGATGG + Intergenic
1146000333 17:29126833-29126855 CAGGAGGCTGAGAAGCAGGAGGG - Intronic
1146134950 17:30311370-30311392 CAGGAGTGTCAGAAGAAGTAAGG + Intergenic
1146176598 17:30669238-30669260 CAGGTGTGCCAAAATGAGGACGG + Intergenic
1146350060 17:32085353-32085375 CAGGTGTGCCAAAATGAGGACGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147371580 17:39996477-39996499 CAGGGGGCCCAGAATGGGGAGGG + Intronic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148862820 17:50613416-50613438 CAAGAGGCCCAGAAGGAAGGCGG - Intronic
1149160007 17:53681177-53681199 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1150131319 17:62670729-62670751 AAGGAGTCCCAGCTGGGGGATGG + Intronic
1151231747 17:72690065-72690087 CACGCTCCCCAGAAGGAGGAAGG - Intronic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1152103663 17:78316726-78316748 CAGGGGTCCCAGAGGGTGGTGGG - Intergenic
1152233935 17:79128712-79128734 CAGGAGTCCCCACAGGAGCAGGG - Intronic
1152343498 17:79737991-79738013 CAGCAGTCCCATCACGAGGAGGG - Exonic
1152537641 17:80959886-80959908 CAGGAGTCCCAGGGAGAGGCAGG - Intronic
1152694275 17:81735808-81735830 GAGAAGTCCCAGGAGAAGGAAGG - Intergenic
1152701344 17:81821454-81821476 CCAGATTCCCAGGAGGAGGAGGG - Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152994535 18:394234-394256 CAGGAGTCCAGAAAGGAGGGTGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153490228 18:5639780-5639802 CAGGAATCCCAGAAACATGAAGG + Intergenic
1153498938 18:5728826-5728848 CAGGAGGTACAGAAGGAGGTCGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156621530 18:38857354-38857376 CAGGATTCCCAGACTGAGCATGG - Intergenic
1157551000 18:48581958-48581980 GAGTAGACCCAGAAGGATGATGG + Intronic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158266046 18:55661712-55661734 CCTGAGTCCTAGAAGGAGGTAGG - Intronic
1158630837 18:59112573-59112595 CAGGAGTCACATGCGGAGGATGG - Intergenic
1158857244 18:61554873-61554895 AAGGAAACCCAGAAGGAAGAGGG + Exonic
1159550041 18:69885460-69885482 GAGAAGCCTCAGAAGGAGGAAGG + Intronic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1159959940 18:74547522-74547544 CAGGCATCCCTAAAGGAGGATGG - Intronic
1160345550 18:78129120-78129142 CTGGAGCCCCAGAAGCTGGAGGG + Intergenic
1160394754 18:78563499-78563521 CAGGAGTCCTTGAACCAGGAGGG - Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160899748 19:1421738-1421760 CAGGAGTCCCAGCAGGACCTTGG - Intronic
1161355148 19:3814883-3814905 CAGGAGGCCCAGAGCAAGGAGGG - Intronic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1161504947 19:4639052-4639074 AACTAGCCCCAGAAGGAGGAAGG + Intergenic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1162548529 19:11345609-11345631 CAGGACTGCAAGATGGAGGAAGG - Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163597318 19:18227633-18227655 CATGTGTCACACAAGGAGGAGGG + Intronic
1163685105 19:18708169-18708191 CAGGAGGCAGGGAAGGAGGAAGG + Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164742234 19:30584267-30584289 CCTGAGTCCCACAAGGAGCAGGG - Intronic
1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG + Intronic
1165341704 19:35217036-35217058 CAGGAGTCCAAGAAAGTGAATGG - Intergenic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166351772 19:42202268-42202290 GAGGAGTCCAAGGAGGAGGTTGG - Intronic
1166883116 19:45940827-45940849 CAGCTGTCCCAGAAGCCGGAGGG - Exonic
1167125275 19:47544943-47544965 CAGGAGGCCCAGAAGGCAGGCGG - Exonic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167609845 19:50501776-50501798 CAGGAGGCCCGGGAGGAGGCTGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1168307379 19:55442834-55442856 CAGGAGTACGAGGAGCAGGAGGG + Exonic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927062067 2:19432621-19432643 CAGTAGCCCCAGAGCGAGGAGGG + Intergenic
927146473 2:20169512-20169534 CAGGCGTCCCAGGAAGAGGTGGG - Intergenic
927151815 2:20200572-20200594 CAAGAGCCCCGGGAGGAGGAAGG + Intergenic
927223450 2:20737338-20737360 CAGAAGTCCCAGGAGGAAAATGG + Intronic
927736356 2:25526055-25526077 CAGGAGCCCCAGGTGGAGGCAGG + Intronic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
928004966 2:27556435-27556457 TAGGAGTCCCAGAAGGAAAGGGG - Intronic
929205781 2:39290954-39290976 CTGTAGTCCCAGCAGGAGAATGG + Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930190093 2:48449301-48449323 CAGTAGCCTCAGAAGAAGGAAGG + Intronic
930294040 2:49530929-49530951 CAGAAGGCTCAGAAGAAGGAGGG - Intergenic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
931263237 2:60638345-60638367 CTGGAGTCCCTGCATGAGGAGGG + Intergenic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
931430516 2:62205561-62205583 CAGGAATCCGAGATGGAGCAGGG + Intronic
931636322 2:64343802-64343824 CCAGAGTCCCAGAAGGAAGATGG - Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932571049 2:72938564-72938586 CAGGAGTCCCAGCAGGAAACTGG - Intergenic
932906412 2:75757467-75757489 TAGGGGTCCTAGAAAGAGGAGGG + Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933762403 2:85681426-85681448 CAGGAATCCCAGAAGACGGAGGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935506572 2:103911984-103912006 CTGGAGTACCAGAAGGAGACAGG + Intergenic
935706301 2:105860476-105860498 TAGGCGTCTCAGAATGAGGAGGG + Intronic
936046676 2:109193959-109193981 CTGGTGCCCCAGAAGGAGCATGG - Intronic
936117406 2:109713078-109713100 CAAGAGACCCAGGTGGAGGAAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936917869 2:117658685-117658707 CAGGTAGCCCAGATGGAGGAAGG + Intergenic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
938967605 2:136402246-136402268 CAGGAATCCCAGGAGGAGGTTGG - Intergenic
939809126 2:146809409-146809431 CTGGAGTACCAGAAGGAGATGGG + Intergenic
942189706 2:173457596-173457618 CAGGAGTCCCACGGGGAAGACGG - Intergenic
943564605 2:189503074-189503096 CAGGTCTCCCTGAAGGAAGAGGG - Intergenic
943928472 2:193819486-193819508 CAGGACTACCAGTAGCAGGATGG - Intergenic
945417598 2:209594156-209594178 CAGGCATCCCAGAGGGAGTATGG + Intronic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
946479532 2:220040798-220040820 CAGGAGACCCAGAAGGAGCAAGG - Intergenic
946536956 2:220640937-220640959 CTGGAGTCTCTGAAGGAGTAAGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947083433 2:226423980-226424002 CAGGAGCCCCATGAGGATGAAGG - Intergenic
948053004 2:234992414-234992436 GAGGAGTGTCACAAGGAGGAAGG + Intronic
948334638 2:237198160-237198182 CAGGACTCCTAGTAGGAGAATGG - Intergenic
948365458 2:237451844-237451866 CAGGGGTGCCGGAAGGAGCATGG - Intergenic
948917520 2:241042897-241042919 CTGGAGTCTGCGAAGGAGGATGG + Intronic
948957268 2:241303271-241303293 CAGGAGCCCCAGATGGTGCAGGG + Intronic
1168769641 20:407425-407447 AAGGAGGCCCAGGAGGAGGCTGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1170589745 20:17762741-17762763 CAGGAGCCTTGGAAGGAGGAGGG - Intergenic
1170599810 20:17832700-17832722 GAGGTGTTCCAGAAGAAGGAAGG + Intergenic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1170747711 20:19115512-19115534 CAGAGGTCCCAGAAGGGGGGAGG + Intergenic
1170760549 20:19245281-19245303 CAGGATTCCTAGAAGAAGAATGG + Intronic
1171543052 20:25979218-25979240 CAGGTGCACCAGAAGGTGGAGGG - Intergenic
1172042023 20:32052527-32052549 GAGGGGTCCCAGGAGGCGGAGGG + Intronic
1172299032 20:33835429-33835451 CTGGAGTCCCCAAAGGAGGAGGG - Intronic
1172768684 20:37364441-37364463 CAGGGGCCCCACAAGGAGGAGGG - Intronic
1172859160 20:38033802-38033824 CAGGGGTGCGAGAAGGGGGAGGG - Exonic
1173176646 20:40769954-40769976 CAGTAGTCCCAGAAGGGGTGAGG - Intergenic
1173275991 20:41583024-41583046 CTGGAGTCCCAGATGGCAGAAGG + Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173585877 20:44182660-44182682 GAGTCGTCTCAGAAGGAGGATGG - Intronic
1173866683 20:46317004-46317026 CAGGAGTCTCAAAAGGAAGATGG + Intergenic
1174114844 20:48219818-48219840 CAGGAGGCCAAGATGGATGAGGG + Intergenic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1174792860 20:53496635-53496657 GAGAAGTCACAGAAGGATGAAGG + Intergenic
1175413158 20:58784783-58784805 CAGGAGCCCCAGGAGCAGCACGG + Intergenic
1175725208 20:61313293-61313315 CCGGAGACCCAGAAGCAGCAGGG + Intronic
1175818576 20:61896362-61896384 CAGGAGGCCCAGATGCGGGACGG - Intronic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1179031125 21:37720490-37720512 CAGGGGACCTTGAAGGAGGAGGG + Intronic
1179055110 21:37924518-37924540 CAGAAGTCCCAGCAGGATGTGGG + Intergenic
1180121332 21:45750406-45750428 CAGGAGTCCAGGAAGAAGGGGGG - Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181386668 22:22550853-22550875 CAGCACTCCCAGAGGGAGGCAGG + Exonic
1181442736 22:22945032-22945054 CAGGTGACCAGGAAGGAGGAGGG + Intergenic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1181520573 22:23447099-23447121 CAGGAGTCCCGGAGGCAGGCTGG - Intergenic
1181959940 22:26615879-26615901 CTTGTGTCCCAGAAGGAGGAGGG + Intronic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183220018 22:36506476-36506498 CACGAGGCCCAGAAAGAGGCGGG + Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183414243 22:37673497-37673519 CAGCAGTTTCAGAAGGGGGACGG + Intergenic
1183547369 22:38461650-38461672 CAGGAGTCACAGAGCGAGGCTGG - Intergenic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184803069 22:46774296-46774318 CAGGAGGCCCAGAGGGAACAGGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
950324817 3:12096929-12096951 TGAGAGTCCCAGAAGGAGAAAGG + Intronic
951159038 3:19393515-19393537 CGGAAGTCCCAAATGGAGGAGGG - Intronic
951857193 3:27210596-27210618 CAGAAGTCGCAGAAGGAATAGGG - Intronic
952307476 3:32158940-32158962 CATGAGTCCCAGGCGGATGACGG - Exonic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
953410111 3:42686022-42686044 CAGGAGGCCGAGACGGAAGACGG - Exonic
953645480 3:44749893-44749915 CAGGAGGCTAAGCAGGAGGATGG - Exonic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
953910316 3:46889515-46889537 CAAGAGTCACAGAAAGAGGAGGG - Intronic
954005349 3:47586268-47586290 CTGGAGTCCGAGAAGGAAAATGG - Exonic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
954661435 3:52228949-52228971 CTGGAGCCCAGGAAGGAGGATGG + Exonic
954980425 3:54740706-54740728 CAGAAGTCCCAGAAGGCAGTAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955717687 3:61847614-61847636 CTGGAATCCCCGAAGGAGGGAGG - Intronic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
956738216 3:72255452-72255474 CAGGAGCCCCACAAGGAAGGGGG + Intergenic
960223401 3:115143860-115143882 CAGAAGTTTGAGAAGGAGGAAGG - Intronic
960600607 3:119454369-119454391 GAGGAGTCCCAAAAATAGGAGGG - Intronic
961007730 3:123416091-123416113 GAGGTGTCCAAGAAGGTGGAAGG + Intronic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
961522354 3:127474032-127474054 CAGGAGTCCCAGCAGGGCCAAGG - Intergenic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
964292068 3:155192609-155192631 CAGGATTCCCAGAAGAGGGAAGG - Intergenic
965162311 3:165150109-165150131 CTGTAGTCCCAGCAGGAGAATGG - Intergenic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967224158 3:187275063-187275085 CTGGAGTCCCAGAAGGGGTGAGG - Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968071894 3:195789315-195789337 CAGGGGGCCCAGAAGGACAATGG - Exonic
968692278 4:1998676-1998698 CTGGAGTACCAGAAGGAGACGGG + Intronic
969511576 4:7620944-7620966 CAGGGGTCGCAGCAGGAGAAGGG - Intronic
970023023 4:11590245-11590267 CAGGAGTCCCAAGAGCAGAAAGG - Intergenic
970148533 4:13065003-13065025 CAGGAGTACCTGAAAGAGAAGGG - Intergenic
970565260 4:17325912-17325934 CAAAAGTTCCAGGAGGAGGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
972667442 4:41180725-41180747 CAGGAGTCCTTGAAGGTGGGAGG - Intronic
973697723 4:53507216-53507238 GAGGGGTCACAGAAGGTGGAAGG + Intronic
974366386 4:60955129-60955151 CAGGAGTGCAAGAGGGTGGAGGG + Intergenic
974624506 4:64405337-64405359 CAGGAGTGCTAGAAGTAGAAGGG + Intronic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
977247692 4:94652893-94652915 CAAGAGTCACAAAAGGAGAAAGG - Intronic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978206325 4:106084462-106084484 CCGGAGTACCAGAAGGAGACAGG + Intronic
981294764 4:143118983-143119005 CAGGAGTCCTAGAGAGAGGAAGG - Intergenic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982419592 4:155178861-155178883 TGGGAGTTCCAAAAGGAGGAAGG - Intergenic
982867449 4:160533939-160533961 CAGGAGGCCGAGCAGGAGAATGG + Intergenic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985665874 5:1181289-1181311 CAGAAGCCTCAGAAGGAGAAGGG - Intergenic
985828034 5:2207187-2207209 AAGGTGTCCCAGAAGGGAGATGG - Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986970970 5:13336043-13336065 CAGGAGTAACACAAGGAGCAAGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
988059646 5:26150046-26150068 CTGGAGTACCAGAAGGAGACAGG + Intergenic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988991147 5:36672158-36672180 CAGGAGCCCTAAATGGAGGAAGG + Intronic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990736936 5:58874897-58874919 CAAAAATCCCAGAAGTAGGATGG + Intergenic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
990907759 5:60822025-60822047 CAACATTCCCAAAAGGAGGAAGG - Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
993527061 5:88977821-88977843 CAAGAGTACCAGAAGGTAGAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994382584 5:99088796-99088818 TGGTAGTCCCAGAGGGAGGAGGG - Intergenic
994407002 5:99357900-99357922 CAAGAGTCCCAGGAGGAAAATGG - Intergenic
995539348 5:113169277-113169299 CAAGAAACCCAGAAGGAGAAAGG + Intronic
996390281 5:122952943-122952965 CTGGAGTCCCAGAAGGAAAGGGG + Intronic
996688716 5:126313938-126313960 CTGGATTCCAAGAGGGAGGAGGG + Intergenic
998034410 5:138901996-138902018 CAGGAGGCCTGGGAGGAGGAAGG - Intronic
998536711 5:142939509-142939531 CAGGAGTTCTAGAAGGACTAGGG - Intronic
999395430 5:151223967-151223989 CGGGAGCCCCCGGAGGAGGATGG - Exonic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1001839137 5:174858675-174858697 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1001875261 5:175194824-175194846 CAGGCAGCCCAGAAGGAGGGAGG + Intergenic
1002395805 5:178953183-178953205 CAGGAGTCACTGAAGGGGCAGGG - Intronic
1002640112 5:180626703-180626725 CAGGTGTCTAAGAAAGAGGACGG - Intronic
1002668702 5:180847096-180847118 TAGGAGTCCCAGAAGGAGATGGG + Intergenic
1003455067 6:6274691-6274713 CAGTAGTCCCAGGAAGAGGCTGG - Intronic
1004253639 6:14043203-14043225 CAGGAGTCCCTGCATGAGGATGG + Intergenic
1005695001 6:28343646-28343668 CTGTAGTCCCAGCAGGAGAATGG - Intronic
1005926783 6:30451506-30451528 CAGGAGGCTCTGAAGGAAGAGGG + Intergenic
1006025363 6:31143317-31143339 GAGGAGGCCCGGAAGGAGGAGGG - Exonic
1006362994 6:33597864-33597886 TAGGAGTCAGAGAAGTAGGAAGG + Intergenic
1007073451 6:39052450-39052472 AAGGCCTCTCAGAAGGAGGAAGG - Intronic
1008365869 6:50678957-50678979 CAGGAGGCTCAGGGGGAGGATGG + Intergenic
1008927275 6:56900131-56900153 CTGGAGTTCTAGAATGAGGATGG - Intronic
1011161834 6:84399809-84399831 CAGGAGTCCCAGAAAGCCCAGGG - Intergenic
1011626029 6:89284609-89284631 CAGGAGCCACAGAATGTGGACGG + Intronic
1012433112 6:99186808-99186830 CAAGAGTCCCTGAAGAGGGATGG - Intergenic
1012999084 6:106003937-106003959 GAGGAGTGACAGATGGAGGAAGG + Intergenic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1014604697 6:123458449-123458471 CTGAAGTCCCCCAAGGAGGAAGG + Intronic
1016460788 6:144278633-144278655 GAGGAGTCCCGGAAGCAGGGAGG + Intergenic
1017039268 6:150294793-150294815 CCAGAGTCCCAGCAGGAAGATGG + Intergenic
1017289560 6:152720241-152720263 CAGGGGTCCCAAGAGAAGGAAGG + Intronic
1017981189 6:159402170-159402192 CAGGAGAGCCAGAAAGGGGAGGG - Intergenic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018547353 6:164952345-164952367 CAGAAGTGGCAGAAGGTGGAAGG - Intergenic
1018696944 6:166397788-166397810 CTGTGGTCCCAGAAGGTGGAGGG - Intergenic
1018788838 6:167130942-167130964 GAGGAGTCCCGGAGGGAGGGGGG - Intronic
1018790296 6:167143180-167143202 AAGGAGGCCCAGAAGGCTGAAGG - Intergenic
1019312359 7:369048-369070 CAGGAATCCGAGAAGAGGGAAGG - Intergenic
1021965561 7:25915009-25915031 AAGGAGACCCAGAAGGAGTGGGG - Intergenic
1022412245 7:30148376-30148398 CAGGAGTCACAGAAGGACATGGG + Intronic
1023026857 7:36058533-36058555 CAGGAGTCCCAGGAAGGGGGAGG - Intergenic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023595980 7:41829866-41829888 CACAGGTCCCAGAAGGAGGCTGG - Intergenic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023843041 7:44107408-44107430 CAGGAGTTCCAGAAGCAGGTGGG - Intronic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1024711666 7:52021869-52021891 CAGGAGGCCTAGAGGGAGCAAGG - Intergenic
1024797528 7:53036452-53036474 CAGAAGTCCCAGATGGCGGATGG - Exonic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027267480 7:76502410-76502432 CAGGAGGCACAGCAGGTGGAAGG - Exonic
1027319295 7:77002275-77002297 CAGGAGGCACAGCAGGTGGAAGG - Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028987482 7:97019502-97019524 CAGGAGTGCAAGAAGAAGGAAGG + Intergenic
1029215111 7:98942392-98942414 CAGGAATGCCAGAAGCAGAAGGG - Intronic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1029524894 7:101088429-101088451 CAGCAGCCCCAGAAGGATGGTGG + Exonic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032077357 7:128842408-128842430 CAGGGGTCCCTGAGGGAGGGCGG + Intronic
1033254216 7:139785561-139785583 CAGCAGTCCAAGGAGGAGGTAGG - Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034590472 7:152133943-152133965 TACGAGTCCCAGGAGGAGCAAGG - Intergenic
1034803257 7:154065991-154066013 CAGTAGTCACAGAAGTATGAAGG - Intronic
1035743441 8:1945487-1945509 CTGGAGGCCCACCAGGAGGAAGG + Exonic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037143271 8:15542391-15542413 CAGAATTCCAAGAAGAAGGAGGG + Intronic
1037757724 8:21722203-21722225 AGGGAGTCCAAGTAGGAGGAAGG - Intronic
1038685952 8:29718710-29718732 CTGGACTCCCACAAGGAGGCCGG + Intergenic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1042148397 8:65756347-65756369 CTGGAGTCCCAGAAAGAAAAAGG - Intronic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045705728 8:104920375-104920397 CTGGGGTCCCAGAAGGATGTGGG + Intronic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1048403301 8:134092801-134092823 CAGGAGTCCCAGAAAGGGCAGGG + Intergenic
1048413414 8:134199461-134199483 GAGGAGCCCCAGAAGGAGATGGG + Intergenic
1049251957 8:141593983-141594005 CAGGGGTCCCAGGAGCAGAACGG + Intergenic
1049268648 8:141682705-141682727 CAGGAGGCCCAGAGGGAGACAGG + Intergenic
1049420426 8:142513995-142514017 CAGGGGTCCCAGCAGGAGTGAGG + Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1050682140 9:8124133-8124155 CAGCACTCCCAGAGGAAGGAGGG - Intergenic
1052158563 9:25226411-25226433 CTGGAGTCCCAAAGGGTGGAGGG + Intergenic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1054766826 9:69049027-69049049 CAGAACTGCCAGAAGGAGTAAGG - Intronic
1055258593 9:74404676-74404698 TGGGAGTCCCAGAAGAAGAATGG - Intergenic
1055550926 9:77431655-77431677 CAGATGTCCCAGAAGGCGCATGG - Intronic
1056014026 9:82363316-82363338 CAGGGGTGCCAGAAGAGGGAGGG + Intergenic
1056548218 9:87630482-87630504 CAGGACTCCAAGAAGGACCAGGG - Intronic
1056728547 9:89143542-89143564 CAGGAGTTTCAGAAGGTGAAGGG + Intronic
1056906050 9:90648756-90648778 CAGCAGCCCCAGTAGGAGGAGGG - Intergenic
1057261569 9:93587517-93587539 GAGGAGTCCCAGATAGTGGATGG + Intronic
1057443816 9:95099854-95099876 CACCAGTCCCAGGAGAAGGAAGG + Exonic
1058374463 9:104306439-104306461 CTGGAGTACCAGAAGGAGATGGG + Intergenic
1058876616 9:109250214-109250236 ACGGAGGCCCAGAAGTAGGAAGG + Intronic
1059014354 9:110498343-110498365 AAGGAGTTCCAGAAGGAGAGAGG - Intronic
1059169681 9:112113385-112113407 CAGGAGTCCCAGAAGTACCTAGG - Intronic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1059437483 9:114285369-114285391 CAGGAGTGCCAGAAGGTCCAAGG + Intronic
1059461330 9:114432320-114432342 CAGGAGCCCCAGGAGGAGAGGGG + Intronic
1059491691 9:114673061-114673083 CTGGACTCTCAGAAGGACGAAGG + Intergenic
1060819334 9:126652277-126652299 CAGGAGTCTGAGGAGGAGAAGGG + Intronic
1061112422 9:128584147-128584169 TAGGAGCCCCAGATGAAGGAAGG + Intronic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1062567879 9:137171319-137171341 GGGGAGTCCCTGGAGGAGGAGGG - Intronic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1188567712 X:31545389-31545411 AAGGAATCCCAGAAGGCAGAAGG - Intronic
1189308364 X:40004148-40004170 AAGCAGTCCCTGAGGGAGGAAGG + Intergenic
1192481128 X:71487119-71487141 TGGGAGTCCCTGAAGGAAGAGGG - Intronic
1192543032 X:71991099-71991121 CACGAAGCCCAGAAAGAGGAAGG - Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197140184 X:123109349-123109371 CAAGAGTCCCAGTAAGAGCAAGG + Intergenic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197851722 X:130869166-130869188 CAGTAGTCCAAGCAGGATGATGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199271155 X:145883785-145883807 CAGGAGTTCTAGAAGTAGGAAGG + Intergenic
1199316349 X:146382737-146382759 TAGAAGTCCCAGAGGGAGGGAGG + Intergenic
1199635756 X:149809988-149810010 CAGGAGGCTGAGAAGGAGAATGG + Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199982217 X:152927460-152927482 CAGGGGTCCCAGGAGGGGTAGGG - Intronic
1201242769 Y:11974757-11974779 TGGGATTCCCAGAAGGAGAATGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic