ID: 910949946

View in Genome Browser
Species Human (GRCh38)
Location 1:92635265-92635287
Sequence GTAGACTCCACCTCGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 2, 1: 19, 2: 54, 3: 68, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910949946_910949957 10 Left 910949946 1:92635265-92635287 CCTGCCCCCGAGGTGGAGTCTAC 0: 2
1: 19
2: 54
3: 68
4: 118
Right 910949957 1:92635298-92635320 AGGCCTCCTTGAGCTGCAGTGGG 0: 322
1: 631
2: 3692
3: 1326
4: 787
910949946_910949956 9 Left 910949946 1:92635265-92635287 CCTGCCCCCGAGGTGGAGTCTAC 0: 2
1: 19
2: 54
3: 68
4: 118
Right 910949956 1:92635297-92635319 CAGGCCTCCTTGAGCTGCAGTGG 0: 315
1: 606
2: 3678
3: 1241
4: 795
910949946_910949955 -10 Left 910949946 1:92635265-92635287 CCTGCCCCCGAGGTGGAGTCTAC 0: 2
1: 19
2: 54
3: 68
4: 118
Right 910949955 1:92635278-92635300 TGGAGTCTACAGGGGCAGGCAGG No data
910949946_910949960 24 Left 910949946 1:92635265-92635287 CCTGCCCCCGAGGTGGAGTCTAC 0: 2
1: 19
2: 54
3: 68
4: 118
Right 910949960 1:92635312-92635334 TGCAGTGGGCTCCACCCAGTTGG 0: 23
1: 44
2: 522
3: 192
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910949946 Original CRISPR GTAGACTCCACCTCGGGGGC AGG (reversed) Intronic
900432752 1:2610771-2610793 GGCCACTCCACCTCTGGGGCTGG + Intronic
900781927 1:4624094-4624116 GTGGATTCCACCTCCGGGCCTGG - Intergenic
906589104 1:47006983-47007005 GTAGACTCCACCACTGGGGCAGG + Intergenic
906835011 1:49073944-49073966 CTAGATTCCACCTCGTGGGCTGG - Intronic
907994046 1:59611067-59611089 GTAGACTCCACCTCTGAGGGCGG + Intronic
909446583 1:75755164-75755186 GTAGACTCCCCTCTGGGGGCAGG + Intronic
909812151 1:79943859-79943881 GTAGGCTCCACCTCTGAGGCAGG - Intergenic
910398726 1:86817423-86817445 GTAGACTCCACTCTGGGGGCAGG - Intergenic
910949946 1:92635265-92635287 GTAGACTCCACCTCGGGGGCAGG - Intronic
911128967 1:94369886-94369908 GTAGACTCCACCTCTGGGGTAGG - Intergenic
911209767 1:95126907-95126929 ATAGACTCCACCTCGGGATTGGG + Intronic
911689839 1:100820499-100820521 CTAGATTCCACCTCTGGGGCAGG + Intergenic
912009413 1:104940619-104940641 GTAGGCTCCACCTCTGGGGGCGG - Intergenic
912900098 1:113638824-113638846 GTAGGCTCCACCTCTGGGGGCGG - Intronic
915763262 1:158336625-158336647 AGAGACTCCACCTCTGGGGGCGG + Intergenic
916351416 1:163853984-163854006 GCAGGTTCCACCTCTGGGGCAGG - Intergenic
916701655 1:167302077-167302099 CAAGACTCCGTCTCGGGGGCGGG - Intronic
917266663 1:173227991-173228013 GTAGACTCCACCTCTGGGGGCGG + Intergenic
918075909 1:181171364-181171386 GTTGAGTCCACCTCTGGGTCGGG + Intergenic
919065465 1:192688312-192688334 GTAGACACCACCTCTGGGGCAGG - Intergenic
919155855 1:193764945-193764967 TGAGACTCCACCTCGGGGGGGGG + Intergenic
921455425 1:215365536-215365558 GTAGACTCCACCTCTCGGGCAGG - Intergenic
923679886 1:236110847-236110869 GTAGACTCCATCTCCTGTGCTGG + Intergenic
1064131846 10:12716632-12716654 GTAGCCTTCATCTCGGGGGATGG - Intronic
1066992725 10:42531661-42531683 GTAGGCTTCACCTCTGGGGCAGG - Intergenic
1067477897 10:46578621-46578643 GGAGACTCCACCCCGGGATCCGG + Intronic
1067616840 10:47763166-47763188 GGAGACTCCACCCCGGGATCCGG - Intergenic
1067996745 10:51281608-51281630 GTAGACTCCACCTCTGGGGGCGG + Intronic
1069259959 10:66382476-66382498 CTAGACTCCATCTCTTGGGCAGG + Intronic
1069604080 10:69729051-69729073 TTGGCCTCCACCTCGGGCGCAGG + Intergenic
1070833501 10:79434175-79434197 ACAGACACCACATCGGGGGCAGG + Intronic
1071825012 10:89316621-89316643 ATAGACTCCACCTCTGGGGCAGG + Intronic
1071884696 10:89937109-89937131 GTAGACTCCACCTCTGGGGGAGG - Intergenic
1072383362 10:94898502-94898524 GTAGGCTCCACCTCTGGGGCAGG - Intergenic
1072405452 10:95147914-95147936 GTAGGCTCCACCTCTGGGGGCGG + Intergenic
1074303215 10:112251439-112251461 GTAGGCTCCACCTCTAGGGGCGG + Intergenic
1074809064 10:117084503-117084525 GTAGGCTCCACCTCTGGGGGCGG - Intronic
1077111162 11:862838-862860 GTGGGCACCACCTCTGGGGCCGG + Intronic
1077591823 11:3498489-3498511 GTAGACTCCACCTCTGGGGGCGG - Intergenic
1078121684 11:8516887-8516909 GTAGACTCCACATCTGGGGCAGG + Intronic
1078560440 11:12366493-12366515 GTAGATTCCACCTCTGGGGCAGG + Intergenic
1078793615 11:14569763-14569785 GTAGACTCCATCTCTGGAGGCGG + Intronic
1079087799 11:17459754-17459776 GTAGCATCCACTTCGGGGGCTGG - Intronic
1079251982 11:18793174-18793196 CAAGACTCCGTCTCGGGGGCGGG - Intergenic
1079682976 11:23321508-23321530 GTAGACTCCACCTCTGGGGCAGG + Intergenic
1079922672 11:26451635-26451657 GTAGGCTCTACCTCTGGGGCAGG + Intronic
1080767442 11:35309825-35309847 GTAGAATCCACCTCAGGGAGAGG - Intronic
1080810950 11:35703307-35703329 GTAGGCTCCACCTGTGGGGGCGG + Intronic
1081308753 11:41545246-41545268 ATAGACTCCACCTCTGTGGTAGG + Intergenic
1082602300 11:55173130-55173152 GTAGGCTCCACCTCTGGGGCAGG - Intergenic
1082744290 11:56945608-56945630 GTAGGCTCCACCTCTGGGGCAGG - Intergenic
1084181330 11:67448050-67448072 GCAGACTCCACCTGTGGGACAGG - Intergenic
1092325741 12:7529069-7529091 GTAGACTCCACCTCTTGAGCAGG + Intergenic
1093677666 12:21962746-21962768 CTAGATTCCATCTCTGGGGCAGG + Intergenic
1094579233 12:31718766-31718788 CTAGATTCCACCTCTGGGGCAGG - Intronic
1096931109 12:55210965-55210987 CTAGGCTCCACCTCTGAGGCAGG + Intergenic
1097164760 12:57078067-57078089 CTAGACTCCATCTCGCGGGCCGG + Intronic
1098844865 12:75523020-75523042 GTAGACTCCACCTCTGGGGACGG - Intergenic
1099512429 12:83554696-83554718 GTAGGCTCCACCTCTGGGGGTGG - Intergenic
1101175215 12:102143077-102143099 GTACACTCCACCTCTGAGGGCGG - Intronic
1102078644 12:110080257-110080279 CGAGACTCCATCTCGGGGGTGGG - Intergenic
1102594664 12:113983245-113983267 GTAGAACCCACCTTGGAGGCTGG - Intergenic
1103309464 12:119992963-119992985 CGAGACTCCATCTGGGGGGCAGG - Intronic
1104375825 12:128265533-128265555 GTAGACCTGACCTTGGGGGCAGG - Intergenic
1108579432 13:51816101-51816123 GTAGCTTCCACATAGGGGGCGGG - Intergenic
1108892459 13:55278169-55278191 GTAGACTCCACCTCAGAGGCAGG - Intergenic
1110507233 13:76301148-76301170 GTAGACTCCACCTCTTGAGAGGG + Intergenic
1111723311 13:91974070-91974092 GTAGATTCCACCTCTGGGGGAGG - Intronic
1112663794 13:101544640-101544662 GTAGACTCCACCTCTGGGGGCGG - Intronic
1112835378 13:103508088-103508110 GTAGACTCCATCTCTGGGGCAGG - Intergenic
1113796168 13:113059995-113060017 TCAGACTCCGCCTCCGGGGCTGG - Intronic
1114029797 14:18567819-18567841 GTAGATTCCACCTCTGGGGTAGG + Intergenic
1114581257 14:23762295-23762317 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1115278953 14:31639674-31639696 GTAGGCTCCATCTCTGGGGTAGG - Intronic
1115524870 14:34269930-34269952 GCAGACTCCACGTCTGAGGCAGG - Intronic
1115891163 14:38030487-38030509 GTATACTCCACCTATGGGGAAGG - Intronic
1116094316 14:40348598-40348620 GTAGGCTCCACCTCTGGGGGCGG + Intergenic
1116581833 14:46651983-46652005 GTAGACTCCCCCTGGCGGCCAGG + Intergenic
1120069711 14:80089067-80089089 GTAGGCTCCACCTCTGGGGCAGG + Intergenic
1120670785 14:87360308-87360330 GTAGGCTCCACCTCTGGGGGAGG - Intergenic
1121174201 14:91878458-91878480 TGAGACTCCACCTAGGGGCCAGG + Intronic
1122443327 14:101749824-101749846 GTAGACCCCACCTCTGGGGGGGG - Intergenic
1122750570 14:103929529-103929551 TGAGACTCCATCTCGGGGGGTGG - Intronic
1125431028 15:39593597-39593619 GTAAACTCCACCACAGGGCCTGG + Exonic
1126974769 15:54163281-54163303 GTAGCCTCAACCTCTGGAGCAGG + Intronic
1128017089 15:64356921-64356943 TGAGACTGCGCCTCGGGGGCGGG + Intronic
1129746444 15:78024966-78024988 GGAGATTCAACCTCAGGGGCAGG + Intronic
1130450138 15:84042944-84042966 GTAGACTCCACCTCTGGGGGTGG + Intergenic
1130687445 15:86051274-86051296 GTAGACTCCATGTCTGGTGCAGG + Intergenic
1130798386 15:87235336-87235358 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1132498067 16:273189-273211 GCAGACTCTGCCTCGGGAGCAGG - Intronic
1134598271 16:15513006-15513028 GTGGGCTCCATCTTGGGGGCGGG + Intronic
1136930764 16:34416277-34416299 GTAGACTCCACGTCTGGGGCAGG - Intergenic
1136973809 16:34995531-34995553 GTAGACTCCACGTCTGGGGCAGG + Intergenic
1137370140 16:47897363-47897385 CTAGACTCCACCTCTGTGGGCGG + Intergenic
1139825792 16:69756137-69756159 TAAGACTCCATCTCGGGGGCAGG + Intergenic
1141185185 16:81781881-81781903 CAAGACTCCGTCTCGGGGGCGGG - Intronic
1142631555 17:1229338-1229360 GGAGACTCGGCCTCGGGGTCGGG + Intergenic
1142631574 17:1229380-1229402 GGAGACTCGGCCTCGGGGTCGGG + Intergenic
1142840665 17:2626563-2626585 CAAGACTCCGCCTCGGGGGGGGG - Intronic
1143422722 17:6808053-6808075 GTAGACTCCACCTCTGGGGGAGG - Intronic
1145738361 17:27249733-27249755 GTAGACTTCACCTCTGGGGCAGG + Intergenic
1146732304 17:35204396-35204418 GTAGACTCCACCTCCAGGGCAGG - Intergenic
1147166281 17:38595227-38595249 CAAGACTCCATCTCGGGGTCGGG - Intronic
1147527559 17:41240444-41240466 GTAGACTCCACCTCTGGGGCAGG + Intronic
1149293035 17:55235584-55235606 CAAGACTCCATCTCGGGGGGTGG - Intergenic
1151580325 17:74973794-74973816 CAAGACTCCATCTCGGGGGGGGG + Intergenic
1152325005 17:79630946-79630968 GTGGCCTCCACCTCGTGGGGCGG - Intergenic
1153518337 18:5926188-5926210 CTAGACTCCACCTCAGGTGAAGG - Intergenic
1153712237 18:7811367-7811389 GAAGACTCCATCTCGGGGTGGGG - Intronic
1154132129 18:11746528-11746550 GTAGCCTCAACCTCCTGGGCTGG - Intronic
1156843096 18:41632279-41632301 GTAGGCTCCACCTCTGGGGGCGG + Intergenic
1159376886 18:67604170-67604192 GTACGCTCCACCTCTGGGGCAGG + Intergenic
1160520840 18:79507151-79507173 GAAGACTTCACCTCTGGGGTGGG - Intronic
1161290107 19:3489418-3489440 CAAGACTCCATCTCGGGGGGAGG + Intergenic
1162907686 19:13833350-13833372 TTAGACTCGACCTCGGTGGGCGG + Intergenic
1163689228 19:18729826-18729848 GTGGACACCACCTCTGGGGGAGG - Intronic
1164429929 19:28178122-28178144 GTAGGCTCCACCTCGGGGGCAGG + Intergenic
1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG + Exonic
1167125118 19:47544300-47544322 GTAGCCTCCACCCCGGGAGCAGG + Exonic
926917700 2:17909044-17909066 GTAGACTCCACCTCTGGGGCGGG - Intronic
927900884 2:26817446-26817468 CGAGACTCCATCTCGGGGGGGGG - Intergenic
932645374 2:73495172-73495194 GTTGATTCCAGCTCTGGGGCAGG - Intronic
932662648 2:73670089-73670111 GTAGACTCCACCTCTAGGGCAGG - Intergenic
933618622 2:84511159-84511181 GTAGACTCCACCTCTGGGGGAGG - Intergenic
938273900 2:129999010-129999032 GTAGGCTCCACCTCTGGGGGCGG + Intergenic
938732821 2:134159746-134159768 GCAACCTCCACCTCTGGGGCGGG - Intronic
938864451 2:135403508-135403530 GTAGACTCCACCTCCGGGGCAGG + Intronic
939981336 2:148785337-148785359 CAAGACTCCATCTCGGGGGTGGG - Intronic
940809197 2:158223376-158223398 GTAGACTCCACTCTAGGGGCAGG + Intronic
941564267 2:167087408-167087430 GTAGGCTCCACCTGTGGGGCAGG - Intronic
941643949 2:168019599-168019621 GTACACTCCACCTCCAGGGCAGG - Intronic
942639894 2:178049905-178049927 GTAGATTCCACCTCTGGTGCAGG + Intronic
942859394 2:180591195-180591217 GTAGACTTCACCTCTGGGGGCGG - Intergenic
943109399 2:183586733-183586755 GTAGGCTCCACCTCTGGGGTAGG + Intergenic
944520972 2:200566656-200566678 GTAGACTCCACCTCTGGCGGAGG - Intronic
945677761 2:212876237-212876259 GTAGACTCCACCTTTGGGGCAGG + Intergenic
946416776 2:219543816-219543838 CGAGACCCCACCCCGGGGGCGGG - Exonic
948235763 2:236389128-236389150 GTAGGCTCCACCTCTGGGGGCGG - Intronic
1171514739 20:25720323-25720345 GTAGACCCCACCTCTGGGGGTGG - Intergenic
1171569448 20:26234217-26234239 GTAGGCTCCACCTCTGGGGGAGG + Intergenic
1171733211 20:28737189-28737211 GTAGGCTCCACCTTTGGGGCAGG + Intergenic
1173770465 20:45651990-45652012 GTAGACTCCACCTCTGGGGGAGG + Intronic
1175278772 20:57788744-57788766 GCAGACCCCACCTCCAGGGCAGG - Intergenic
1178238401 21:30870721-30870743 GTGGAATCCATCTCGCGGGCCGG + Intergenic
1178446464 21:32648034-32648056 TGAGACTCCAGCTTGGGGGCAGG - Intronic
1180404790 22:12541678-12541700 GTAGGCTCCACCTCTGGGGGCGG + Intergenic
1180453913 22:15494869-15494891 GTAGATTCCACCTCTGGGGTAGG + Intergenic
1181326931 22:22057186-22057208 GTAGATTCCACCTCTGGGGGAGG - Intergenic
949816865 3:8068211-8068233 GTAGACGCCACCTCTGGGGCAGG - Intergenic
950781543 3:15397070-15397092 GTAGACTCCACTTCTGGGGGCGG - Intronic
951833758 3:26959293-26959315 ATAGACTCCACCTCTAGGGCAGG - Intergenic
952864039 3:37839354-37839376 CTAGATTCCACCTCTGGGGAAGG + Intergenic
953112256 3:39954064-39954086 ATAGACTCCACCTCTGGGGCAGG + Intronic
955427485 3:58807118-58807140 GTAGGCTCCACCTCTGGGGGCGG + Intronic
960860014 3:122142680-122142702 GTAGGCTCCACCTCTGGGGCAGG - Intergenic
960913051 3:122668590-122668612 GTAGACCCCACCTCCGGGCAGGG - Intergenic
961665317 3:128490505-128490527 GAAGCCTCCACCTCGGTTGCAGG + Intronic
962177920 3:133174232-133174254 GTAGACTCCACGTCTGGGGACGG + Intronic
962554062 3:136528169-136528191 GTAGACTCCACCCTGGGGCAGGG - Intronic
967287894 3:187890739-187890761 GTAGGCTCCACCTCTGGGGGCGG + Intergenic
967565291 3:190964979-190965001 GTAGGCTCCACCTCTGGGGGCGG - Intergenic
968500208 4:946382-946404 CCAGCCTCCACCTCGGGTGCAGG + Intronic
970611533 4:17729302-17729324 GTAGGCTCCACCTCTGGGGGCGG + Intronic
973871319 4:55169704-55169726 ATAGATTCCACCTCTGGGGCAGG - Intergenic
974470233 4:62309800-62309822 GTAGACTCCACCTCTGGGGCAGG + Intergenic
975410066 4:74038811-74038833 TCCGACTCCACCCCGGGGGCGGG - Intergenic
977492923 4:97736759-97736781 GTAGGCTCCACTTCTGGGGCAGG + Intronic
978205283 4:106073708-106073730 GTAGACTCCAGCTCTGGGGCAGG - Intronic
979757651 4:124361764-124361786 GTAGACTCCACCTCTGGGGCAGG + Intergenic
981087458 4:140698724-140698746 TGAGACTCCATCTCGGGGGTGGG + Intronic
981299127 4:143167001-143167023 GTAGACTCCACCTCTGGGGGTGG + Intergenic
981796272 4:148598891-148598913 ATAGACTCCACCTCTGGGGCAGG - Intergenic
982317239 4:154044174-154044196 CTAGACTCCACCCCGTGGCCAGG + Intergenic
989186428 5:38631188-38631210 GTAGGCTCCACCTCTGGGGGCGG - Intergenic
990911944 5:60860929-60860951 GTAGGCTCCACCTATGGGGCAGG + Intergenic
992690688 5:79237296-79237318 GGAGACTCCAGCTCGGTGGCGGG - Exonic
993046455 5:82872327-82872349 GTAGGCTCCACCTCTGGGGCAGG - Intergenic
997245944 5:132349364-132349386 GTAGTCTCCACCTCTGGGGCAGG - Intergenic
997608090 5:135191231-135191253 CTCGACTCCACCCCCGGGGCTGG - Intronic
999693983 5:154172076-154172098 GTAGTCTCCACCTCTGTGCCAGG - Intronic
1001009205 5:168083038-168083060 GTAGACTCCACCTCGGGGGCAGG - Intronic
1003813484 6:9811289-9811311 GTAGGCTCCACCTCTGGGGCAGG + Intronic
1003987581 6:11452330-11452352 GTAGTCTCCACCTCTGGGGGCGG + Intergenic
1005583190 6:27251967-27251989 GCGGACTTCTCCTCGGGGGCGGG + Exonic
1009998132 6:70919997-70920019 GTAGATTCTACCTCGGGGGCAGG - Intronic
1010025677 6:71213327-71213349 GCAGATTACACCTCTGGGGCAGG + Intergenic
1010361846 6:75004241-75004263 GTAGGCTCCACTCTGGGGGCAGG + Intergenic
1010484310 6:76391064-76391086 GTAGACTTCACCTCTGGGGCAGG + Intergenic
1010688356 6:78878048-78878070 GTAGACTCCACCTCTGGGGCAGG + Intronic
1011244471 6:85307578-85307600 GTAGGCTCCACCTCTGGGGCAGG + Intergenic
1011303066 6:85896556-85896578 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1011408232 6:87038775-87038797 GAAGACTCCACCTCTGGGGCAGG - Intergenic
1012085827 6:94824701-94824723 GTAGGCTCCACTCTGGGGGCAGG + Intergenic
1012905778 6:105063622-105063644 CAAGACTCCATCTCGGGGGGGGG + Intronic
1013093237 6:106920445-106920467 GTAGCCTCAACCTCCTGGGCTGG + Intergenic
1013185819 6:107757099-107757121 GGAGTCTCCACCAGGGGGGCTGG + Intronic
1016930000 6:149396027-149396049 TGAGACTCCAACTCGGGGGCGGG - Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1020344141 7:7145212-7145234 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1020705519 7:11539076-11539098 GTAGACTCTACCTCTAGGCCTGG - Intronic
1022176958 7:27880617-27880639 CAAGACTCCATCTCGGGGGATGG + Intronic
1024106130 7:46088532-46088554 ATAGATTCCACCTCTGGGGGAGG - Intergenic
1025260354 7:57414082-57414104 CTGGAGTCCACCTAGGGGGCAGG + Intergenic
1026057551 7:66997638-66997660 CAAGGCTCCATCTCGGGGGCGGG - Intronic
1028646955 7:93108855-93108877 GTAGACTCCACCTGTGGGGCAGG + Intronic
1029037047 7:97533100-97533122 GTAGGCTCCACCTCTGGGGGCGG + Intergenic
1029172102 7:98638153-98638175 GAAGACTACAGCTGGGGGGCGGG + Intergenic
1033163824 7:139020907-139020929 CAGGACTCCACCTCGGAGGCAGG + Intergenic
1034341162 7:150356450-150356472 GTAGCCTCCAACTCATGGGCTGG - Intergenic
1035159276 7:156939294-156939316 GTAGACTCTGCCTCAGGGTCTGG + Intergenic
1035792783 8:2323175-2323197 GTAGGCTCCACCTTGGGGGCCGG - Intergenic
1035800021 8:2398530-2398552 GTAGGCTCCACCTTGGGGGCCGG + Intergenic
1037545407 8:19915587-19915609 GTAGATTCCACATCTAGGGCAGG - Intronic
1038811425 8:30849885-30849907 CAAGACTCCATCTCGGGGGCTGG + Intronic
1038919758 8:32069641-32069663 GAAGACTGCACCTCGGGGTAAGG + Intronic
1040650968 8:49448446-49448468 GTAGGCTCCACCTCGGGGGCAGG + Intergenic
1041202216 8:55461030-55461052 GTAGGCTCCACCTCTGGGACAGG + Intronic
1041294239 8:56338346-56338368 GTAGACTCTACCTCTGGGGGTGG - Intergenic
1041302716 8:56429639-56429661 GTAGACTCCACCTCTGGGGGTGG + Intergenic
1042763077 8:72291586-72291608 GTAGACTCCACCTTTGGGCCAGG + Intergenic
1043605111 8:81990695-81990717 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1044060096 8:87625345-87625367 GTAGGCTCCACCTCTGGGGCAGG + Intergenic
1044548313 8:93483781-93483803 GTAGACTCCACTTCTGGAGGCGG + Intergenic
1044588356 8:93889110-93889132 CCAGACTCCATCTTGGGGGCAGG + Intronic
1045222360 8:100211575-100211597 GCAGCCTCAACCTCTGGGGCAGG - Intronic
1045419562 8:102000434-102000456 GTAGACTCCACTTCTGGGGGTGG + Intronic
1046704464 8:117434858-117434880 GTAGACTCCACCTCTGGGGCAGG + Intergenic
1047129387 8:122001772-122001794 CTAGACTCCACCTCTGTGTCAGG + Intergenic
1048594558 8:135852985-135853007 GCAGGCTCCACCTCTGGGGGCGG - Intergenic
1050500845 9:6295896-6295918 GTAGGATCCACCTCTGGAGCAGG + Intergenic
1053225008 9:36347107-36347129 GGAGACTCCATCTCGGGGGGGGG + Intronic
1055013975 9:71596058-71596080 GTAGACTCCACCTCTGTGGGCGG + Intergenic
1056657872 9:88523866-88523888 GTACCCTCCACCCCAGGGGCTGG + Intergenic
1056797625 9:89669654-89669676 GTAGCATCCACCTCTGGTGCTGG - Intergenic
1058694710 9:107549416-107549438 GTACATGCCATCTCGGGGGCTGG + Intergenic
1059617005 9:115962412-115962434 GTAGGCTCCACCTCTGGGGGCGG - Intergenic
1061014705 9:127975042-127975064 GTTGAATCCACCTCCGGGGGAGG - Intronic
1061665393 9:132157929-132157951 GCAGACTCCACCTCCTTGGCAGG - Intergenic
1188238698 X:27759115-27759137 GTAGACCCCACTTCGGGGGCAGG + Intergenic
1190055729 X:47180079-47180101 CTCGTCTCCACCCCGGGGGCCGG - Intronic
1191048228 X:56162355-56162377 GTAGACTACAGCACCGGGGCAGG - Intergenic
1191170675 X:57444195-57444217 GTAGACTCCACCTCTGGGGCAGG - Intronic
1191647011 X:63492631-63492653 GTAGACTCCACCTATGGGGCAGG + Intergenic
1191747212 X:64502675-64502697 GTAGGCTCCACCTCTGGGGGCGG - Intergenic
1191814155 X:65224924-65224946 GTAGGCTCCAACTCTGGGGGAGG + Intergenic
1191827293 X:65379133-65379155 GTAGGCTCCACCTCTGGGGGAGG + Intronic
1192458854 X:71300426-71300448 TAAGACTCCGTCTCGGGGGCGGG - Exonic
1192796649 X:74429101-74429123 GTAGCCTCAACCTCCTGGGCTGG - Intronic
1193035906 X:76950919-76950941 GCAGACTCCACCTCAGGGGCAGG + Intergenic
1194370075 X:93060724-93060746 GTAGGCTCCACCTCTGGGGCAGG + Intergenic
1195340555 X:103902706-103902728 GTAGACTCCACCTCTGGGGGGGG - Intergenic
1196139570 X:112246312-112246334 GTAGACTCCACCTCTGGGGCAGG - Intergenic
1198572386 X:137971514-137971536 CTAGATTCCACCTCTGGGGCAGG + Intergenic
1200678261 Y:6176929-6176951 GTAGGCTCCACCTCTGGGGCAGG + Intergenic
1200733436 Y:6768162-6768184 GTAGACTTCACAGCAGGGGCAGG - Intergenic
1200751954 Y:6954259-6954281 GTAGACTCCACCTCTGGGGCAGG - Intronic
1201263320 Y:12181379-12181401 GTAGACTCCACCTCTGGGGGTGG + Intergenic
1201359957 Y:13135963-13135985 GTAGGCTCCACCTCTGGGGGCGG - Intergenic
1201909006 Y:19114511-19114533 GTAGGCTCCACCTCTGGGACAGG - Intergenic
1202085175 Y:21129108-21129130 GTAGACTCCACCTCTGGGGCAGG - Intergenic