ID: 910954011

View in Genome Browser
Species Human (GRCh38)
Location 1:92681896-92681918
Sequence GAAACATGGTAGGGTGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910954011 Original CRISPR GAAACATGGTAGGGTGCTAG GGG (reversed) Intronic
900850660 1:5140175-5140197 GAAACATAGAGGGGTGCTAATGG - Intergenic
904026469 1:27506884-27506906 GAGTCATGGTAGGCGGCTAGCGG + Intergenic
910034935 1:82778026-82778048 GAAAAATGATATGGTGTTAGTGG - Intergenic
910954011 1:92681896-92681918 GAAACATGGTAGGGTGCTAGGGG - Intronic
911579591 1:99619557-99619579 GAACCATGCTATGGTGCTAATGG - Intergenic
913485165 1:119327320-119327342 GACACCTGGCAGGGAGCTAGCGG - Intergenic
915627395 1:157123595-157123617 GAAACATGGGAGGTAGCTGGGGG - Exonic
916968780 1:169985295-169985317 GGAACCAGGTAGGATGCTAGAGG + Intronic
921028111 1:211308625-211308647 GAAACATGGTAAGCTGCTTATGG - Intronic
921585672 1:216943496-216943518 GAAACATGGTAGCATGACAGTGG + Intronic
1064565529 10:16635474-16635496 GCAGCATGGTAGGCTGCTAAGGG - Intronic
1067235579 10:44445703-44445725 CACAGATGGTGGGGTGCTAGGGG + Intergenic
1067529392 10:47059504-47059526 GACACATGGTAGGGTTGTTGAGG + Intergenic
1067539144 10:47139005-47139027 GAAACATGGTAGGCTGTTTTTGG - Intergenic
1068045173 10:51877121-51877143 GCAACATGGGAGGGTGCATGGGG - Intronic
1071200393 10:83215480-83215502 GCAACATGGGAGGGTGAGAGGGG + Intergenic
1072295843 10:94008924-94008946 GAACCATGGATGGGTGCTAGAGG + Intronic
1072533128 10:96338366-96338388 GAAACATGGGAAGGTGCCACTGG + Exonic
1072995268 10:100237981-100238003 GAAACTTGGAAGGGCGCTATGGG - Intronic
1078053715 11:7989408-7989430 GAATCATGGTACAGTGCTATAGG + Intronic
1079399924 11:20098612-20098634 GGAAAATGGTGGGGTGCTTGTGG - Intronic
1080210895 11:29783639-29783661 GACACATGGTTAGGTGCTTGTGG + Intergenic
1082191481 11:49250747-49250769 GAAAACTGTTATGGTGCTAGTGG + Intergenic
1083839520 11:65296099-65296121 GCCACAGGGCAGGGTGCTAGAGG - Intronic
1085466234 11:76725320-76725342 GAAACATGGAAGGGAGCAAGAGG - Intergenic
1085858485 11:80204099-80204121 GAAACATGGTAGGGATCAAAAGG - Intergenic
1086614915 11:88804818-88804840 GAAACATAGGAGGGTGGCAGAGG + Intronic
1088658543 11:112025180-112025202 GGAAAGTGGTAGGGTTCTAGGGG - Exonic
1092970004 12:13684521-13684543 GAGACCTGGTAAGGTGCTACAGG + Intronic
1099882714 12:88486963-88486985 CAATCATGGTAGTGTGATAGTGG - Intergenic
1102631634 12:114285962-114285984 GAAACATGGAAAGGTCCCAGGGG + Intergenic
1105286409 13:19008195-19008217 CAAACATGGTATGATGCAAGGGG + Intergenic
1106259500 13:28053101-28053123 GAAACATGGTAGGGTGGAGTTGG + Intronic
1107228693 13:38082612-38082634 GAAAGATAGTAGGGGCCTAGTGG + Intergenic
1108019357 13:46110873-46110895 GAGACATACTAGGGTGCTACGGG - Intergenic
1108143692 13:47453706-47453728 GAAACATGGAAGTGTGCAAAAGG + Intergenic
1108459692 13:50652692-50652714 AAAACCTGGTAGGGTGGGAGTGG - Intronic
1108977706 13:56469426-56469448 GAAACATGAGAGGGTGCTACTGG + Intergenic
1112715343 13:102178541-102178563 GAAACTTGGAAGGGTGGGAGGGG - Intronic
1115196364 14:30804650-30804672 GTAACATGTTAGAGTGCTCGTGG - Intergenic
1115286413 14:31717905-31717927 GAAACATAGTAAGATACTAGTGG + Intronic
1116309289 14:43301440-43301462 GAAAGGTGGTAGGGTGGGAGAGG + Intergenic
1119164821 14:72483552-72483574 AAAACCTGCTAGGGTGATAGAGG + Intronic
1121430222 14:93881260-93881282 GAAACATGGCTGGGAGCTAGAGG + Intergenic
1124210624 15:27762180-27762202 GAAAGATGGGAGGGTGGGAGAGG - Intronic
1128000080 15:64183035-64183057 GAAACATAGTAAGTTTCTAGTGG + Intronic
1129696843 15:77745463-77745485 GACACATGGAATGGTGCTAAGGG - Intronic
1130541940 15:84826756-84826778 GAAACATGGTTGGCTGCTCCAGG - Intronic
1131472551 15:92709535-92709557 GACACATGGTAGGATGCTTGGGG - Intronic
1134533276 16:15002299-15002321 AAAACATGGTAGGGAGATAGAGG - Intronic
1137003843 16:35254432-35254454 GAAAGATGGGAGGTTGGTAGAGG + Intergenic
1137013029 16:35343336-35343358 GAAAGATGGGAGGTTGGTAGAGG + Intergenic
1137019731 16:35413500-35413522 GAAAGATGGGAGGTTGGTAGAGG + Intergenic
1139862757 16:70038440-70038462 AAAACACGGTAGGGAGATAGAGG + Intergenic
1146687128 17:34848764-34848786 GAAACATGGTAGGGTGGGTGTGG + Intergenic
1147989143 17:44322765-44322787 GGAGCATGGGAGGGTGCAAGGGG - Intronic
1149341422 17:55690416-55690438 GAAAAATGGTAGGATGCACGTGG + Intergenic
1149980381 17:61306079-61306101 GAAACATACTAGGGTGTTTGAGG - Intronic
1151963364 17:77419047-77419069 GAGACAGGGCAGGCTGCTAGAGG - Intronic
1157259994 18:46169322-46169344 GAACCAGGGTGGGGAGCTAGAGG + Intergenic
1159632262 18:70762822-70762844 GAAACATGGCAGGGAGCTGCAGG - Intergenic
1159634718 18:70790439-70790461 CAAACTTGGTAAGGTGCTGGTGG + Intergenic
1159652027 18:70988769-70988791 GAAGCATGGTGGGGGGCTGGGGG - Intergenic
925610439 2:5696996-5697018 GAAAAATGGTGGGGAGCGAGGGG - Exonic
926445697 2:12939501-12939523 TAAACATGGTAGGCTGCTTCTGG + Intergenic
928451664 2:31383560-31383582 CATCCATGGTAGGGTGCCAGTGG - Intronic
928477827 2:31649072-31649094 GAAACATGGTTGGGTTCTAGAGG - Intergenic
929037612 2:37709535-37709557 GAGGCAAGGCAGGGTGCTAGGGG + Intronic
933840503 2:86282472-86282494 GCAACATGGAAGGGTGGTTGGGG + Intronic
938251306 2:129817611-129817633 GAAACAAGTTAAGGTGCCAGAGG + Intergenic
939072568 2:137560788-137560810 GACACATGGTGGGCTGCTAGGGG - Intronic
941619467 2:167759757-167759779 GAAACATGCCACTGTGCTAGGGG + Intergenic
941680452 2:168392934-168392956 GAAAAATGGTAGCCTACTAGGGG - Intergenic
948911226 2:241003653-241003675 GGAACATGGTAGTGTGGTAGGGG + Intronic
1170223918 20:13970050-13970072 GAAACTGTGCAGGGTGCTAGAGG - Intronic
1172029732 20:31973507-31973529 GAAACAGGGCAGGGAGCTACTGG + Intronic
1172770941 20:37382237-37382259 AAGACACTGTAGGGTGCTAGGGG - Intronic
1174011331 20:47452055-47452077 GAACCATGGTGGGGTGGTGGCGG - Intergenic
1174288264 20:49487542-49487564 GACACATGGGAGGATGCTCGTGG - Intergenic
1183079975 22:35450079-35450101 GAGACAGGGAAGGGTGCTATAGG + Intergenic
1185177275 22:49335088-49335110 GAATCATGGTAGGGGGATCGGGG + Intergenic
951288108 3:20840256-20840278 GATACATGGTATGGTGTTTGGGG - Intergenic
952749766 3:36815779-36815801 GAAACTTAGCTGGGTGCTAGGGG - Intergenic
953296175 3:41719651-41719673 GAAATATGGTAGCTTGCTATTGG - Intronic
955564770 3:60232228-60232250 TACACATGGTAGGGTGATGGAGG + Intronic
955576942 3:60375923-60375945 GAAATATGGTAGTGTGCCTGAGG + Intronic
958176578 3:90003023-90003045 AGAACATAGTAGGGTGATAGTGG - Intergenic
962943396 3:140145957-140145979 GAAACAAGGTAGGCTTCTTGTGG - Intronic
964186773 3:153954990-153955012 AAAACAAGGTGGGGTGCTAGGGG + Intergenic
965422675 3:168481390-168481412 GAAACATGATAGGGGGCTTTGGG + Intergenic
970320725 4:14873042-14873064 GAAATATGGTAGTTTGCTGGTGG + Intergenic
972829522 4:42798888-42798910 GAAACATGGTAGAGAGCTCAGGG - Intergenic
975763987 4:77648015-77648037 GAAGCATAGTAGGGGGCTAGGGG + Intergenic
977393030 4:96437440-96437462 GAAACAGGGTAGGGGGTTGGAGG + Intergenic
979624480 4:122829330-122829352 GTAACCTGGAAGGGTGCTACTGG + Intronic
980378675 4:131979956-131979978 AAAACATGGGAGGGTGTAAGAGG + Intergenic
984929492 4:184834220-184834242 GAAAGATGGTAGGGTGCTGTGGG - Intergenic
988599347 5:32625284-32625306 GAAAGATGGTAGCATGCTTGTGG - Intergenic
989734985 5:44693363-44693385 GAAAAAGGGTAGGGTGCAATTGG + Intergenic
991655146 5:68896511-68896533 AGAAAATGGTAGGGTGCTAGGGG - Intergenic
992967812 5:82021234-82021256 GAAACAAGGAAGGTTGCAAGTGG + Intronic
995418350 5:111934968-111934990 GAAACATAGTAGGGTGGGTGGGG + Intronic
995525479 5:113047298-113047320 GAACCAAGGCAGGGTGCTAGAGG - Intronic
1001777227 5:174337799-174337821 GAACCATGGTAGGGGGCAGGGGG + Intergenic
1003743392 6:8969482-8969504 CCAACATGGTAGGGTTCTGGTGG + Intergenic
1007161017 6:39792075-39792097 GAAACATGGAAGGGTCAAAGAGG - Intergenic
1007239022 6:40411784-40411806 AAGACATGGCAGGGTGCTGGGGG - Intronic
1007812116 6:44493725-44493747 GAAGCAGGGAAGGGTGATAGGGG + Intergenic
1007913112 6:45535769-45535791 GAGATAGGGTAGGGGGCTAGTGG + Intronic
1022686478 7:32602071-32602093 GAATCATAATAGGGTGGTAGTGG + Intergenic
1024004878 7:45217788-45217810 GAAAAAAGGTTGGGGGCTAGTGG + Intergenic
1026828945 7:73600083-73600105 GAAAAGGGGTACGGTGCTAGGGG + Intronic
1030868370 7:114727316-114727338 GGAACATGGATGGGAGCTAGAGG - Intergenic
1033956544 7:146856419-146856441 GAAACGTGGAAGGGTGCTGGAGG + Intronic
1034573530 7:151977888-151977910 GAAAGAAGGTATGGTACTAGCGG - Intronic
1035114956 7:156516827-156516849 GAAACAAGGGAGGCAGCTAGAGG - Intergenic
1036059191 8:5295910-5295932 TGGACATGGTAGGGAGCTAGAGG + Intergenic
1036628881 8:10496529-10496551 GGAAAATGGGAGGGTCCTAGTGG + Intergenic
1038363890 8:26911158-26911180 GAAAAATGGCAGTGTGCTACTGG + Intergenic
1042786760 8:72556363-72556385 GACACATGGTAGGTTGAGAGAGG + Intronic
1043318580 8:78952113-78952135 GTCACAGGGTAGGGGGCTAGGGG + Intergenic
1045072634 8:98525260-98525282 GAAACTTGGAAGGGTGAGAGGGG + Intronic
1047176492 8:122545889-122545911 CACACATGGTAGGGTGGTGGGGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1054980132 9:71196605-71196627 GAAACAGTGGAGGGTGCTTGGGG - Intronic
1185561880 X:1066191-1066213 CAAACAGGGTGGGGAGCTAGGGG + Intergenic
1186500799 X:10048877-10048899 GTAACATGGGATGGTGATAGTGG + Intronic
1187690290 X:21859689-21859711 GAAAAAGGGGAGGGTGCTACTGG + Intronic
1191786623 X:64923358-64923380 GAAGCATGGTAGGGAGCCAGTGG - Intronic
1192429494 X:71102691-71102713 TAACCATGGCAGGGTGCTAGTGG + Exonic
1193150988 X:78124517-78124539 GCAACTTGGGAGGGTGCTACTGG - Intronic
1194924810 X:99811380-99811402 GAAACATTGGAGGGTCCCAGAGG - Intergenic
1194934895 X:99937180-99937202 GAAACATGGTGGGGAGTTACTGG + Intergenic
1195065775 X:101236962-101236984 GAACCATGGTAGGAAGCTGGAGG - Intronic
1195987800 X:110649826-110649848 AAAACAGGGTAGGGTGGGAGAGG - Intergenic
1196136167 X:112211915-112211937 CAAACAGGGTTGGGTGATAGAGG + Intergenic
1198420276 X:136464972-136464994 GAAACAAGGTAGGGGTGTAGTGG - Intergenic
1199610601 X:149609703-149609725 GGAACATGGTTGGGTCCTACAGG - Intronic
1200120117 X:153786181-153786203 GCAGCAGGGTAGGGTGCGAGGGG + Intronic
1200846162 Y:7833906-7833928 GAGACATGGGAAGATGCTAGAGG - Intergenic