ID: 910954375

View in Genome Browser
Species Human (GRCh38)
Location 1:92685871-92685893
Sequence CAATTTCAGAACCTGTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 7, 2: 27, 3: 34, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910954375_910954378 17 Left 910954375 1:92685871-92685893 CCAATTAACAGGTTCTGAAATTG 0: 1
1: 7
2: 27
3: 34
4: 228
Right 910954378 1:92685911-92685933 CTACCAACCAAAAAAAGTCCAGG 0: 1419
1: 3426
2: 6166
3: 2471
4: 1758
910954375_910954381 26 Left 910954375 1:92685871-92685893 CCAATTAACAGGTTCTGAAATTG 0: 1
1: 7
2: 27
3: 34
4: 228
Right 910954381 1:92685920-92685942 AAAAAAAGTCCAGGACCTGATGG 0: 33
1: 3349
2: 7210
3: 3902
4: 3265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910954375 Original CRISPR CAATTTCAGAACCTGTTAAT TGG (reversed) Intronic
901905435 1:12405389-12405411 CAATTTTAGAAGCTGTGAGTTGG - Intronic
902683472 1:18060161-18060183 CAATTTCCTCATCTGTTAATTGG - Intergenic
905712987 1:40123126-40123148 CAATTTCACAACATGTTCACAGG + Intergenic
906358478 1:45130251-45130273 CTATTAAAGAACCTATTAATAGG + Intronic
906958796 1:50401198-50401220 CAATTTCAGAGCTTGTTAATTGG - Intergenic
907336224 1:53701524-53701546 CAATTTCTGCACCTGTAAAATGG - Intronic
908899620 1:68941406-68941428 AGATTTCAGAACCTGGAAATGGG + Intergenic
909305500 1:74070737-74070759 CAATTTCAAAATCTGTTGAAGGG + Intronic
910601521 1:89037721-89037743 GAAATTCAGAATCTGTTCATGGG - Intergenic
910954375 1:92685871-92685893 CAATTTCAGAACCTGTTAATTGG - Intronic
911243084 1:95486546-95486568 CAATTTCAGAACTTGTTATTGGG - Intergenic
911404493 1:97419883-97419905 CATTGTCAGAATCTGTTAGTAGG - Intronic
912742997 1:112219097-112219119 CAATGGCAGATGCTGTTAATAGG + Intergenic
913114785 1:115685904-115685926 CAGTTTCCTAACCTGTTAATTGG + Intronic
914699924 1:150122696-150122718 CAATTTTAGAACATTTTCATTGG + Intronic
916159917 1:161899350-161899372 GAATTACTGAAGCTGTTAATAGG - Intronic
916955174 1:169825052-169825074 CATTGACAGAACATGTTAATAGG - Intronic
917015500 1:170527262-170527284 GAATTTCATAAGCTGTTAAAGGG + Intergenic
919934824 1:202244720-202244742 AACTTCCAGAACCTGTAAATGGG - Intronic
920753612 1:208706156-208706178 TAATTTCAGAGCCTGTTATTGGG - Intergenic
920775847 1:208936410-208936432 CCATTTCCTCACCTGTTAATTGG - Intergenic
921275658 1:213516895-213516917 TCATTTCAGAGCCTGTTATTGGG + Intergenic
1063889626 10:10616354-10616376 CAAATTCAGAACCTATTGGTTGG + Intergenic
1070827314 10:79398852-79398874 CAGTTTCACCATCTGTTAATAGG - Intronic
1072962623 10:99942789-99942811 CATCATCAGAACCCGTTAATAGG - Intronic
1075015127 10:118905001-118905023 CAATTTCATCATCTGTAAATTGG - Intergenic
1075394754 10:122119239-122119261 CAGTTTCTGAACCTGTAAAATGG - Intronic
1075613376 10:123871493-123871515 AAATTTCTGAAGCTGATAATAGG - Intronic
1077713960 11:4562797-4562819 CAATTTCAGAACTTGTTAATTGG - Intergenic
1077772907 11:5240292-5240314 GAATTTCAGAAGCTGTTAGATGG + Intergenic
1079417351 11:20251840-20251862 CATTTTCAGAATATGTTCATAGG - Intergenic
1079806337 11:24934729-24934751 CTATTTCAGACCTTGCTAATAGG + Intronic
1080984622 11:37446374-37446396 AAATTTCAAAACATGTTAAGAGG + Intergenic
1081610479 11:44559803-44559825 CAATTTCAGGAACTGAAAATTGG + Intergenic
1081694071 11:45097482-45097504 CAATTTCCTCACCTGTTAAATGG - Intronic
1081911477 11:46702695-46702717 TTATTTCAGAACCTGTCATTAGG + Exonic
1083894294 11:65612462-65612484 CAATTTCAGAATCTGTAAAAAGG - Intronic
1085378898 11:76094526-76094548 CAATTTCAGAGCCTGTTAATTGG + Intronic
1086196896 11:84151219-84151241 CAGTTTCAGAACTTATTATTGGG + Intronic
1086298510 11:85398749-85398771 CAATTTTGGAACCTGTTATTGGG - Intronic
1087351854 11:97042798-97042820 CAATTTCAGAGCCTGTTATTGGG + Intergenic
1087352635 11:97053119-97053141 CAATTTCAGAGCCTGTTATTGGG - Intergenic
1087656659 11:100931663-100931685 CAACTTCATAATCTGTTAGTTGG + Intronic
1088392077 11:109325459-109325481 CAATTTCAGTACCATTTAATTGG + Intergenic
1088713468 11:112528419-112528441 CTATTTCAGATCCTTTTAATAGG - Intergenic
1088834095 11:113562571-113562593 CTACTTCAGAACCTCTTACTTGG - Intergenic
1090244563 11:125206658-125206680 CAATTTCCTAATCTGTTAAGAGG + Intronic
1091281678 11:134385090-134385112 CAATTTCAGCAACTGTAAAATGG + Intronic
1091832190 12:3557698-3557720 CAGTTTCCACACCTGTTAATGGG - Intronic
1092154831 12:6275386-6275408 CAATTTCCTCACCTGTTAAATGG - Intergenic
1092310404 12:7345595-7345617 CAACTTTAGAACTTGGTAATAGG - Intergenic
1092632191 12:10393809-10393831 AAATTTGAGCACCTGCTAATAGG - Exonic
1093366095 12:18301448-18301470 GAATTTCAGAACTTCATAATAGG - Intronic
1097476419 12:60062097-60062119 AAATTTCAGAACCTATTACCAGG - Intergenic
1097685335 12:62685531-62685553 CAATTTCCCAATCTGTAAATTGG + Intronic
1098132105 12:67361720-67361742 GAATTTGAGGACCTGTTAAATGG + Intergenic
1098520719 12:71432305-71432327 CAAGTTCACAGTCTGTTAATAGG - Intronic
1099098227 12:78402662-78402684 CAATTTCTCCACCTGTTAAGTGG + Intergenic
1099222167 12:79928042-79928064 CTATTTAAAAACCTTTTAATAGG - Intronic
1099377884 12:81915492-81915514 CAATTGGACAACCTGGTAATTGG - Intergenic
1099767109 12:87000680-87000702 CTATTTCACACCCTTTTAATAGG - Intergenic
1099989178 12:89706347-89706369 TTATTTTAGAATCTGTTAATAGG + Intronic
1100454548 12:94739857-94739879 CACATTCAGAAACTGCTAATGGG + Intergenic
1101069526 12:101059529-101059551 CAATTTCAGAACTTGTTATTGGG + Intronic
1101726089 12:107389499-107389521 CAGTTTCAGAACCTCTTGTTGGG - Intronic
1101806920 12:108072200-108072222 CAATTTCATCATCTGTTAAATGG + Intergenic
1103190614 12:118998764-118998786 CAATCCCAGAACCTGTTAATTGG + Intronic
1103518567 12:121523095-121523117 CAGTTTCAGCATCTGTGAATTGG - Intronic
1105624219 13:22097760-22097782 TGATTTCATAACCTGTTAATAGG + Intergenic
1107687101 13:42913249-42913271 TAGTTTCAGAATCTCTTAATGGG - Intronic
1109269663 13:60240824-60240846 AAATTTTTGCACCTGTTAATCGG + Intergenic
1110532710 13:76615495-76615517 CAATTTCAGAGCCTGTTAATTGG + Intergenic
1110766816 13:79289451-79289473 AAAATTCAGAAAATGTTAATTGG + Intergenic
1110961314 13:81629734-81629756 CATTTTCAGAACTTGTTTTTGGG + Intergenic
1111800887 13:92979115-92979137 AAAATTCAGAACCAGTTATTAGG + Intergenic
1111967329 13:94874248-94874270 GAATTTCAGAGCCTGTTATTGGG - Intergenic
1112686119 13:101829873-101829895 CATTTTCAGAACCTGAAAAATGG - Intronic
1114778311 14:25511796-25511818 CAGTTTCAGCACCTGTAAAATGG - Intergenic
1117621569 14:57592602-57592624 CATTTTCAGAAAGTTTTAATTGG - Intronic
1119315501 14:73691034-73691056 CAATTTCACAAACTATTAAGTGG - Intronic
1119699209 14:76741247-76741269 GAATTTCAGAACCTGAAGATAGG - Intergenic
1123958357 15:25365134-25365156 TAATTTCTGAACTTTTTAATTGG + Intronic
1124585262 15:30999693-30999715 TGATTTCAGAACCTGTGACTGGG - Intergenic
1127830875 15:62749951-62749973 CAATTTTGGAACATTTTAATAGG - Intronic
1127848119 15:62889165-62889187 CCATTTCAGAACCTATTAGGTGG - Intergenic
1127954729 15:63843509-63843531 AAATTTCAGAACCTGGAAAAGGG + Intergenic
1128484654 15:68072817-68072839 CAATTGCAGAAAATGTTAAAGGG - Intronic
1128974372 15:72139090-72139112 CATTTACAAAACGTGTTAATTGG - Intronic
1130058294 15:80549135-80549157 CAATTTAAGAAAATGTTGATGGG + Intronic
1132422650 15:101686555-101686577 CAATTAGGGAAGCTGTTAATAGG - Intronic
1132441321 15:101868267-101868289 CAAGCCCAGAAACTGTTAATTGG - Intergenic
1135999244 16:27278473-27278495 CAATTTTAAAAACTGTCAATAGG + Intronic
1137745997 16:50820598-50820620 CAATTTCAGAACCAGTGCATTGG - Intergenic
1137848009 16:51710773-51710795 GACTTTCAGAACCTGTAAAATGG + Intergenic
1139312056 16:66035725-66035747 CAATTTCTGCACCTGTAAAATGG + Intergenic
1139344617 16:66294519-66294541 CATTTACAGAACCTATTTATGGG + Intergenic
1140022726 16:71254039-71254061 CAATTTCTTCACCTGTAAATTGG + Intergenic
1144361559 17:14499687-14499709 GAATTTCAGAAGCTGTAAAATGG + Intergenic
1146118064 17:30160905-30160927 AAATTTCAGAAGCTGCTAAGGGG + Intronic
1146628535 17:34453440-34453462 CAATTTCCCAACCTGTTAAATGG + Intergenic
1147526667 17:41231390-41231412 CTATTTCCTAACCTGGTAATGGG + Intronic
1147530310 17:41270236-41270258 CTATTTCCTAACCTGGTAATGGG + Intergenic
1147530717 17:41274668-41274690 CTATTTCCTAACCTGGTAATGGG + Intergenic
1149016248 17:51911870-51911892 CAATTTCAGTGCATATTAATTGG + Intronic
1153458743 18:5310174-5310196 CCATTTCATCACCTGTAAATGGG - Intergenic
1153862988 18:9233156-9233178 CAATCTCAGAACTTGAAAATCGG - Intronic
1155133001 18:22957039-22957061 CATTTTCAGATGCTGTTAAAAGG + Intronic
1156429080 18:37051526-37051548 CAATTTCATAACTCGTTATTTGG - Intronic
1158659021 18:59368644-59368666 CAATTTCAGAACTTATTATTGGG + Intergenic
1158741556 18:60148323-60148345 ATATTTCAGAACCTCTTTATTGG + Intergenic
1158753109 18:60289057-60289079 GCATTTCAGAACCTTTTATTTGG + Intergenic
1161688564 19:5717274-5717296 CAATTTCAGAAACATTTATTGGG + Intronic
1164914606 19:32041751-32041773 GAAGTTCAGAACCTGGCAATTGG + Intergenic
1166816608 19:45550198-45550220 AAGTTTCAGAACCTGTTTCTTGG + Intronic
1168436518 19:56322156-56322178 GCATTTCAGAACCTGTTAACAGG - Intronic
927454509 2:23237990-23238012 CTCTTTCAGAACCTGTCACTCGG - Intergenic
928974160 2:37066287-37066309 CAATTTCCTTATCTGTTAATGGG + Intronic
929284190 2:40116982-40117004 CAATTTCCTAATCTGTTAAATGG + Intronic
930083873 2:47478541-47478563 TAAATTCAGAACTTGGTAATGGG + Intronic
930268686 2:49230375-49230397 CAATTTCAGAGCCTGGTTATTGG + Intergenic
935132792 2:100273892-100273914 GAAAATAAGAACCTGTTAATAGG - Exonic
936237956 2:110761329-110761351 CATTCTCAGAACCAGTCAATGGG - Intronic
937260088 2:120579782-120579804 CAATTTCAGAACCTGGGGCTGGG - Intergenic
937725478 2:125159813-125159835 CAATTTCAGAGCTTGTTATTGGG - Intergenic
939206357 2:139109035-139109057 CAATTCCAGAACTTGTTATTGGG - Intergenic
940656729 2:156496075-156496097 GCATTTCAGAACCAGTTAACAGG + Exonic
942699833 2:178693361-178693383 CAATCTCGTAACCTGTTACTTGG - Intronic
943278011 2:185893015-185893037 CTTTTTCAGCACCTGTTTATTGG - Intergenic
944504419 2:200395546-200395568 CAATTTCCTAATCTGTAAATTGG + Intronic
944996357 2:205298955-205298977 CAATTTCTGAATCTGTAAAATGG + Intronic
945141290 2:206689638-206689660 CAGTTTCTTTACCTGTTAATTGG - Intronic
945434262 2:209800226-209800248 CAATTTCAGAGCTTGCTATTGGG + Intronic
945779710 2:214154137-214154159 CTATTTCAGAAAATGTTAAATGG + Intronic
945936197 2:215905046-215905068 CAATTTCCTAATCTGTAAATTGG - Intergenic
947023750 2:225713594-225713616 CAATTTCAGAGCCTGTTTATTGG - Intergenic
1170320233 20:15088825-15088847 CAATTTTAGAACCTCTTAGGAGG + Intronic
1171513835 20:25711157-25711179 CAATTTTAGAGCCTGTTAATTGG + Intergenic
1172417835 20:34785999-34786021 CAATTTCAGAACTTGTTAATTGG + Intronic
1172864120 20:38082227-38082249 CAATTTTGGAACTCGTTAATAGG + Intronic
1173337056 20:42120882-42120904 CAATTTTAGAGCCTATCAATTGG + Intronic
1173398669 20:42704574-42704596 CACATTCAGATCCTGTTAACTGG + Intronic
1173516752 20:43669712-43669734 CAATTTCCGCATCTGTTAAGGGG + Intronic
1173543567 20:43873804-43873826 CAATTTCAGAGCCTGTTATTGGG + Intergenic
1173678348 20:44857799-44857821 CAGTTTCAGCAGCTGTAAATTGG - Intergenic
1174855260 20:54038557-54038579 CAGTTTCCCAACCTGTTCATTGG - Intronic
1175158946 20:56993851-56993873 CAATTTCCTAACCTGTCAATAGG - Intergenic
1176694014 21:9951806-9951828 AAATTTCAGAATCTGTTTTTGGG + Intergenic
1177123411 21:17166352-17166374 CAATTTCAGATCCTATTATTGGG - Intergenic
1178032991 21:28549315-28549337 TAATTTCAAAACCTGTAAAATGG + Intergenic
1178719378 21:34994900-34994922 CAACTTCTGAAGCAGTTAATTGG + Intronic
1182454776 22:30443314-30443336 CCATTTCAGCACCTGTCACTTGG + Intergenic
949592916 3:5512300-5512322 CAATTTCAGAACTTGTCTATTGG - Intergenic
949716381 3:6936259-6936281 CTATTACAGAACCTCTTGATGGG - Intronic
950305888 3:11915175-11915197 CGACTTCAGAACCTGGTAAGGGG - Intergenic
950896325 3:16454936-16454958 CAAATACAGAACCAGTTACTGGG + Intronic
950937217 3:16851379-16851401 TGATTTCATCACCTGTTAATAGG - Intronic
951346908 3:21557830-21557852 CAATTTCAGAACTTGTTATTGGG + Intronic
951670048 3:25171109-25171131 CAGTTTCAGAATCTGTAAAAGGG - Intergenic
952275873 3:31876157-31876179 CAATTTAGGCAGCTGTTAATTGG - Intronic
952492218 3:33883690-33883712 CAATTTTAGAACGAGTTAAGAGG - Intergenic
953202452 3:40789582-40789604 TAATTTCAGGATCTGTGAATAGG + Intergenic
953721604 3:45360595-45360617 CAATTTCAGAACTCGTTAATTGG + Intergenic
955053061 3:55431020-55431042 AAATTTCAAAACCTGACAATGGG + Intergenic
955975852 3:64479270-64479292 CAATTTCAGAGCCTGTTATTGGG - Intergenic
957797749 3:85033719-85033741 CATATTCAGAAACTTTTAATTGG - Intronic
960014381 3:112870391-112870413 CAATTTCAGAACTTGAAAACAGG - Intergenic
962820171 3:139040866-139040888 CAATGACAGAATCAGTTAATTGG + Intronic
963744477 3:149112410-149112432 CCATATCATAACCTTTTAATTGG + Intergenic
964399224 3:156281633-156281655 CAATTTCAGCTCCTGTTATTGGG + Intronic
965194424 3:165575663-165575685 CAATTTCAGATCCTGTTATTGGG - Intergenic
965195406 3:165588485-165588507 CAATTTCAGATCCTGTTATTGGG - Intergenic
965198754 3:165630532-165630554 CAACTTCAGAACTAGTTAACAGG + Intergenic
969159544 4:5244243-5244265 CAATTTCAGAGCCTGTTTATTGG + Intronic
969799181 4:9549140-9549162 CCATTTAAGAACCTGTAAACAGG - Intergenic
970191120 4:13520159-13520181 CAATTTCCTAATCTGTTAAGTGG + Intergenic
974130215 4:57745410-57745432 CAATTTCAGAACTTGTTATTGGG + Intergenic
975420845 4:74162725-74162747 CAATTTCTCAATCTGTTAACTGG - Intronic
976938465 4:90669376-90669398 AAATTTTAAAACCTGTTTATAGG + Intronic
976968961 4:91080880-91080902 CAATTTCAGAACCTGTTATTGGG - Intronic
977643365 4:99383064-99383086 CCAATTCAGACCCTGTGAATGGG + Intergenic
977951161 4:102971963-102971985 CAATTTCAGAGCCTGTTAATGGG - Intronic
979520336 4:121658856-121658878 CATTTTAAAAGCCTGTTAATAGG - Intergenic
981038312 4:140195307-140195329 CAACTCCAGAATCTGTTAAGAGG + Intergenic
982488233 4:155995213-155995235 CATTTTCATCACCTGTCAATAGG - Intergenic
982905367 4:161062191-161062213 AAAATTCTTAACCTGTTAATAGG + Intergenic
984340707 4:178452626-178452648 CAATTTTAAAAAATGTTAATGGG - Intergenic
986231182 5:5866100-5866122 CTACTTCAGAACATGTTAACTGG + Intergenic
986312467 5:6562847-6562869 ACATTTCAGAATCTGTTAAGAGG + Intergenic
986851551 5:11818959-11818981 CCTTTTCAGAACCTGTTGAGAGG + Intronic
987733926 5:21813686-21813708 CAATTTCAAAATCTCTGAATTGG - Intronic
987997886 5:25309449-25309471 CAATTTCAGAGTCTGTTATTTGG + Intergenic
988373975 5:30409257-30409279 CATTTTAATAACCTGTAAATCGG - Intergenic
988687918 5:33543336-33543358 CAATTTCAGAGTCTGTTATTGGG - Intronic
989276477 5:39595809-39595831 CAATTTCAGAACTTGTTATCGGG + Intergenic
990077270 5:51864424-51864446 CAATTTCAGGACCTCATAAGTGG - Intergenic
993546907 5:89223404-89223426 CAATTTCAGAGCCTTGTTATTGG - Intergenic
993674271 5:90798399-90798421 CAATTCCAGAACTTGTTATTTGG - Intronic
994611039 5:102039920-102039942 CCACTTCAGAACCTTTAAATAGG + Intergenic
996351312 5:122545051-122545073 CAACATCAGAACTTTTTAATGGG - Intergenic
996907306 5:128615628-128615650 CAATTTTCCAACCTGTTAGTAGG + Intronic
998589877 5:143465555-143465577 CAACTTTAGAACCGGATAATGGG - Intergenic
1000702637 5:164472741-164472763 CAATTTCAGTATCTGTCAAATGG - Intergenic
1001856699 5:175017733-175017755 CAATTCTAGCACCTGTTAGTGGG + Intergenic
1002733264 5:181359589-181359611 CAAGCCCAGAAACTGTTAATTGG - Intergenic
1003501894 6:6710092-6710114 CAATTTTTGCAGCTGTTAATGGG - Intergenic
1004697679 6:18049160-18049182 AAATTTTAAAACCTCTTAATGGG + Intergenic
1005145413 6:22684681-22684703 GAATTTAAGAACCTGCTCATTGG - Intergenic
1005490524 6:26343399-26343421 CAATTTCAGATCCTTATAACTGG + Intergenic
1005558441 6:27011887-27011909 CAATTTCAGAGCCTGTTATTGGG - Intergenic
1005779895 6:29179259-29179281 CAATTTCAGAGCCTGTTATTTGG + Intergenic
1007158467 6:39769587-39769609 CAACTTCAGCACTTGTTAACTGG - Intergenic
1008183154 6:48358626-48358648 CAATTTCAGAGCTCGTTATTGGG - Intergenic
1008825022 6:55683698-55683720 CAATTGCAAAAAATGTTAATAGG - Intergenic
1010060090 6:71612759-71612781 CAATTTCCTAACCTGTAAAATGG + Intergenic
1010129350 6:72472896-72472918 CAATTTCAGATCCTGTTATTGGG - Intergenic
1011120414 6:83945896-83945918 CAGTTTCAGAACTTGTTACTGGG - Intronic
1012251239 6:96983548-96983570 CAATTTCAGAGCCTGTTAATTGG + Intronic
1012616725 6:101286398-101286420 CAATTTCAGAACCTGGCTGTGGG - Intergenic
1012617828 6:101299358-101299380 CAATATCAGAACTTGTAAAATGG + Intergenic
1013377966 6:109537272-109537294 CAATTTCAGAGCCTGTTATTGGG + Intronic
1015689084 6:135900783-135900805 CAATCACATATCCTGTTAATTGG - Intronic
1018798429 6:167205002-167205024 CAATTTGTGAAACTCTTAATAGG - Intergenic
1018814286 6:167319173-167319195 CAATTTATGAAACTCTTAATAGG + Intergenic
1019237513 6:170631911-170631933 CAAGCCCAGAAACTGTTAATTGG - Intergenic
1020907647 7:14084208-14084230 TAATCTCAAAACCTGTTAATGGG + Intergenic
1022330441 7:29374035-29374057 CAATCTCATTACCTTTTAATTGG + Intronic
1022772712 7:33491788-33491810 TAATTTCAGTACCTCTTCATGGG - Intronic
1023051417 7:36255474-36255496 CAATTTCAGAACTTGTTATTGGG + Intronic
1023747516 7:43335295-43335317 AAATATCAGAACCAGTTAAATGG + Intronic
1024102747 7:46049411-46049433 CAATTTCCTTACCTGTGAATGGG - Intergenic
1024195741 7:47057304-47057326 CAATTTCAGAAGCTGGTATAAGG + Intergenic
1026355939 7:69557454-69557476 GAATTTCAGAAGCTGTTATTTGG - Intergenic
1028722574 7:94050386-94050408 CAACTTCATCACCTGTTAAACGG - Intergenic
1028943816 7:96554864-96554886 CAATTTCAGCTCCTGTTTATTGG + Intronic
1030804438 7:113897843-113897865 CAAGTTGAGAACCTGATAAAAGG + Intronic
1031749811 7:125557759-125557781 GAATTTCAGAACTGGGTAATGGG - Intergenic
1032434791 7:131890935-131890957 CCAACTCAGAACCTTTTAATTGG + Intergenic
1033539174 7:142339930-142339952 GAACTTCACAACCTGTTGATGGG - Intergenic
1033880984 7:145883546-145883568 CAATTTCAGAAACTACTATTAGG + Intergenic
1035510254 8:174700-174722 CAAGCCCAGAAACTGTTAATTGG + Intergenic
1036683346 8:10892172-10892194 CAATTTCAAAACATGTAAAAAGG - Intergenic
1037676722 8:21057345-21057367 CAATGGCAAAACCTGCTAATGGG + Intergenic
1040041849 8:42924257-42924279 CAATTTCAAAACCTGTAAAATGG + Intronic
1041120731 8:54583668-54583690 CAATTTCAGAGCCTGTTATTGGG + Intergenic
1042003850 8:64158529-64158551 CAATTTTAGAACCCATCAATGGG + Intergenic
1042018300 8:64341918-64341940 CAGTTTCTGCATCTGTTAATTGG - Intergenic
1042023252 8:64394076-64394098 CGATTTCATCACCTGTTAACTGG + Intergenic
1042894310 8:73650288-73650310 TTATTTCATGACCTGTTAATGGG - Intronic
1043512293 8:80961540-80961562 CAATTTAAAAAAATGTTAATTGG + Intergenic
1045109710 8:98928835-98928857 CAATTTCTAAACCTGATAACAGG + Intronic
1045134658 8:99202520-99202542 TAATTTCAGAAATTGTTATTGGG - Intronic
1046875781 8:119253254-119253276 CAGTTTCAGAAACTTTTACTTGG + Intergenic
1046876863 8:119264551-119264573 CAATTTCGGAACATGTAAACTGG + Intergenic
1048812152 8:138298484-138298506 CAAGTTCAGAAGCTCTGAATTGG + Intronic
1048921614 8:139236451-139236473 CAATTTCATAACCTGATGTTTGG - Intergenic
1050519283 9:6480287-6480309 GAATTTCAGAAAGTGTTAAGTGG - Intronic
1050586467 9:7117057-7117079 CAATTTCATAACCTGTCACATGG - Intergenic
1050642082 9:7679117-7679139 CAATTTCTGAAACTGTAGATGGG - Intergenic
1050802761 9:9636881-9636903 CAATTTCAGCATCTGGTAAGGGG + Intronic
1050899429 9:10927449-10927471 CAATTTTAGAAAATGGTAATAGG - Intergenic
1051035355 9:12738106-12738128 CATTTTTAGATCCTCTTAATGGG + Intergenic
1052126089 9:24776022-24776044 CAATTTAAGAATCTGTAATTTGG + Intergenic
1052200060 9:25767345-25767367 CAATTTCAGAACTTGTTATTGGG - Intergenic
1052277729 9:26696703-26696725 GAATTTCAGAGCTTGTAAATTGG + Intergenic
1052718111 9:32143354-32143376 CAATTTCAGATGATGTTATTTGG - Intergenic
1052725892 9:32227712-32227734 CAATTTCAGAGCCTGTTATTTGG + Intergenic
1052766455 9:32646175-32646197 CACTTACAGCACCTCTTAATTGG + Intergenic
1052849361 9:33367256-33367278 CACTCTCAGAACCTGGGAATAGG + Intronic
1053510089 9:38680355-38680377 GAATTGCAGAACCTGGTTATCGG + Intergenic
1056378943 9:86040135-86040157 CAATTTCAGAACATTTTTATTGG - Intronic
1058182879 9:101819305-101819327 CAATTTCAGAATTTGTTACTGGG - Intergenic
1059004755 9:110389384-110389406 CCATATGAGAACCTTTTAATGGG - Intronic
1059108675 9:111533994-111534016 CATTTTCAGAACCAGTTTTTAGG - Intronic
1059869331 9:118554151-118554173 CAATTACAGAATCTTTTCATGGG + Intergenic
1060079884 9:120633256-120633278 CAATCTCATTACCTGTTACTGGG + Intronic
1060162582 9:121378995-121379017 AAACTTAAGAATCTGTTAATAGG - Intergenic
1186320974 X:8425145-8425167 CATGTTCAGGACCTGTTCATGGG - Intergenic
1186749785 X:12609621-12609643 TAATTTCAAAACCTGTTTTTTGG - Intronic
1187455922 X:19441265-19441287 CATTTTGGCAACCTGTTAATGGG - Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189140518 X:38600597-38600619 CAATTTGACAACCTATAAATAGG + Intronic
1190487304 X:50940523-50940545 CAATATAAGAAAGTGTTAATGGG + Intergenic
1191802043 X:65092357-65092379 CAATTTTGGAACCTGGTAATGGG + Intergenic
1192008375 X:67241463-67241485 CAATTTCAAAACATGGCAATTGG + Intergenic
1192220770 X:69196004-69196026 CCAGTTCAGAATCTATTAATAGG - Intergenic
1192228728 X:69248526-69248548 CAGCTTCAGAACTTGTTATTGGG - Intergenic
1192789297 X:74365610-74365632 CAATTCCAGATTGTGTTAATAGG - Intergenic
1192918746 X:75683185-75683207 GAATTTCAGAGCCTGTTAATTGG + Intergenic
1192919626 X:75692826-75692848 GAATTTCAGAGCCTGTTAATTGG + Intergenic
1193373607 X:80730587-80730609 CAATTTTAGAACATTTTCATTGG - Intronic
1193757332 X:85424505-85424527 CAATTTCAGATCTTGTTTATTGG + Intergenic
1196119313 X:112031459-112031481 CAATTTCTGCACCTGTTTATTGG + Intronic
1196660537 X:118264399-118264421 CAATTCCAGGACCTGATACTTGG + Intergenic
1196724010 X:118879370-118879392 CAATTTCAGATAATGTTAAGTGG - Intergenic
1197575158 X:128202398-128202420 CAATTTCAGAGCCTGTTATTGGG - Intergenic
1199755592 X:150862041-150862063 CAATTTCAAAACTTGTTATTGGG - Intronic
1199935884 X:152573173-152573195 CAATGGCACTACCTGTTAATGGG - Intergenic