ID: 910954958

View in Genome Browser
Species Human (GRCh38)
Location 1:92693027-92693049
Sequence CTTTCTAATGAAGCTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910954958_910954959 4 Left 910954958 1:92693027-92693049 CCAAAAAAAGCTTCATTAGAAAG No data
Right 910954959 1:92693054-92693076 ACAAAAAATAAGATTTGACCAGG 0: 1
1: 0
2: 6
3: 107
4: 1270
910954958_910954960 12 Left 910954958 1:92693027-92693049 CCAAAAAAAGCTTCATTAGAAAG No data
Right 910954960 1:92693062-92693084 TAAGATTTGACCAGGTGCAGCGG 0: 1
1: 1
2: 44
3: 413
4: 2757

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910954958 Original CRISPR CTTTCTAATGAAGCTTTTTT TGG (reversed) Intronic
No off target data available for this crispr