ID: 910958645

View in Genome Browser
Species Human (GRCh38)
Location 1:92736531-92736553
Sequence CAGTCAGATGGCCAGTCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910958645 Original CRISPR CAGTCAGATGGCCAGTCAGG TGG (reversed) Exonic
900350813 1:2233666-2233688 CAGGCAGGTGCCCAGCCAGGTGG + Intronic
901761417 1:11474272-11474294 AAGGCAGATGGGCAGTTAGGAGG - Intergenic
902499760 1:16902185-16902207 CAGCCAGGTGGCTACTCAGGAGG + Intronic
902698923 1:18158463-18158485 GACTCAGATGTCCTGTCAGGAGG - Intronic
903399295 1:23028255-23028277 CAGGCAGATGCCAAGGCAGGAGG - Intronic
904046643 1:27613142-27613164 CAGTCAAAGGGACAGCCAGGTGG + Intronic
904343587 1:29853720-29853742 CAGGCAGATGGGCAATCAAGTGG + Intergenic
905228210 1:36493639-36493661 CAGACAGATGGACAGACAGACGG - Intergenic
905252437 1:36658368-36658390 CAGCCAGATGGACAGGCAGATGG - Intergenic
905790217 1:40785470-40785492 CAGTCAGGTGGGCAGGCAGGTGG - Intronic
910958645 1:92736531-92736553 CAGTCAGATGGCCAGTCAGGTGG - Exonic
911982049 1:104580358-104580380 CAGTCAGAGAGCCAGTGTGGGGG + Intergenic
912580577 1:110717516-110717538 CAATCACTTGGCCAGTTAGGTGG + Intergenic
913477487 1:119252423-119252445 CATTGACATGGCCAGTCAAGAGG + Intergenic
915215682 1:154339274-154339296 AGGTCACATGGCCAGTGAGGAGG - Intronic
916155187 1:161838511-161838533 CATTCACATGGCCAGTAAGTTGG + Intronic
916440680 1:164821596-164821618 CAGTCAGATGTACAGTCCGCAGG + Exonic
917239713 1:172934389-172934411 CATCCAGATGGCCAGTCATCTGG + Intergenic
917982828 1:180282603-180282625 CAGGCAGCTGGCCAGTGAGGAGG - Intronic
918097100 1:181344781-181344803 CAGGCCGATGGCCAGCCCGGGGG - Intergenic
918142689 1:181732450-181732472 CATGCAGATGTCCAGCCAGGAGG + Exonic
918988888 1:191671655-191671677 CAGCCAGGTGGGCAGTCAGTTGG - Intergenic
920387588 1:205579780-205579802 CAGGGAGATGGCCAGAGAGGAGG - Exonic
923470847 1:234289433-234289455 CAGTCATATTTCCAGTAAGGTGG - Intronic
924434739 1:244029023-244029045 CAGTCAGATGTCGAGGCAGCAGG - Intergenic
1062976672 10:1688598-1688620 CAGTCAGAAGGCCAGGCGGGGGG - Intronic
1067077105 10:43194165-43194187 GAGTCAGATGGCCTCTCTGGGGG - Intergenic
1067947284 10:50697561-50697583 CAGCCAGATGAACAGTCAAGCGG - Intergenic
1072289308 10:93947947-93947969 CAGTCAGAGAGCCAGCCAGGTGG + Intronic
1074039149 10:109770932-109770954 CAGTGAGATGGGCTGGCAGGAGG - Intergenic
1074861325 10:117512429-117512451 CACTCAGATGGCCAGGAATGGGG - Intergenic
1075075334 10:119346653-119346675 CATTCTGATGGCCAGCCAGGTGG - Intronic
1075488381 10:122846294-122846316 CATTCAGATGCCCTGCCAGGTGG + Intronic
1076026708 10:127121485-127121507 CAGACAGATGGACAGACAGACGG - Intronic
1076702906 10:132283491-132283513 CAGACAGATGGGCAGTGGGGAGG + Intronic
1077028070 11:450537-450559 CCGGCAGACGGCCCGTCAGGCGG - Exonic
1077554969 11:3221490-3221512 CAAACAGATGGACAGTGAGGGGG - Intergenic
1078966228 11:16347166-16347188 CAGTCAGCAGGCCAGTCATTAGG - Intronic
1080919842 11:36697931-36697953 CAGACAGATGGACAGACAGGAGG - Intergenic
1085045276 11:73349106-73349128 CAGCCAGAATGCCAGGCAGGAGG + Intronic
1089327438 11:117666960-117666982 CTGTCAGGTGGGCAGTCAGCAGG + Intronic
1090949119 11:131457315-131457337 CACACAGATGGCCAGAAAGGAGG + Intronic
1091762894 12:3098870-3098892 TAGTCACATGGCTACTCAGGAGG - Intronic
1093219202 12:16399058-16399080 CATTCAGATGGCAAGGGAGGAGG - Intronic
1096229059 12:49887485-49887507 CAGTCAGAGGGGCAGGGAGGAGG + Intronic
1098205861 12:68109177-68109199 CAGGGAGCTGGCCAGGCAGGAGG - Intergenic
1100018466 12:90041013-90041035 CAGTAAAATGGCCATTCAGGTGG + Intergenic
1100536784 12:95519148-95519170 CACTCATATGGACAGTCTGGTGG - Intronic
1103580787 12:121913740-121913762 CATTCAGAGGCCCAGGCAGGAGG - Intronic
1109179958 13:59202005-59202027 CAGTCAGCTGGTGAGTCAGCTGG + Intergenic
1113102798 13:106738306-106738328 CATGCAGCAGGCCAGTCAGGGGG - Intergenic
1113765026 13:112875835-112875857 CAGCACGATGGCCAGCCAGGCGG - Exonic
1114298505 14:21352456-21352478 CATTCAGATGGCAAGGGAGGAGG - Exonic
1115768223 14:36645609-36645631 CAGAGAGATGGACAGACAGGTGG + Intergenic
1118278294 14:64405737-64405759 CAGTCAGGAGGACAGACAGGAGG - Intronic
1118897369 14:69956249-69956271 CAGCCAGACGGCCAGACAGCGGG + Intronic
1119706406 14:76785462-76785484 AAGGGAAATGGCCAGTCAGGAGG - Intergenic
1124214015 15:27791721-27791743 GATTCAGATGGCCAGTCAGGAGG + Intronic
1131218233 15:90558263-90558285 CTGCCAGAAGCCCAGTCAGGAGG - Intronic
1132195822 15:99914016-99914038 CAGTCACTTGGACAGTCAGTCGG - Intergenic
1134823332 16:17264502-17264524 CAGTCAGATGAAGAGTTAGGGGG - Intronic
1137748214 16:50839049-50839071 CAGGGAAATGTCCAGTCAGGAGG - Intergenic
1141982982 16:87561237-87561259 CAGCCAGAAGGCCAGCAAGGAGG - Intergenic
1142766605 17:2067893-2067915 CAGGCAGACTGCCAGTCTGGTGG + Intronic
1143013496 17:3879307-3879329 CAGCCAGCTGGCCAGGGAGGAGG - Intronic
1143461749 17:7108603-7108625 CAGTCACATGGACAGTGATGGGG - Intronic
1144516185 17:15918916-15918938 CAGCCAGAGGCCCAGGCAGGAGG + Intergenic
1144576653 17:16433880-16433902 CAGGCAGATGGCCAGTCATGTGG - Intronic
1147604173 17:41764639-41764661 AGGTCAGATGCCCAGACAGGAGG + Intronic
1149121463 17:53171485-53171507 CACAAAGATGGCCAATCAGGTGG - Intergenic
1151384926 17:73749066-73749088 CTGTCAGAGGGGAAGTCAGGGGG + Intergenic
1151557775 17:74855157-74855179 GAGGCAGATGGACAGACAGGAGG + Intronic
1152303343 17:79507893-79507915 CAGTGACAGGGCCAGTGAGGGGG + Intronic
1152698831 17:81809196-81809218 CAGGCAGATGGGCAGGCAGACGG - Intronic
1152785008 17:82243168-82243190 CAGGCAGACGGCCAGCCAGCTGG + Exonic
1153667487 18:7379301-7379323 CAGGCAGATGGCCAGGCAGCAGG + Intergenic
1154997070 18:21650403-21650425 CTGTCACATGGCCATCCAGGTGG - Intergenic
1158630827 18:59112495-59112517 AGGCCACATGGCCAGTCAGGTGG - Intergenic
1160866925 19:1260283-1260305 AAGGCGGATGCCCAGTCAGGCGG + Intronic
1161658315 19:5529694-5529716 CAGCCAGCTGGCCAGGGAGGCGG + Intergenic
1162303459 19:9857347-9857369 CAGTCTGGCGGCCATTCAGGAGG - Exonic
1162513042 19:11131280-11131302 GAGACAGATGGTCAGTCTGGAGG + Exonic
1164935064 19:32203489-32203511 CAGTAGGATGGAAAGTCAGGAGG - Intergenic
1165486683 19:36100857-36100879 CAGTCACAGGGACAGACAGGTGG + Exonic
1165853975 19:38869228-38869250 CAGCCAGATGGGCAGTCACCTGG + Exonic
1167568515 19:50272180-50272202 CAGTCAGATGGGAAGAAAGGAGG - Intronic
1168591140 19:57634983-57635005 CAGGGAGAAGGCAAGTCAGGTGG - Intronic
926825736 2:16903476-16903498 CAGTCAGAGGGCCAATGTGGTGG + Intergenic
932604578 2:73156655-73156677 CAGTCAGGAGACCAGGCAGGAGG - Intronic
936982868 2:118279979-118280001 CAGGCAGAGGGCCAAGCAGGTGG + Intergenic
937636390 2:124160205-124160227 CAGTCAGATGTCAAGTCTGAAGG + Intronic
938698292 2:133854256-133854278 CAGCCAGAAGGCCAGGCAGTTGG + Intergenic
946714552 2:222539537-222539559 CAATCAGATGGCCAGACACTAGG + Intronic
948729523 2:239954093-239954115 CACTCAGCTGGCCTGGCAGGTGG - Intronic
948729546 2:239954190-239954212 CACTCAGCTGGCCTGGCAGGTGG - Intronic
948729569 2:239954288-239954310 CACTCAGCTGGCCTGGCAGGTGG - Intronic
949036290 2:241817041-241817063 CGGCCAGAAGGCCTGTCAGGAGG - Exonic
1171118971 20:22551593-22551615 CAGAGAGATGGACAGTCAGAGGG + Intergenic
1171459117 20:25288667-25288689 CAGTGAGCTGGGCAGGCAGGAGG - Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174361112 20:50029523-50029545 CAGGCAGGAGGCCAGTCGGGTGG + Intergenic
1176019036 20:62953258-62953280 CAGTCAGGAGGCCAGGTAGGGGG + Intronic
1176884908 21:14244020-14244042 CTGTCACATGTCCAGTGAGGGGG - Intergenic
1179989882 21:44942286-44942308 CCTTCAGATGGGCAGGCAGGTGG - Intronic
1180993779 22:19954299-19954321 AGGTCAGATGGCCAGGCAGAGGG - Intronic
1181314148 22:21961055-21961077 CAGTCAGAGGGGCAGAAAGGAGG + Intronic
1181637608 22:24181622-24181644 CAGACAGATGGACAGACAGACGG - Intronic
1182556349 22:31131070-31131092 TTGTCACATGGCCAGTCAGTGGG + Intronic
1185029456 22:48433965-48433987 CAGGCAGACGGGCAGCCAGGAGG - Intergenic
950084508 3:10248240-10248262 CAGCCAGATGTGCAGGCAGGTGG - Exonic
950519565 3:13488935-13488957 CAGTAAGATGGCCACACTGGGGG - Intronic
951604471 3:24417905-24417927 CAGTCAGAGGACTAGTCAAGTGG + Intronic
955625737 3:60917345-60917367 GAGGCAGGTGGCCAGTCAGAAGG - Intronic
958176917 3:90007753-90007775 TGGTCAAATGGCCAGTCAGAGGG + Intergenic
958722852 3:97866892-97866914 CAGTCAAACTGGCAGTCAGGTGG - Intronic
961627411 3:128273620-128273642 CAGTCAGCTGTCCAGGCAGAGGG + Intronic
962198684 3:133383982-133384004 CAGTGAGAGGGCCATTAAGGTGG + Intronic
962494321 3:135924127-135924149 CAGTCAGGTGGCCAGTCACGAGG - Intergenic
965604384 3:170484504-170484526 CAGTCATATGGCCAGATATGGGG + Intronic
966463034 3:180198657-180198679 CACTCAGATGGCTATTCATGGGG - Intergenic
967269006 3:187717651-187717673 AAGACAGATGCCCAGGCAGGAGG - Intronic
972132856 4:35859593-35859615 CAGTCAAAGGGCCAGTGAGTCGG + Intergenic
974646603 4:64702960-64702982 AATTCAGATGGCCAGTGTGGTGG + Intergenic
987066724 5:14297152-14297174 CAGGCAGATCGCGAGTCAGCTGG + Exonic
987889914 5:23863915-23863937 CAGTCAGAGGCTCTGTCAGGGGG - Intergenic
988918529 5:35920070-35920092 CTGTCAGAAGGCCAGGCAGTGGG - Intronic
990768157 5:59210655-59210677 CATTCAGAGGGCCAGTGACGAGG - Intronic
995836271 5:116402723-116402745 CAGACATATGGACAGACAGGTGG + Intronic
996521947 5:124437158-124437180 CAGTGAGCTGGCCAGGCTGGAGG - Intergenic
997669283 5:135657059-135657081 CATTCAGATGCCCATTGAGGAGG - Intergenic
998398437 5:141834815-141834837 CAGTCAGGACGCCAGTCAGCTGG + Intergenic
998565662 5:143213846-143213868 CAGCCAGATGGCAAGACATGAGG - Intronic
999277925 5:150344296-150344318 CAGGCAGAAGGTCAGACAGGAGG - Intergenic
999291662 5:150429909-150429931 CCCTCAGAGGGCCAGGCAGGAGG + Intergenic
999378209 5:151101566-151101588 CAGACAGATGGGCAGCCGGGAGG - Intronic
999768088 5:154755751-154755773 CGCGCAGATGGCCACTCAGGTGG + Intronic
1000432536 5:161167549-161167571 CAGTCATATGACCTGGCAGGAGG + Intergenic
1001549603 5:172593511-172593533 GAGGCAGATGGCCAGCGAGGTGG + Intergenic
1002639954 5:180626039-180626061 CACACAGATGGCCGGTCAGCTGG + Intronic
1006539248 6:34726172-34726194 CAGACAGTTTGCCAGGCAGGGGG + Intergenic
1007403460 6:41618090-41618112 CATTCAGCTGGCCATTCAGCTGG + Intergenic
1008384999 6:50879240-50879262 CACTCTGATGGAGAGTCAGGAGG + Intergenic
1008474874 6:51925678-51925700 CAGTCAGAAGGCCAGCAAGCTGG - Intronic
1015066261 6:129032681-129032703 TAGTCAGCAGGCCATTCAGGAGG + Intronic
1021604963 7:22400783-22400805 CAGTCAGCTGGCAAATCAGTCGG - Intergenic
1022279036 7:28887230-28887252 AAGGCACATGGCCAGTGAGGTGG + Intergenic
1026538591 7:71261008-71261030 AAGTCAGCTGCCCACTCAGGAGG - Intronic
1028147226 7:87331265-87331287 CAGTCAGACAGGCAGTTAGGGGG - Intergenic
1029417691 7:100453641-100453663 CGCTCAGTTGGCCAGACAGGAGG - Intergenic
1029727370 7:102415988-102416010 CAGTCAGATGAGAAGTCAGGCGG - Intronic
1030384281 7:108848670-108848692 CAGTCAAATGCACAGGCAGGTGG - Intergenic
1031985494 7:128162075-128162097 TGGTCAGATGGCCAGTGAGTGGG + Intergenic
1032566684 7:132954107-132954129 CAGGCAGAGGGACAGGCAGGAGG + Intronic
1032804411 7:135340407-135340429 CGGTCAGAATCCCAGTCAGGTGG - Intergenic
1033933577 7:146554750-146554772 CAGACAGCTGCCCAGGCAGGTGG + Intronic
1034407009 7:150911318-150911340 AAGTCAGCTTGCAAGTCAGGCGG + Intergenic
1034713365 7:153217065-153217087 AAGACAGATGGCCAAGCAGGAGG - Intergenic
1034938342 7:155214077-155214099 CAGACAGCGGGGCAGTCAGGAGG + Intergenic
1035225465 7:157430046-157430068 CAGACAGATGGACAGGCAGATGG - Intergenic
1035225641 7:157430702-157430724 CAGGCAGATGGGCAGACAGATGG - Intergenic
1039386704 8:37142684-37142706 CAGACAGCTGGACAGACAGGCGG - Intergenic
1041520433 8:58750030-58750052 CAGTCAGATGTCCAGGAAAGAGG + Intergenic
1041617620 8:59926505-59926527 AAATCATATGGCCAGCCAGGAGG + Intergenic
1042735305 8:71981179-71981201 CAGACAGAGGGCCAGCAAGGGGG + Intronic
1045743141 8:105386095-105386117 CAGTAAAATGGCCAGTAAGTGGG + Intronic
1046248117 8:111593031-111593053 CAATCATATGGCCAGAAAGGTGG - Intergenic
1047522549 8:125606378-125606400 CAGTCAGATGCCAAGGCAGGGGG - Intergenic
1049796386 8:144499100-144499122 CTCTCAGATGGCCGCTCAGGAGG + Intronic
1050718728 9:8560977-8560999 CAGTCAAATGCCTAGTCAGATGG + Intronic
1053043310 9:34892835-34892857 CAGTCAGCTGCCCGGTCAGCTGG - Intergenic
1053288821 9:36866721-36866743 AAGTCATATGGCAAGTCAGAGGG - Intronic
1054810511 9:69430412-69430434 CTGGCAGGTGGCCAGGCAGGCGG - Exonic
1056879757 9:90379947-90379969 CAGTCACATAGCCAGTAAAGGGG + Intergenic
1059239015 9:112787052-112787074 CAGCCAGGTAGCCAGTCAGGTGG + Intronic
1060610057 9:124955586-124955608 CACTCTGTTGCCCAGTCAGGAGG - Intronic
1061003277 9:127914740-127914762 CAGGCAGGTGGCCAGGCAGAGGG + Exonic
1061193910 9:129097182-129097204 CAGTCAGAGGGACAGACAGATGG + Intronic
1061213393 9:129206305-129206327 CAGTCAAATGGCCAGGCAGAAGG - Intergenic
1061613443 9:131763617-131763639 CAGACAGATGGGCAGACAGAGGG + Intergenic
1061712708 9:132498918-132498940 CAGTCAGCTGCCCAGGCTGGCGG - Intronic
1062095317 9:134700109-134700131 CTGTCAGATGGCAAGTAAGTGGG + Exonic
1062106161 9:134756147-134756169 CAGCCCCATGGCCAGTCAGTTGG + Intronic
1189685938 X:43563618-43563640 AAGTCTGATGGCCAGTCAGGAGG - Intergenic
1192367253 X:70484246-70484268 ATGGCAGATGGCCAGTCAGGAGG - Intronic
1195045295 X:101049983-101050005 CAGTCAGCAGGAAAGTCAGGAGG + Intronic
1195814792 X:108873124-108873146 TGGTGAGTTGGCCAGTCAGGGGG - Intergenic
1198393095 X:136196168-136196190 CAGTGAGGAGGCCAGTGAGGTGG + Intronic
1199851103 X:151725398-151725420 GAGCCAGAGGGCCAGGCAGGAGG - Intergenic
1200117462 X:153775623-153775645 CAGGCAGATGGACAGCCAGTTGG - Exonic