ID: 910968890

View in Genome Browser
Species Human (GRCh38)
Location 1:92834206-92834228
Sequence ATGCCACTTAACCACTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910968883_910968890 30 Left 910968883 1:92834153-92834175 CCAATTCCAGTAGAAGAATAGGG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG No data
910968885_910968890 24 Left 910968885 1:92834159-92834181 CCAGTAGAAGAATAGGGTTTGTC No data
Right 910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG No data
910968888_910968890 -8 Left 910968888 1:92834191-92834213 CCTATATGGCCTTATATGCCACT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG No data
910968887_910968890 2 Left 910968887 1:92834181-92834203 CCTGATTTTTCCTATATGGCCTT No data
Right 910968890 1:92834206-92834228 ATGCCACTTAACCACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910968890 Original CRISPR ATGCCACTTAACCACTGAAA AGG Intronic
No off target data available for this crispr