ID: 910981244

View in Genome Browser
Species Human (GRCh38)
Location 1:92961547-92961569
Sequence GGCGCGCGCCGCGGCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1464
Summary {0: 1, 1: 1, 2: 21, 3: 163, 4: 1278}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910981244_910981261 24 Left 910981244 1:92961547-92961569 CCGCCCCCGCCGCGGCGCGCGCC 0: 1
1: 1
2: 21
3: 163
4: 1278
Right 910981261 1:92961594-92961616 TGAAGGCGGCGAGAGGCCAGAGG 0: 1
1: 0
2: 0
3: 15
4: 187
910981244_910981251 -5 Left 910981244 1:92961547-92961569 CCGCCCCCGCCGCGGCGCGCGCC 0: 1
1: 1
2: 21
3: 163
4: 1278
Right 910981251 1:92961565-92961587 GCGCCGCGCTCCCCTCGGCCCGG 0: 1
1: 0
2: 3
3: 23
4: 223
910981244_910981260 17 Left 910981244 1:92961547-92961569 CCGCCCCCGCCGCGGCGCGCGCC 0: 1
1: 1
2: 21
3: 163
4: 1278
Right 910981260 1:92961587-92961609 GCTGCAGTGAAGGCGGCGAGAGG 0: 1
1: 0
2: 0
3: 23
4: 198
910981244_910981257 10 Left 910981244 1:92961547-92961569 CCGCCCCCGCCGCGGCGCGCGCC 0: 1
1: 1
2: 21
3: 163
4: 1278
Right 910981257 1:92961580-92961602 CGGCCCGGCTGCAGTGAAGGCGG 0: 1
1: 0
2: 1
3: 15
4: 205
910981244_910981256 7 Left 910981244 1:92961547-92961569 CCGCCCCCGCCGCGGCGCGCGCC 0: 1
1: 1
2: 21
3: 163
4: 1278
Right 910981256 1:92961577-92961599 CCTCGGCCCGGCTGCAGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 168
910981244_910981250 -10 Left 910981244 1:92961547-92961569 CCGCCCCCGCCGCGGCGCGCGCC 0: 1
1: 1
2: 21
3: 163
4: 1278
Right 910981250 1:92961560-92961582 GGCGCGCGCCGCGCTCCCCTCGG 0: 1
1: 0
2: 0
3: 20
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910981244 Original CRISPR GGCGCGCGCCGCGGCGGGGG CGG (reversed) Intergenic
900095983 1:940306-940328 GGCCGGCTCCGCGGCGGGGCGGG - Intronic
900113755 1:1020124-1020146 CGCGCGGGCCGCGCCGGGGACGG - Exonic
900119148 1:1041120-1041142 GGCGGGAGCGGGGGCGGGGGCGG + Intronic
900151465 1:1180938-1180960 GGCGGGCGCAGGGGCAGGGGTGG - Intronic
900180199 1:1307897-1307919 GGCGGGCGCCGAGGCGGCGCGGG - Exonic
900245155 1:1633129-1633151 GGGCCGGGCCGGGGCGGGGGCGG - Intronic
900256386 1:1700288-1700310 GGGCCGGGCCGGGGCGGGGGCGG - Intronic
900349400 1:2227675-2227697 GGCGCGGGCGGAGGCGGAGGCGG - Intergenic
900349668 1:2228497-2228519 GGCCCGGGCGGCGGCGGGCGCGG + Intergenic
900349747 1:2228689-2228711 GGCGCGCGGGGCGGCGGCGGGGG + Exonic
900366957 1:2315273-2315295 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
900522398 1:3111967-3111989 GGCCGGCGCGGCGGCGAGGGAGG + Intronic
901007791 1:6180106-6180128 GGCGCGCGCGGCGGGCGAGGCGG + Exonic
901050698 1:6424663-6424685 TCCCCGCGTCGCGGCGGGGGCGG + Intronic
901050821 1:6425134-6425156 GGCGCGGGCCGCGGCGGGGAGGG - Exonic
901109858 1:6785695-6785717 GGCGGGCGACCCGGCCGGGGAGG + Intronic
901433880 1:9234721-9234743 GGCGCGCGCGGCGGGGGCGGGGG - Intergenic
901506611 1:9689522-9689544 GGCGCGGCCCGGGGCGGGGCTGG - Intronic
901641193 1:10694029-10694051 GGCGGGCGCCGAGGCCGCGGCGG + Intronic
901724096 1:11226917-11226939 GGCGGGGGCGGGGGCGGGGGTGG - Intronic
902072124 1:13749277-13749299 GGCGCGCACCGGGACGCGGGCGG - Intronic
902169600 1:14599156-14599178 GGCCAGCGCCTCGGCGGCGGGGG + Exonic
902214171 1:14924223-14924245 GGCGCGCGCCGCCGGCCGGGCGG + Intronic
902323569 1:15684304-15684326 GCTGTGCGCCGCGGCGGCGGCGG - Intergenic
902336734 1:15758611-15758633 GGCGCGGGGCGCGGCCGGGCAGG + Intronic
902350112 1:15847971-15847993 GGCGGGTGCCGGGGCGGCGGCGG - Exonic
902451499 1:16499350-16499372 GGCCGGGGCCGAGGCGGGGGCGG + Intergenic
902501447 1:16914151-16914173 GGCGCGCGCGTGCGCGGGGGCGG + Intronic
902600893 1:17539700-17539722 GTCGCGCACGGCGGCGGCGGCGG + Intergenic
902823238 1:18956232-18956254 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
902823383 1:18956718-18956740 GGGCGGGGCCGCGGCGGGGGCGG - Intergenic
903132733 1:21290240-21290262 GGGGCGGGGCGCGGCGGCGGCGG - Intronic
903184746 1:21622610-21622632 GGCGCGGGGCGGGGCGGGGCGGG + Intronic
903250977 1:22052941-22052963 GGCGGGGGTCGCGGCCGGGGAGG + Intronic
903398295 1:23019614-23019636 GGCGGCAGCCGCGGCGGCGGCGG + Exonic
903413789 1:23168155-23168177 GGCGCGGGCCGCGGGCCGGGCGG - Intronic
903468366 1:23568128-23568150 GGCGCGGGGCGCGGGCGGGGAGG - Intergenic
903596988 1:24502740-24502762 GGGGCGCGCGGGGGCCGGGGTGG - Intronic
903750405 1:25617470-25617492 GGCGCGGGCCCCGGCGCGGCGGG + Exonic
903950673 1:26994300-26994322 GGCCCGCGCCGCGGCCGCCGCGG + Exonic
904045164 1:27604226-27604248 CGCGCGCGGAGCGGCCGGGGCGG - Intronic
904063153 1:27726475-27726497 GGAGACCGCGGCGGCGGGGGAGG - Intronic
904542011 1:31239644-31239666 GGCGCGCCGGGCGGCGGGGCCGG + Intergenic
904618080 1:31760683-31760705 GGCGAGCGCCGGGGAGGCGGAGG - Intronic
904641996 1:31938109-31938131 GTCGCGCGCCGAGGCTGGGGGGG - Exonic
904642051 1:31938341-31938363 TGCGCGCGCAGCGGTGGTGGTGG - Exonic
904672890 1:32179598-32179620 GGCGGGCGCCCCGGCAGGGCGGG - Intergenic
904782934 1:32964397-32964419 GGCGGAGGCCGCGGCGGCGGCGG - Exonic
905066844 1:35192089-35192111 TGCGCGCGCCGCTGCGGGGGCGG - Intronic
905107559 1:35573539-35573561 GGCGCGAGGCGTGGCGGCGGCGG - Exonic
905201750 1:36320983-36321005 GGCGCGGGTCCCGGCGGGAGGGG + Intronic
905375053 1:37514538-37514560 GGGGCGCGGCGCGGCGGGCCGGG - Intronic
905414379 1:37794384-37794406 GGCGGCGGCGGCGGCGGGGGCGG - Exonic
905617110 1:39408929-39408951 GGGGCGGGGCCCGGCGGGGGCGG - Intronic
905670709 1:39788594-39788616 GGCGGGCGGCGGGGCGGGGCGGG + Exonic
905960167 1:42036127-42036149 CGCGTGCGCCGTGGCTGGGGAGG + Intergenic
906027020 1:42682600-42682622 GGCGGGGGCGGCGGGGGGGGCGG - Exonic
906214605 1:44031420-44031442 TGCGAGCGGCGCGGCGGGGCGGG - Intronic
906377037 1:45304103-45304125 GGCGCGCGGGGCCGCGGGGCAGG - Intronic
906614569 1:47225571-47225593 GGCGGGCGCGGGGGCCGGGGCGG + Exonic
906614603 1:47225704-47225726 GGCGCGCGCGGAGGCCCGGGGGG - Exonic
906641873 1:47445804-47445826 GGCGTGGGCCGGGGTGGGGGTGG - Intergenic
907767357 1:57424144-57424166 GGCGCGGGGGGCGGCGGGGCGGG - Intronic
908355701 1:63323398-63323420 GGCGCGAGCGGCGGCGGGCCTGG + Exonic
910251205 1:85200950-85200972 GGCGCGCGGCGGGGCGGCAGGGG - Exonic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
912185506 1:107270694-107270716 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
912337538 1:108876894-108876916 GGCGGGCGGCGCAGCGGGGCGGG - Exonic
912401606 1:109397941-109397963 GTGGCGCGCGCCGGCGGGGGTGG - Exonic
912435183 1:109656589-109656611 TGCGTGCGCCGGGGTGGGGGGGG + Intronic
912492711 1:110070728-110070750 GGCGCGCGCCGCGGGGGGCGGGG + Intronic
912576261 1:110675002-110675024 GGCGCGCGCCCCGCAGGGGAGGG - Exonic
913109060 1:115641854-115641876 GGCCGGCCCCGCGGCGGGGCCGG + Intergenic
914286157 1:146228799-146228821 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
914428561 1:147600068-147600090 GTGGCGCGGTGCGGCGGGGGAGG + Intronic
914847612 1:151291638-151291660 GGCGGGGGCGGGGGCGGGGGTGG - Exonic
914869164 1:151458957-151458979 GGCGCGGCCCGCGGCAGGGGCGG - Intronic
915142494 1:153776124-153776146 CGCGCGCGCCGCAGCTGCGGAGG - Exonic
915161260 1:153922519-153922541 GGGGCGCGCCGTGCCGGGGTGGG + Intronic
915167788 1:153958250-153958272 GGCGGGCGCCGCAGCGAAGGAGG - Intronic
915238457 1:154502451-154502473 GGCGCCAGCCGCGGAGGGGAGGG - Intronic
915247664 1:154567985-154568007 GGAGCGCGCCGCCGGGGGGAGGG - Exonic
915393153 1:155562419-155562441 GGCGGGAGCGGCGGCGGCGGCGG + Exonic
916773444 1:167936195-167936217 GGCCCGCCCCGAGGCGCGGGCGG + Intronic
917141807 1:171842131-171842153 GGCGCGCACCGAGGGGGTGGGGG - Intronic
917291584 1:173477197-173477219 GGCGCGGGGCGGGGCGGGGCTGG - Intergenic
917846733 1:179026135-179026157 CCCGCCCGCCGCGCCGGGGGCGG - Intronic
917869648 1:179229785-179229807 GGGGCGCGGCGCGGCAGGGCGGG - Intergenic
918064406 1:181089553-181089575 GAAGCGCTGCGCGGCGGGGGTGG + Exonic
918066511 1:181105341-181105363 GGCGCGCGGCGCGGCGCTGCGGG + Intergenic
918066570 1:181105500-181105522 GGGGCGGGGCGGGGCGGGGGCGG + Intergenic
918215942 1:182391930-182391952 GGCGGGCGCCGCTGGGGTGGGGG + Exonic
918282839 1:183023186-183023208 GGCGCGCGACCCGGGGGGAGGGG - Intergenic
918365649 1:183805129-183805151 GTCGCGCGCACCGGCGGCGGCGG + Intronic
918480671 1:184974117-184974139 GGCGCGCTCCGGCGCGGGTGTGG - Intronic
919820526 1:201469229-201469251 GGTGCGCGGCGCGGAGGGGAGGG - Intronic
919981088 1:202643320-202643342 GGCGGGGGCGGGGGCGGGGGCGG + Exonic
920184590 1:204152082-204152104 CCCGCGGGCCGGGGCGGGGGCGG - Intergenic
920309963 1:205043230-205043252 GGCGGCCGCGGCGGCGGTGGCGG - Exonic
920309964 1:205043233-205043255 GGCGGCGGCCGCGGCGGCGGTGG - Exonic
920367781 1:205457120-205457142 GGAGCCCGCAGGGGCGGGGGAGG + Intergenic
920641008 1:207752043-207752065 GGCCCGAGCCGCGCCCGGGGCGG - Exonic
920986859 1:210898667-210898689 GGCAGGCGTGGCGGCGGGGGGGG + Intronic
921167131 1:212515238-212515260 GGGGCGGGGCGGGGCGGGGGGGG - Intergenic
921172100 1:212558982-212559004 TGCGCGCGGCCCGGCGGGGGCGG + Intergenic
921217742 1:212951490-212951512 GGGGCGCGCGGCGGCGGCAGCGG - Exonic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
922351393 1:224737201-224737223 TGCGTGCTCCGCTGCGGGGGTGG + Intronic
922496498 1:226062223-226062245 GGCGCGCGCCGGGGCCCGCGCGG + Intronic
922496512 1:226062262-226062284 GTCTCGGGCCGCGGCGGGGAGGG - Intronic
922739383 1:228006913-228006935 GCGGCGCGGGGCGGCGGGGGCGG - Intergenic
922851165 1:228735335-228735357 GGCGCGCGGCGCGCAGGCGGGGG + Exonic
922937313 1:229432497-229432519 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
922937317 1:229432503-229432525 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
923107907 1:230868561-230868583 GGCGCGGGGCGGGGCGAGGGCGG - Exonic
923119589 1:230978371-230978393 AGGGCGCGCGGCGGCGTGGGTGG + Intronic
923353222 1:233129392-233129414 GGAGCCCACCGCGGCGGGGCGGG - Intronic
923400778 1:233614076-233614098 GGCCCGGGCGGGGGCGGGGGCGG + Exonic
923506455 1:234609765-234609787 GGCGGGCGGCGCGGCGCGGCGGG + Intergenic
923631155 1:235650101-235650123 GGCCCGGGCTGGGGCGGGGGCGG - Intronic
923631159 1:235650107-235650129 GGCGCGGGCCCGGGCTGGGGCGG - Intronic
924289656 1:242524515-242524537 GGTGCGGGCGGGGGCGGGGGCGG + Exonic
924289660 1:242524521-242524543 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
924289727 1:242524719-242524741 GGCGGCGGCGGCGGCGGGGGTGG + Intergenic
924436558 1:244048608-244048630 GGCGGGCGCGGGGGAGGGGGAGG - Intergenic
924527194 1:244863492-244863514 GGAGGGCGCCGCGGTGAGGGTGG - Intronic
924801431 1:247331734-247331756 GGCGCGGGCCGAGGAGGGCGGGG + Exonic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1062843801 10:689751-689773 GGCGCGCGAGGCGGCCGTGGCGG - Intergenic
1063114990 10:3067105-3067127 GGGGCGCGCCAGGGCGGGGCGGG - Intronic
1063929848 10:11018060-11018082 GGCGCACGCGGCGGCAGCGGCGG - Exonic
1063995088 10:11611518-11611540 GCGGCGCGGCGCGGCGGCGGCGG + Intronic
1064011869 10:11742322-11742344 GGGGCGTGCCGGGGCGGGGAGGG + Intergenic
1064011879 10:11742342-11742364 GGGGCGTGCCGGGGCGGGGCGGG + Intergenic
1064028797 10:11869982-11870004 GGCGTCCCCCGCGGCGGGGAAGG - Exonic
1064208969 10:13347774-13347796 GCCCCGCGCGGCGGCGGCGGCGG + Intronic
1064209073 10:13348105-13348127 GCCGCGCCCGGCGGCGGCGGCGG + Exonic
1064274195 10:13891767-13891789 GGCGGGGGCGGCGGCGGGGACGG - Intronic
1064354278 10:14603974-14603996 GGCGGGGGCCGCTGCGGGGAAGG - Intronic
1064354283 10:14603989-14604011 GGGGGGCGCCGCGGAGGCGGGGG - Intronic
1064443184 10:15371311-15371333 GGCGCGGGCAGCGGCGGCGGCGG - Intergenic
1064553112 10:16521715-16521737 GGTGCGCCCAGCGGCGGCGGCGG + Exonic
1064622398 10:17229191-17229213 GGCGCGCTCCGCGGCTGGGATGG + Intronic
1065025101 10:21534104-21534126 GGCGAGCGGCGCGGGGGAGGGGG + Intergenic
1065025399 10:21535125-21535147 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1065069025 10:22003346-22003368 GGCGTCCGCGGCGGCGGCGGCGG + Exonic
1065099633 10:22320943-22320965 GGCGCGCGGCGCGGAGGGGAGGG + Intronic
1065140358 10:22714021-22714043 GGCACGCGCCGCGGGGCTGGGGG + Intronic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1066080802 10:31928842-31928864 GGAGCGCGCCGGCGCGGGGGCGG + Intronic
1066180602 10:32957999-32958021 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1066429218 10:35336458-35336480 GGCGGGGGCTGCGGCGAGGGCGG + Intronic
1067060783 10:43077007-43077029 GGGGCGGGGCGGGGCGGGGGCGG - Exonic
1067096536 10:43305052-43305074 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1067336949 10:45374105-45374127 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1067336953 10:45374111-45374133 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1067471419 10:46541293-46541315 GGGGCGGGGCGGGGCGGGGGAGG - Intergenic
1067972807 10:50991703-50991725 GGCTCTGGCCGCGGCGGCGGGGG + Intronic
1068544936 10:58334923-58334945 GGGGCGGGGCGCGGCGGGGAGGG + Intergenic
1068989128 10:63133286-63133308 GGCCCGCGGCGCGGCGCCGGAGG + Exonic
1069419153 10:68231196-68231218 GGCGCGCGCCTCCGCGGGGGTGG - Exonic
1069486614 10:68827782-68827804 GGCGCGCGCCGCCTCGCGGCTGG + Exonic
1069486701 10:68828118-68828140 GGCGCGCGCCGCCTCGCGGCTGG + Intronic
1069651652 10:70053568-70053590 GGGGCGGGCCGCGCCGGGGAAGG + Intronic
1069676953 10:70255196-70255218 GGCGCGGGCAGAGGCGGGCGCGG + Exonic
1070079166 10:73168404-73168426 GCCGCCCGCCCCGGCTGGGGTGG - Intronic
1070257603 10:74825428-74825450 GGCGGGCGGCGCGGGGGGAGCGG + Intergenic
1070329989 10:75409691-75409713 GGCCCGCGCGGCGGAGGGGCGGG - Intergenic
1070570647 10:77637748-77637770 CCCGCGCTCCGCGGCGGCGGCGG - Intronic
1070610088 10:77926860-77926882 GGCGCGCGCGGAGGCTGAGGGGG - Intergenic
1071086825 10:81875239-81875261 GGCGCGGGCTCCGGCGGCGGCGG - Intergenic
1071529280 10:86376916-86376938 GGCGCGCGCGGCCTCTGGGGAGG - Intergenic
1071695290 10:87863512-87863534 GGCTCCCGGCGCGGCGGCGGAGG + Exonic
1071997513 10:91162861-91162883 GGCGCTGGCGGCGGCGGGCGCGG - Intergenic
1071997558 10:91162977-91162999 GGAGCCCGCGCCGGCGGGGGCGG - Intergenic
1072021837 10:91410285-91410307 GGCGCGGGCGCGGGCGGGGGCGG + Exonic
1072151721 10:92689786-92689808 GGGGCGGGCCGGGGTGGGGGCGG + Intergenic
1072169887 10:92848744-92848766 GGTGCGCGCGGGGGCGGGCGGGG + Intronic
1072719505 10:97771940-97771962 GGCGACCTCCGCGGCGGCGGCGG - Exonic
1072915485 10:99535284-99535306 GCCACGCGGCGCGGCGGCGGCGG - Exonic
1072970174 10:100010166-100010188 TCGGCGCGCTGCGGCGGGGGCGG - Intergenic
1073049185 10:100656679-100656701 GGCTAGGGCCGCGGCGGGCGGGG + Intergenic
1073058256 10:100715696-100715718 GGCGCCGGCGGCGGCTGGGGCGG - Intergenic
1073147861 10:101292232-101292254 GGCGCGGCCCGCGTGGGGGGCGG - Intergenic
1073266367 10:102230673-102230695 GGCGGCAGCCGCGGCGGCGGCGG + Exonic
1073290112 10:102409242-102409264 GGAGTGCGCGGCGGCGGCGGCGG + Intronic
1074571898 10:114632072-114632094 GGGGCCCGCCGAGGCGGGGCGGG - Intronic
1074618450 10:115093369-115093391 GGCGCGGGCCGCGGGCGAGGCGG + Intronic
1074843265 10:117375390-117375412 GGCGCGGGCCGCTGCGGGCTCGG - Exonic
1075032114 10:119030350-119030372 GGAGCGGGCCCCGGCGTGGGCGG + Exonic
1075054316 10:119206859-119206881 GCCGCGCACCGCGGCCGGCGGGG + Intergenic
1075521515 10:123146431-123146453 GGTGCGCGCAGCGGCCCGGGAGG - Intergenic
1075587256 10:123666814-123666836 GGCGAGCGCGGCGGCTGGGAAGG - Exonic
1075999787 10:126905574-126905596 GGCGAGAGGCGCGGCGGCGGCGG - Intronic
1076116967 10:127907451-127907473 TGGGCGCGCCGCGGGGGCGGCGG - Intronic
1076372496 10:129964393-129964415 GGCGAGCGCGGCGGCGGCGGCGG - Intergenic
1076554144 10:131311315-131311337 GGGGTGCGCGGCGGCGGCGGCGG + Exonic
1076624689 10:131814625-131814647 TGCGTGCTCCGCGGAGGGGGAGG - Intergenic
1076722204 10:132397562-132397584 GGCGGGCGCCGGGCCGGGGCGGG + Intronic
1077010084 11:375783-375805 GGCCCGCGCGGGGGCGAGGGCGG + Intronic
1077048047 11:554918-554940 GGCGGGCGCCGGGGCTGGGCGGG - Exonic
1077103643 11:832862-832884 AGCGCCCGCCGCCGCGGGAGGGG + Exonic
1077214543 11:1389990-1390012 GGCGCGGGCCTCGGCGGCGGCGG + Intronic
1077491496 11:2862906-2862928 GACGCGCGGCGCGGTGGGGGCGG + Intergenic
1077492757 11:2869778-2869800 GCCGCGAGCAGCGGCGGGGCCGG + Intergenic
1077495762 11:2885908-2885930 GGGCCGGGCCGCGGCGGGGCGGG - Intergenic
1077505719 11:2929226-2929248 GGCGCGCGCGGGGGCTGGCGGGG + Exonic
1077505850 11:2929681-2929703 GGCGAGCGCCCGGGCGGGGCGGG - Intergenic
1078245940 11:9573506-9573528 GGCTGGCGCCGAGCCGGGGGTGG + Intergenic
1079035206 11:17014448-17014470 GGCGCGGGCAGGGGCGGAGGCGG + Intergenic
1079064371 11:17276715-17276737 GGCGCGCGCGGCGGGAGGAGGGG + Intronic
1079076712 11:17389111-17389133 AGCGGGAGCCGCGGCGCGGGCGG - Intronic
1079689410 11:23403542-23403564 GGCCCGTCCCGCGGCGGCGGCGG - Intergenic
1080012326 11:27472001-27472023 GGCCCGGGCGGCGGCGGGGCGGG + Intronic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080606633 11:33869625-33869647 CGGGCGCGCCGCGGCCGAGGCGG + Intronic
1081207564 11:40293201-40293223 GGCGGGGGCGGGGGCGGGGGCGG + Exonic
1081492581 11:43579620-43579642 GCCCCGCGCCGCGGCGGCGGCGG + Intronic
1081672422 11:44949649-44949671 GGGGCGCGCCGGGGTGGGCGCGG + Intronic
1081699973 11:45146804-45146826 GGCGGGCGGCTCGGCGGAGGCGG - Intronic
1081805020 11:45885770-45885792 GGAGCGCGGCGCGGAGGAGGCGG - Exonic
1081831913 11:46121544-46121566 GGCGCGCACGGCGGCGGCGGCGG - Intergenic
1081831957 11:46121649-46121671 AGAGCGGGCCGCGGCGGGGAGGG + Intergenic
1081863531 11:46347522-46347544 GGCGCGCGGCGCGGGGCGGGCGG + Intronic
1081870723 11:46381544-46381566 GGCGCGGGCTGGAGCGGGGGCGG + Intronic
1082029501 11:47594259-47594281 CGCCCGCGCTGCGGCAGGGGCGG + Exonic
1082807591 11:57460638-57460660 GGGGCGCGACGGGGCGGGGAAGG - Exonic
1082838344 11:57668061-57668083 GGAGCGCGCGGCAGCGGGGCGGG + Exonic
1083171092 11:60924496-60924518 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1083303756 11:61752543-61752565 GGCGCTGGGCGCGGCGGGCGGGG + Intergenic
1083342376 11:61967239-61967261 GGCGCGCGCTGGGGCGGGCCGGG - Intronic
1083571370 11:63763740-63763762 GGCGGGGGCGGAGGCGGGGGAGG + Exonic
1083599646 11:63938942-63938964 GGCGCGCGGTTGGGCGGGGGGGG + Intronic
1083617988 11:64035869-64035891 GGTGCGCTCGGCGGCGGGGCGGG - Intronic
1083672182 11:64305750-64305772 GGGGAGCGCTGCCGCGGGGGTGG + Intronic
1083684550 11:64368615-64368637 GGCGCGGGCAGGGGTGGGGGTGG + Intronic
1083753645 11:64777908-64777930 GGGGCGCGCGGCGGCGGCGACGG - Intronic
1083772982 11:64878672-64878694 GGCTAGCGCCGCCGCGGCGGGGG + Exonic
1083945041 11:65918995-65919017 GGCGGCGGCCGTGGCGGGGGTGG - Exonic
1083945119 11:65919205-65919227 GGGGCGGGCCGCGGGGGGCGGGG + Intergenic
1083999583 11:66288915-66288937 GGGGCGCGGCGCGGCCGGCGGGG - Intronic
1084010932 11:66347849-66347871 GGTGCGCGCGCCGGCGGGGAGGG - Intergenic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084165304 11:67372617-67372639 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1084165308 11:67372623-67372645 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1084284260 11:68121304-68121326 GGCGCGCGGGGCGGCGGCGGCGG + Intronic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1084418577 11:69049034-69049056 GGCGGGGCCCGCGGCGGTGGCGG + Exonic
1084526908 11:69703602-69703624 GGTGCGCGCGGCGGGGCGGGCGG + Intronic
1084526910 11:69703604-69703626 TGCGCGCGGCGGGGCGGGCGGGG + Intronic
1084546845 11:69818944-69818966 CGCCCGCCCCGCGGCGGCGGCGG + Exonic
1084888136 11:72223855-72223877 GGCGGGCGGCGCGGAGGGCGGGG + Intronic
1084946681 11:72642468-72642490 GGGGCGGGCCGGGGCGGGGCCGG - Intronic
1085165816 11:74398452-74398474 GGGGCGGGCGGCGGCGGCGGCGG - Exonic
1085321552 11:75577323-75577345 GGCGGGGGCGGGGGCGGGGGGGG - Intergenic
1085321558 11:75577329-75577351 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1085641587 11:78196378-78196400 GGCGCGCGCCTCTACGTGGGCGG + Exonic
1086064904 11:82733805-82733827 CGCGCGCGCCGCGCCGGGGCGGG - Exonic
1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG + Intronic
1087241807 11:95789494-95789516 GGAGCGGGCGGCGGCGGAGGAGG - Exonic
1088172907 11:107018097-107018119 GACGCGAGCGGCGGCGGAGGCGG + Exonic
1088522272 11:110712482-110712504 GGCGCCCGGAGCGGAGGGGGCGG - Intronic
1088604077 11:111512404-111512426 GGCGCGAGACGGGGCGGGTGGGG - Intergenic
1088630072 11:111766162-111766184 GGCCTGCGTCGCGGTGGGGGTGG - Intronic
1088764384 11:112962006-112962028 GGCGGGCGGCGGGGCGGGGGAGG + Intronic
1089242976 11:117097992-117098014 GGAGCCAGCCGCGGCGGGGCGGG - Intronic
1089432713 11:118436692-118436714 GGCGGCCGCGGCGGCGGCGGCGG + Exonic
1089520044 11:119057248-119057270 TACGCGCGCCGGGGCGGCGGGGG - Intergenic
1089533853 11:119149214-119149236 GGCCCGGGCCGGGGCGGGGCCGG - Exonic
1089993426 11:122882896-122882918 GGCCCGGGCGGCGGCGGCGGCGG + Exonic
1090699331 11:129279691-129279713 CGCGCGCGCGGCCGAGGGGGCGG + Intergenic
1091233413 11:134002943-134002965 GGCGCTCGTCGGGGAGGGGGTGG + Intergenic
1091498273 12:991154-991176 GCTGCGCCCCGCGGCGGGGCTGG + Intronic
1091616196 12:2052911-2052933 GGCGCGGGCAGGGGCGGGCGCGG + Intronic
1091616224 12:2053030-2053052 GGCGCTCGGCGCGGCGCGGCGGG + Intronic
1091778753 12:3200822-3200844 GGCGCGGGCTGCGGGGGGGCCGG - Intronic
1092219123 12:6700759-6700781 GGGGCGCGGGGCGGCGGCGGTGG + Intronic
1092256236 12:6928064-6928086 GCCGGGCGGCGCGGCGGGGGCGG + Intronic
1093464840 12:19439368-19439390 TGCAGGCGCCGGGGCGGGGGCGG + Intronic
1093894667 12:24562715-24562737 GGCGCCCGCCCCGGGGGGTGCGG + Intergenic
1093958792 12:25250904-25250926 GGCGGCGGCCGCGGCGGCGGAGG - Intronic
1094041108 12:26122614-26122636 GGGGGGCGGCGCGGCGGCGGCGG - Exonic
1095261663 12:40105624-40105646 GGCGCGGGCGGCGGCGGCGTCGG - Exonic
1095440799 12:42237798-42237820 GGCGGGGGGCGGGGCGGGGGCGG - Intronic
1095810989 12:46372922-46372944 GGCGCGGGCCGCAGAGGGAGGGG - Intergenic
1095875951 12:47079990-47080012 GGCGCGCGATGCGGAGGGGGCGG + Intronic
1096078489 12:48818889-48818911 GGAGCGAGCGGCGCCGGGGGCGG - Exonic
1096336941 12:50764052-50764074 GGCGGGGGCGGGGGCGGGGGAGG - Intronic
1096396472 12:51270070-51270092 GGAGCGCGCTGCGCTGGGGGCGG + Intronic
1096491414 12:52015017-52015039 TGCGCGGGCCCTGGCGGGGGCGG + Exonic
1096647593 12:53047190-53047212 GGCGCGGGGCGCGGCGGGGGCGG + Intronic
1096741256 12:53695660-53695682 AGGGCGCGCTGGGGCGGGGGCGG + Intergenic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096863834 12:54549599-54549621 GCAGCGCGCGGCGGCGGCGGCGG + Exonic
1098275658 12:68808709-68808731 GGCTCTCGCGGCGGTGGGGGTGG + Intronic
1099713719 12:86264453-86264475 GACGCGGGCTGCAGCGGGGGAGG + Intronic
1099989761 12:89709306-89709328 GGCGCGAGCTTCGGCGGCGGTGG - Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1100869411 12:98894902-98894924 GGCACGCGCCGCGCGGGGGGCGG - Intronic
1100869417 12:98894923-98894945 GGCGCGCGGCGGGGGGTGGGGGG - Intronic
1100978086 12:100142822-100142844 GGCGCCCGCGGCGGCCGTGGCGG - Exonic
1101605889 12:106247631-106247653 GGCGGCCACCGCGGCGGCGGCGG - Exonic
1101606006 12:106248039-106248061 GGTCGGCGCCGCGGCGGCGGAGG - Intronic
1101640132 12:106581637-106581659 CCGGCGGGCCGCGGCGGGGGCGG - Intronic
1101640625 12:106583797-106583819 GGAACGCCCCGAGGCGGGGGAGG + Intronic
1101705976 12:107221619-107221641 GGCGGGCGGCGGGGCGGCGGGGG + Intergenic
1102370950 12:112382095-112382117 GGCGGCCGCGGCGGCGGCGGCGG - Intronic
1102636218 12:114326608-114326630 GGCGGGGGCGGGGGCGGGGGTGG - Intergenic
1102853962 12:116277522-116277544 TTCGCGCTCCGCGGCGGCGGCGG - Intergenic
1103563277 12:121803682-121803704 GACGCACGCCGCGGCGGTCGCGG + Intergenic
1103604718 12:122078431-122078453 GGCGCGGAGCGGGGCGGGGGCGG + Intergenic
1103604792 12:122078726-122078748 AGCGCGCGGCGCGGCGGGAGGGG - Exonic
1103764499 12:123271169-123271191 GGCCCGGGCCGCGCCGGGAGCGG - Intronic
1103954254 12:124567592-124567614 GGCGGCCGCGGCGGCGGTGGCGG + Intergenic
1103954291 12:124567703-124567725 GGGGCGCGTCGCTGCGGGCGGGG - Intergenic
1104270790 12:127280735-127280757 GGCGCGCGCGGCAGGGGGGCAGG + Intergenic
1104376169 12:128267073-128267095 GTCGCGGGGCTCGGCGGGGGCGG + Intergenic
1104376182 12:128267096-128267118 GGCCCGGGCGGGGGCGGGGGCGG + Intergenic
1104739932 12:131164788-131164810 GGTGCGGCCCGCGGCGGGGCTGG - Intergenic
1104792547 12:131493177-131493199 GGTGCGGCCCGCGGCGGGGCTGG + Intergenic
1104961466 12:132490285-132490307 GGGGCGCGCCCCCGGGGGGGCGG + Exonic
1104987416 12:132604679-132604701 GGTGCGTGCAGGGGCGGGGGTGG - Intronic
1105767897 13:23579276-23579298 GGCGAGAGCCGCGGTGAGGGCGG + Intronic
1105768065 13:23579879-23579901 GGCGGGCGCCGGGGCCGGGTCGG - Intronic
1106187859 13:27424822-27424844 AGCGCGGGGCGCGGCGGGGTCGG - Exonic
1106269487 13:28139105-28139127 GGGGCGGGCCGCGGCGGCGGAGG + Intronic
1106340099 13:28819765-28819787 GGCGGGAGCTGGGGCGGGGGCGG + Intergenic
1106478033 13:30114809-30114831 GGCGGCGGCGGCGGCGGGGGTGG + Intergenic
1106510510 13:30408648-30408670 TGCGCGCGCTGCGGCAGGCGCGG + Intergenic
1106516974 13:30464814-30464836 TGCGGGCGCGGCGGCGGCGGCGG + Intronic
1106517119 13:30465265-30465287 GCGGGGCGCCGCGGCGGGCGAGG - Intronic
1106517123 13:30465282-30465304 GGCGGGCGGCGGGGCGGGCGGGG - Intronic
1106602568 13:31200259-31200281 GACGCGCGCGCCGGCGGGGCAGG - Intronic
1107133503 13:36920314-36920336 AGAGCGCGCGGCGGCGGGCGGGG - Intronic
1107467545 13:40664819-40664841 GGCGCGGGCGGTGGCGGTGGCGG - Intronic
1107468027 13:40666652-40666674 CGCGCGCGCCGCCGCGGGCGGGG - Intergenic
1107468029 13:40666654-40666676 GGCGCGCGCGCCGCCGCGGGCGG - Intergenic
1108408300 13:50125419-50125441 GGCGCGGGCCCCGCCGAGGGGGG - Intronic
1108408315 13:50125455-50125477 GGGGAGCGCTGCGCCGGGGGAGG - Intronic
1108521617 13:51251618-51251640 GGCGGGCGTCCCGGCGGCGGCGG + Exonic
1110119609 13:71865797-71865819 GCCGCGCGCCCCGGCGAGCGCGG - Intronic
1110318203 13:74134291-74134313 GGCGGGGGCGGCGGCGGGGAGGG + Intergenic
1110450725 13:75635904-75635926 GCCGCGCTCCCCAGCGGGGGAGG + Intronic
1110706022 13:78602488-78602510 GGCGCGGGCCGAGGCGCTGGCGG - Exonic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112461443 13:99606722-99606744 GGCGCGCGGAGCTGCGGCGGCGG + Exonic
1112507853 13:99985569-99985591 GGCGGGGGCGGCGGCGGGGCGGG + Exonic
1113312033 13:109140995-109141017 GGCGGGGGCGGGGGCGGGGGCGG - Exonic
1113312039 13:109141001-109141023 GGCCCGGGCGGGGGCGGGGGCGG - Exonic
1113494022 13:110713929-110713951 GGCGCGGGCCGCGGTGGCGGTGG - Intronic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1113655916 13:112067737-112067759 GGGGCGGGCGGCGGCGGGGGCGG + Exonic
1113655922 13:112067749-112067771 GGCGGGGGCGGAGGCGGGGGCGG + Exonic
1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1113656103 13:112068506-112068528 GCCGCCCGCAGCGGCGGCGGCGG - Exonic
1113737582 13:112689769-112689791 GGCGCTGGGCGCGGCGGGGAAGG - Intergenic
1113768328 13:112894296-112894318 GGGGCGGGGCGGGGCGGGGGCGG - Intergenic
1113779723 13:112969177-112969199 GGCGCGCGCTGCGCCGCGGGGGG - Intronic
1113820231 13:113208561-113208583 GGAGCGCGCGGCGGCGTGGTTGG - Intronic
1113820668 13:113209893-113209915 GGCGCCGGCCGGGTCGGGGGTGG + Intronic
1113830544 13:113292210-113292232 GGCGTGGGCGGCAGCGGGGGCGG - Intergenic
1114265349 14:21070166-21070188 GTCCCGCGCGGAGGCGGGGGCGG + Intronic
1114270678 14:21098333-21098355 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1114270713 14:21098434-21098456 GGCGGGGGCCGGGCCGGGGGCGG - Exonic
1114270765 14:21098530-21098552 GGGGGGCGGCGCGGCGGGGCTGG + Exonic
1114485169 14:23057653-23057675 GGCCCGCGCGGCGGGGGCGGGGG + Intergenic
1114669040 14:24399123-24399145 GGGGCGCGCCGCGGGGAGGAGGG + Intronic
1115028413 14:28767529-28767551 GGGGCGCCCCGCGTCTGGGGGGG - Exonic
1115474564 14:33800597-33800619 GGCGGGGGCGGGGGCGGGGGCGG + Exonic
1115474570 14:33800609-33800631 GGCGGGGGCGGCGGCGCGGGGGG + Exonic
1115651166 14:35403982-35404004 GGCGCCCGCCGGGGCCGCGGGGG - Intronic
1115761662 14:36582651-36582673 GGTGCGGGGCGGGGCGGGGGCGG - Intergenic
1115851783 14:37595136-37595158 GGCGTGCGCGGCGGCGGCGGCGG + Intronic
1116835743 14:49767992-49768014 GGCGCGGGCAGAGGCGGCGGCGG + Exonic
1116861793 14:50001336-50001358 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1117302296 14:54441435-54441457 GGCTGGCGCCGCGGCGGTAGCGG - Intergenic
1117675606 14:58152145-58152167 GGCGGGCCCTGCGGCGGCGGCGG + Exonic
1117875928 14:60249722-60249744 GGCCTGCGCGGCGGCGGCGGCGG + Intronic
1118206370 14:63727628-63727650 CCCGCGCGCCGCGGCGAGGCCGG + Exonic
1118607675 14:67515340-67515362 GGCGTCCGCCGCGGCGGCGCGGG + Intronic
1118748537 14:68790865-68790887 GTCGCGGGCGGTGGCGGGGGCGG - Intronic
1118797016 14:69152986-69153008 GGCGCGAGCGGCGGCGGCGGCGG - Exonic
1118992604 14:70809612-70809634 GGCGCGGGGCGGGGCGGGCGTGG - Intergenic
1119004159 14:70908430-70908452 GACGAGGGCCGCGGCGGGGGCGG - Intronic
1119223281 14:72926210-72926232 GGCGCACGCGGGGGCGGGGCCGG - Intergenic
1119240903 14:73058817-73058839 GGGGAGCGCGGAGGCGGGGGTGG + Intronic
1119325908 14:73759518-73759540 GGCGCGGACCGCGGGGGAGGGGG + Intronic
1119539173 14:75427822-75427844 GGCGCCCAAGGCGGCGGGGGAGG + Intronic
1119602488 14:75985939-75985961 GCCTCGCGCCGCGCCGGGTGAGG + Intronic
1120167865 14:81220274-81220296 GGCTCGCGGCGCGGGGAGGGCGG - Intronic
1120190555 14:81436223-81436245 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1121050442 14:90816337-90816359 AGGGGGCGCCGCGGCGGCGGCGG - Exonic
1121417508 14:93789096-93789118 GGCGCTGGCGGCGGCGGCGGGGG - Intergenic
1122088032 14:99320535-99320557 GGGGCGGGGCGGGGCGGGGGTGG + Intergenic
1122131278 14:99605373-99605395 GGGGCGGGGCGGGGCGGGGGGGG + Intergenic
1122137857 14:99645130-99645152 GGCGCTCGCGGCGGCAGGGAAGG - Exonic
1122143375 14:99675235-99675257 GCGGCGGGCGGCGGCGGGGGCGG + Exonic
1122145077 14:99684169-99684191 GGGGCGGGGCGGGGCGGGGGAGG + Intergenic
1122162295 14:99793296-99793318 GGCTCGCGCGGCTGCGGCGGCGG + Intronic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122221084 14:100239413-100239435 GGCGACCACGGCGGCGGGGGCGG + Exonic
1122270766 14:100567682-100567704 GGCCCGGGCCGCTGCGGCGGGGG - Intronic
1122300136 14:100726836-100726858 GGCGGGGGCCGCGAGGGGGGAGG + Exonic
1122602885 14:102930106-102930128 GGGGCGAGGCGCGGCGGGGCGGG - Intronic
1122620720 14:103056570-103056592 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1122666723 14:103334846-103334868 CGCGCGCTCTGGGGCGGGGGCGG + Intronic
1122736755 14:103847757-103847779 CGCGCTCCCGGCGGCGGGGGAGG + Intergenic
1122779155 14:104136364-104136386 GGTGCGGGGCGCGGCGGCGGCGG + Intergenic
1122881820 14:104693706-104693728 GGCCCTCGCCGGGTCGGGGGTGG + Intronic
1122905696 14:104800596-104800618 GCAGCGCGCCCCGGCGGGGAGGG - Intronic
1122947842 14:105021292-105021314 GCCGGGCGCAGGGGCGGGGGCGG - Intergenic
1122975053 14:105167628-105167650 CGCGCGCGCCCAGGCGGGGCGGG - Intronic
1122975255 14:105168333-105168355 GGTGAGCGGGGCGGCGGGGGCGG - Exonic
1122993302 14:105248988-105249010 GGCGCGGGCGGCGGCGGCGCTGG - Exonic
1123036595 14:105474353-105474375 CGCGCGCGGCGGGGTGGGGGTGG + Intronic
1123037996 14:105479081-105479103 GCCGAGCCCCGGGGCGGGGGCGG - Intronic
1123041294 14:105491324-105491346 GCCCCGGGCCGCGGCGGAGGCGG + Exonic
1123630803 15:22258324-22258346 GGGGCGCGGCGCGGCGCGGGCGG + Intergenic
1123898055 15:24848217-24848239 GGCGGGGGCGGCGGTGGGGGCGG + Intronic
1123898065 15:24848235-24848257 GGCGGGGGCGGCGGCGGGGGCGG + Intronic
1123898073 15:24848247-24848269 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1124109483 15:26773048-26773070 GGCCAGCGCGGCGGCGGCGGCGG - Exonic
1124109564 15:26773268-26773290 GGCGGCCGCCGAGGCGGGAGGGG - Intronic
1124142286 15:27088248-27088270 GGCGGGCGCGGGGGCGGGCGCGG + Intronic
1124142292 15:27088260-27088282 GGCGGGCGCGGGGGCGGGCGCGG + Intronic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1124453622 15:29821792-29821814 GGCGCGGGCCGCACTGGGGGCGG - Intronic
1124453872 15:29822554-29822576 GGGCGGGGCCGCGGCGGGGGAGG + Intronic
1124640360 15:31392817-31392839 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1124640364 15:31392823-31392845 GTCGCGGGCGGGGGCGGGGGCGG - Intronic
1124652326 15:31483271-31483293 GCGGCGCGGCGCGGCGCGGGCGG - Exonic
1124957227 15:34367322-34367344 TGCGGGCGCCGCGGCGGGCGCGG - Intergenic
1125536153 15:40441863-40441885 GGGCCGCGCCGGGCCGGGGGCGG + Intronic
1125728927 15:41882214-41882236 GGGGCCCGGCGAGGCGGGGGTGG - Intronic
1126113374 15:45187973-45187995 GGGGAGCGCAGCGGCGGGTGGGG + Intronic
1126766910 15:52019074-52019096 TGCGCGCGCCGCGGAGGCGGTGG - Intronic
1126766997 15:52019425-52019447 GGAGGGCGCCGCGGCGGGCCCGG + Intronic
1126767002 15:52019437-52019459 GGCGGGCCCGGCGGCGGCGGCGG + Intronic
1127103320 15:55588502-55588524 GGAGCGCGAGGCGGCGGCGGTGG - Intronic
1127165767 15:56243791-56243813 GGAGCGAGCGGCGGCGGCGGCGG - Intergenic
1128067850 15:64775583-64775605 CGAGTGCGCCGCGGCGGCGGCGG + Exonic
1128078239 15:64841639-64841661 GGAGGGGGCTGCGGCGGGGGAGG - Intergenic
1128321994 15:66701083-66701105 GCGGGGCGCCGCGCCGGGGGTGG + Intergenic
1129082349 15:73052301-73052323 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1129150283 15:73684187-73684209 GGGGCGGGGCGGGGCGGGGGCGG + Intronic
1129267964 15:74404094-74404116 GGCGCGGGCGGCTGTGGGGGAGG + Intergenic
1129274057 15:74433871-74433893 GGCGCGCGGTGCGCTGGGGGCGG + Exonic
1129330875 15:74826545-74826567 GGGGCGGGCCCGGGCGGGGGCGG + Exonic
1129468494 15:75737681-75737703 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1129675996 15:77632679-77632701 GGCGCGCTCCGCCGCGGGGCCGG + Intronic
1129710716 15:77819172-77819194 CGCGCGCGCCGCGCCGCCGGCGG + Intronic
1129983561 15:79896742-79896764 TGCGCGCGCCGGGGGGTGGGGGG + Intronic
1130224400 15:82046250-82046272 GGCGCGCGCCAGGCCGGGGGCGG + Intergenic
1130224434 15:82046365-82046387 GGCGTTAGCGGCGGCGGGGGAGG - Intergenic
1130362964 15:83207692-83207714 AGCGCGCGCGGCGGCGGCGGCGG - Exonic
1130564497 15:84981974-84981996 TGCGGGCGCTGCGGCGGCGGCGG - Exonic
1131060285 15:89400148-89400170 GGGGCGCGGCGGGGCGGGGCGGG - Intergenic
1131060332 15:89400252-89400274 GGCTCGGGCCGGGGAGGGGGTGG + Intergenic
1131094810 15:89648492-89648514 GGCGGCCGCCGCGGAGGCGGTGG + Exonic
1131117869 15:89805592-89805614 GGCTCCCGGCGAGGCGGGGGTGG - Intronic
1131268960 15:90935167-90935189 GGAGCGCGCCCGGGCAGGGGCGG - Intronic
1131367662 15:91853707-91853729 GGCGATCGCGGCGGCGGCGGCGG + Exonic
1131475385 15:92734218-92734240 GGCGCGCGGCGGGGCGGAGGCGG - Intronic
1131517580 15:93089247-93089269 GCCGCGCTCGGCGGCGGGCGGGG - Intergenic
1132055673 15:98648976-98648998 GGAGCTCGCCGCGGCGGCGGCGG + Exonic
1132365155 15:101251658-101251680 GGCGCAGGCCGCGGCGGCGGGGG - Exonic
1132453627 16:10570-10592 GGCGCGCGCCGCGCCGGCGCAGG + Intergenic
1132453634 16:10599-10621 GGGGCGCGCCGCGCCGGCGCAGG + Intergenic
1132480701 16:164941-164963 GGCGCGGGGCGGGGCGGGGCGGG + Intronic
1132569116 16:636322-636344 GGCGCGGGTCGCGTCGGGGGCGG + Intronic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1132586001 16:705965-705987 GCCGCGCGCGGGGGCCGGGGCGG - Intronic
1132588107 16:715017-715039 GGCGCGGGGCGGAGCGGGGGCGG - Intronic
1132663760 16:1072719-1072741 GGGGCGGGGCGGGGCGGGGGCGG - Intergenic
1132719662 16:1309521-1309543 GGAGCGCTCGGCGGCGCGGGAGG + Intronic
1132724674 16:1333610-1333632 GGCGGACGCCGCTGCGGGGGCGG - Intronic
1132834053 16:1943495-1943517 GGCGCGAGGGGCGGCAGGGGCGG - Intergenic
1132885097 16:2179027-2179049 GGCGGGGGGCGCGGCGGCGGCGG + Exonic
1132885098 16:2179030-2179052 GGGGGGCGCGGCGGCGGCGGCGG + Exonic
1132889387 16:2196517-2196539 GGCGGGGGAGGCGGCGGGGGAGG - Exonic
1132889425 16:2196594-2196616 GGCTCCCGGCGCGGAGGGGGCGG + Intergenic
1132947170 16:2538068-2538090 GCCGCGCAGCGCTGCGGGGGAGG + Exonic
1132978346 16:2721383-2721405 GGCGCGGGGCGCGGCGCGGGCGG + Intergenic
1133053874 16:3135115-3135137 GGCGGGGGCCGGGGCGGGGACGG + Exonic
1133197898 16:4184001-4184023 GGCGCGCAGCCCGGAGGGGGCGG + Intergenic
1133220172 16:4316285-4316307 GGACCGGGCCGGGGCGGGGGGGG + Intronic
1133232099 16:4371784-4371806 CGGGCCCGCCGCGGCAGGGGCGG - Intronic
1133325034 16:4937086-4937108 GGCGCGCACCGAGGGGCGGGCGG + Exonic
1133784176 16:8962792-8962814 GGCGAGCCCCGCGCCCGGGGAGG + Intronic
1133784415 16:8963574-8963596 GGCGGGCCCCGCGGCGGCGGCGG - Intronic
1133784570 16:8964053-8964075 GGGGCGCGGCGCTGCGGGGCAGG - Intronic
1134134085 16:11668421-11668443 GCCCCGCGCTGCGGCGGGCGGGG - Exonic
1134134169 16:11668628-11668650 GGCGCGCGCGGCGGCGGGGCCGG + Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134419305 16:14071269-14071291 CGCGCGCGCCGCGGGGAGGAGGG + Intergenic
1134419322 16:14071335-14071357 GGCGGGAGCGGCGGCGGCGGCGG + Intronic
1134482312 16:14630288-14630310 CGCCTGCGCGGCGGCGGGGGCGG + Intronic
1134656078 16:15949514-15949536 AGCGGGCGCCGGGGCGGGGCGGG + Intergenic
1134849715 16:17470394-17470416 CTCGCGCCCCGCGGCGAGGGAGG - Intronic
1135342927 16:21664237-21664259 GGCGCGCGCGGGGGCCTGGGCGG + Intergenic
1135572280 16:23558029-23558051 GGCTGAAGCCGCGGCGGGGGCGG + Exonic
1135821872 16:25692323-25692345 GGCGGCGGCGGCGGCGGGGGCGG + Exonic
1136110798 16:28062899-28062921 GGCGCGCGCCGTTCCGGGGCCGG - Intronic
1136110896 16:28063209-28063231 GGCGGCGGCGGCGGCGGGGGCGG + Exonic
1136247723 16:28985094-28985116 GGCGGGCGCCGAGGAGGGGCAGG + Intronic
1136365177 16:29806411-29806433 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1136399875 16:30011444-30011466 GCCGCGCGCGCGGGCGGGGGCGG - Intronic
1136414813 16:30096436-30096458 GGCCCGCGCAGGGGCGGGGTCGG + Intronic
1136454029 16:30370296-30370318 GGCGCGCGCCGGGGGCGGAGCGG + Intergenic
1136517360 16:30775952-30775974 AGCGCGGGCCGCGGCAGGGGAGG + Exonic
1136546521 16:30957982-30958004 TGCGCGCGCCGGGGAGGTGGTGG + Intronic
1137300528 16:47144025-47144047 GGCGCGGGGCGGGGCGGGGCGGG - Intergenic
1137454812 16:48610090-48610112 GGCGGGCGGCGGGGCGCGGGCGG - Exonic
1137618011 16:49858231-49858253 GGCGGGCGCCGCGGCCCGGCCGG - Intergenic
1137655128 16:50153136-50153158 GCTGCGCGGCGCAGCGGGGGCGG + Intronic
1138016708 16:53434848-53434870 GGCGCGCGACGCGGCTCGGAAGG - Intronic
1138178598 16:54928379-54928401 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1138178602 16:54928385-54928407 GGCGGGGGCGGGGGCGGGGGTGG + Intergenic
1138426050 16:56932544-56932566 GGCGCCCGCGTCGGCGGGGCAGG - Intronic
1138478290 16:57284717-57284739 GGCGGCCCCGGCGGCGGGGGCGG - Intergenic
1138619266 16:58198239-58198261 GGGGCGTGCCGGGGCGGGGCCGG - Intergenic
1139534418 16:67562695-67562717 AGCGGGCGCCGCGGGGGGTGTGG + Exonic
1139633656 16:68245357-68245379 GGCTCTCGCCTAGGCGGGGGCGG - Exonic
1139954318 16:70685994-70686016 GGCGGGCGGCGCGGGGGGCGCGG + Exonic
1140033849 16:71358606-71358628 GGGGCGCGGCGCGGCGGGGGCGG - Intergenic
1140458129 16:75116280-75116302 GGGGCGGGGCGCGGCGGGGCGGG + Intronic
1141054528 16:80803719-80803741 GGGGCGCGCCGCGGCCGGCGGGG - Intronic
1141132333 16:81444896-81444918 GGCGGGCGCCGGGGTGGGGGCGG - Intergenic
1141164468 16:81651259-81651281 GGCGGGAGCCCGGGCGGGGGTGG + Intronic
1141538468 16:84699951-84699973 GCCGCGCGCCGCGGGGCGCGGGG - Intergenic
1141665295 16:85462686-85462708 CGGGGGCGCCGCGGCGCGGGAGG + Intergenic
1141831166 16:86510612-86510634 GGCGGCGGCGGCGGCGGGGGAGG + Exonic
1141839254 16:86564090-86564112 GGAGCGCAGCGCGGTGGGGGCGG + Intergenic
1141840026 16:86568246-86568268 GGCGGGCGGCGCGGCGGCGTAGG - Exonic
1141972239 16:87492243-87492265 GGGTCGCGGCGCGGCGCGGGCGG - Intergenic
1141972314 16:87492388-87492410 GGCGGGCGCCGGGGCGGGGGCGG + Intergenic
1141989560 16:87602417-87602439 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1141989604 16:87602549-87602571 GGCTCGGGCGGCGGCGGCGGCGG - Intronic
1142136328 16:88453503-88453525 GGCGCGGGCCGGGGCGGCCGCGG + Exonic
1142226755 16:88881328-88881350 GGGCCGGGCCGCGGCGGGAGCGG + Exonic
1142352734 16:89587333-89587355 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1142395275 16:89828379-89828401 GGGGCGGGGCGCGGAGGGGGAGG - Intronic
1142467393 17:144072-144094 GGCGGGCGGGGCGGCGGGCGGGG + Intergenic
1142467399 17:144084-144106 GGCGGGCGGGGCGGCGGGCGGGG + Intergenic
1142611012 17:1109240-1109262 GACGCGCGAGGCGGCGGCGGCGG - Intronic
1142656755 17:1399746-1399768 GGCGAGTCCCGGGGCGGGGGAGG - Intronic
1142810492 17:2393574-2393596 GGCCCGCGCCGCAGCGTGGACGG + Intronic
1142848137 17:2691943-2691965 GGGGCGTGGCGGGGCGGGGGCGG - Intronic
1143016451 17:3893287-3893309 GGCCCACGCCGCGGCCGGGAGGG - Intronic
1143063356 17:4222212-4222234 GGTCCGCGGGGCGGCGGGGGCGG - Intronic
1143099870 17:4499077-4499099 GGCGGGCGGCGCGGAGGAGGAGG + Exonic
1143321376 17:6070887-6070909 GGCGCTCGGCGCGGCCGGGATGG + Intronic
1143400759 17:6640611-6640633 GGCTCGGGCCGGGGCTGGGGGGG - Intronic
1143575015 17:7787083-7787105 GGCGTGGGCCGGGGCTGGGGAGG + Intronic
1143590781 17:7885056-7885078 GGCGGGGGCGGCGGCGGCGGGGG - Exonic
1143590875 17:7885302-7885324 GGCGGCGGCGGCGGCGGGGGAGG - Intronic
1144742393 17:17591390-17591412 GGGGCGTGGCGTGGCGGGGGTGG - Intronic
1144756172 17:17681800-17681822 AGCGAGCGCCGGGGCGCGGGGGG + Intronic
1144758565 17:17694620-17694642 GGTGGGCGCCGCGGGCGGGGAGG - Intronic
1144828768 17:18120730-18120752 GGCGCGGGCTGTGGCGCGGGCGG - Exonic
1145018878 17:19415141-19415163 GGGGCGCGCCGTGGCCAGGGGGG + Exonic
1145750833 17:27353981-27354003 GGCCCGGGCCGTGGCTGGGGAGG - Intergenic
1146062212 17:29613361-29613383 GGCTGGCGCTGCGGCGTGGGCGG - Exonic
1146271374 17:31487969-31487991 GCCTCGCGCCGGGGCGGGGCGGG - Intronic
1146439026 17:32877244-32877266 GGCCAGGGCCGCGGCTGGGGCGG - Intergenic
1146896537 17:36545434-36545456 GGAGCGCGGCGCGAGGGGGGCGG + Intronic
1147168695 17:38606040-38606062 GCCGCCCGGGGCGGCGGGGGCGG + Intergenic
1147261034 17:39209959-39209981 GGCGAGCGCGGCGGCGGGAGGGG + Intergenic
1147661924 17:42121307-42121329 GCCGCTCTCCGCTGCGGGGGAGG - Exonic
1147719818 17:42532151-42532173 GTCGCGCGCCGAGGCTCGGGGGG + Intergenic
1147720384 17:42536284-42536306 GGCGGTGGCCGCGGCGGTGGGGG + Exonic
1147743153 17:42680005-42680027 GGCGAGCGCCGTGGCGCAGGTGG - Exonic
1147758940 17:42785221-42785243 GCCGCGGGCCGCGGCGGGCTCGG + Intronic
1147774330 17:42889939-42889961 GGCGGGCGGCGGGGAGGGGGCGG + Intergenic
1147907551 17:43832916-43832938 GGCGCGCGGCGGGGCGGGCGCGG + Intronic
1147907593 17:43833047-43833069 GCTGGGCGCCGCGGCGGGAGGGG - Intronic
1147996762 17:44363818-44363840 AGCGGGCGCCGCAGCGGGAGCGG - Exonic
1148095681 17:45051496-45051518 GCCGGGCGCCGGGGAGGGGGCGG - Intronic
1148323762 17:46771880-46771902 GGCGGGGGCAGGGGCGGGGGCGG - Intronic
1148685354 17:49497577-49497599 GCCGCGCGCCGAGGCGGAGGCGG - Intronic
1148698675 17:49575792-49575814 GGGGCGCGCCGCGACGGGGCGGG + Intergenic
1148786836 17:50149732-50149754 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1148818232 17:50346006-50346028 GGCGCGCGCCGGGGCGGGGCCGG - Intergenic
1148878574 17:50707722-50707744 GGAGCGGGCCGCGGCGACGGCGG - Exonic
1149599691 17:57885488-57885510 GGGGCACGCGGGGGCGGGGGAGG - Exonic
1149626356 17:58083353-58083375 GGCGCGCGCGGCGGGGGGGCGGG + Intergenic
1149994705 17:61400353-61400375 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1149994706 17:61400356-61400378 GGCGGCCGCGGCGGCGGCGGCGG + Exonic
1150217117 17:63476994-63477016 GAAGCGCGGCGGGGCGGGGGCGG + Intergenic
1150239943 17:63622918-63622940 CTCGCGCGCCGCGGCCCGGGCGG + Intronic
1150423172 17:65056604-65056626 GGGGCCCGCCGAGGCGGCGGCGG - Exonic
1150489012 17:65561700-65561722 GGGGCGGGCCGGGGCGGGGCGGG - Intronic
1150624821 17:66835086-66835108 GGCGCGAGCTGCGGCGGCGGCGG + Intergenic
1150768284 17:68020078-68020100 GGCGCGCGCCGCCGCCGCTGGGG - Intergenic
1150791966 17:68205968-68205990 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1150830312 17:68512677-68512699 GGCGCCCGCCGGGCCGGGGAGGG - Intronic
1151153804 17:72110429-72110451 TATGCGCGCGGCGGCGGGGGAGG + Intergenic
1151296905 17:73192824-73192846 GGCGGGCGCGGGCGCGGGGGCGG - Intronic
1151472337 17:74326134-74326156 GGCGGGCGCCGGGGGCGGGGCGG + Intergenic
1151559170 17:74861554-74861576 CGGGCGCGGCGGGGCGGGGGCGG + Intergenic
1151708396 17:75784995-75785017 CGCGCGCGGCGGGGGGGGGGGGG - Intronic
1151708398 17:75784997-75785019 TGCGCGCGCGGCGGGGGGGGGGG - Intronic
1151711414 17:75809085-75809107 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1151802040 17:76384490-76384512 GGCGCGGGCCGTGCCGGAGGCGG + Intronic
1152175145 17:78782314-78782336 GGGGCGCGGGGCGCCGGGGGCGG - Intergenic
1152349688 17:79777921-79777943 GGCGGGGGCGGGGGCGGGGGTGG - Intergenic
1152349801 17:79778201-79778223 GGCGGGCGCCGCGGTCGGGCTGG + Exonic
1152356750 17:79811271-79811293 TGCGCGCGCCTCGGCGGGTTGGG - Intergenic
1152362520 17:79839261-79839283 GGAGCGCGCCGGGGCGCTGGCGG + Exonic
1152362540 17:79839349-79839371 GGGGCGAGCGGCGGCGGCGGCGG - Exonic
1152396543 17:80036540-80036562 GGCGCGCGCCTCTGCGTGCGTGG + Intergenic
1152581201 17:81166266-81166288 GGGGCCCTCCGCGGCCGGGGTGG + Intergenic
1152718581 17:81911511-81911533 GGCGGGAGGCGGGGCGGGGGAGG - Intergenic
1152721882 17:81927473-81927495 TGGGGGCGGCGCGGCGGGGGCGG - Intronic
1152745752 17:82037840-82037862 TGGGCGCGCCGGGGCGGGGCGGG + Intergenic
1152748411 17:82051630-82051652 GGCGCGCGCGGGGCCGGGGCGGG + Exonic
1152758865 17:82098129-82098151 GGCGCGGGCGGCGGTGCGGGCGG + Exonic
1152924156 17:83079885-83079907 AGCGGGAGCGGCGGCGGGGGCGG - Exonic
1152924484 17:83080862-83080884 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1152924494 17:83080874-83080896 GACTCGGCCCGCGGCGGGGGCGG - Intronic
1153006277 18:500811-500833 GGCGCGGGCCGAGGGCGGGGCGG - Intergenic
1153015642 18:580328-580350 GTCCCGCGCCGCGCCGGCGGGGG + Intergenic
1153219378 18:2847958-2847980 GGGGCGCGCCCGGGCCGGGGCGG + Intronic
1153514307 18:5890701-5890723 GGCGCGCGCCGCCAGGGGGCAGG - Exonic
1153515385 18:5896129-5896151 TGCGCCCGTCCCGGCGGGGGCGG - Intergenic
1153935204 18:9914541-9914563 CGCGCGCACCGCAGCGAGGGCGG - Intronic
1153997481 18:10454685-10454707 GGCGCACGCGGCGGCCGGGGCGG + Exonic
1154202330 18:12308176-12308198 GGCGAGCGGCGGGGCGGGGGCGG + Exonic
1154241602 18:12658118-12658140 GGCGCGAGGCGGGGCGGGGCGGG - Exonic
1155199354 18:23503596-23503618 GGCGGGCGCCGCGCCCGCGGCGG - Exonic
1155392732 18:25352335-25352357 GGCGCGCGGCGCGTGGGAGGCGG - Intergenic
1155654572 18:28178002-28178024 GGCGAGGGCGGCGGCGGCGGCGG - Intergenic
1155954217 18:31943300-31943322 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1155954221 18:31943306-31943328 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1156008444 18:32470477-32470499 GGCGGCCGCCGAGGCGCGGGTGG - Intronic
1156099640 18:33578397-33578419 GGGGCGCGCGACGGCGGCGGCGG - Intergenic
1156171652 18:34493648-34493670 GGAGCCCGCCGCGGGGCGGGAGG + Intronic
1156253825 18:35376964-35376986 GGCGCGCGGCGCGGCGCGGTGGG - Intronic
1156275774 18:35581662-35581684 GCCGGGCGCGGAGGCGGGGGCGG + Intronic
1156448599 18:37254063-37254085 GGCGGGCACCGGGGCGGGGCCGG - Intronic
1156452536 18:37274841-37274863 GGCCTGCGCCTCGGCGTGGGAGG + Exonic
1156502113 18:37566509-37566531 GGCGGGCGGGGCGGCGGCGGAGG + Intergenic
1156502208 18:37566962-37566984 CGCGCTCTCCGGGGCGGGGGAGG - Intergenic
1157376986 18:47176148-47176170 GGCGCGGGCTGGGGCGGCGGCGG - Intronic
1157383934 18:47247073-47247095 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1157529555 18:48409574-48409596 GCCGCGCGGCGGGGAGGGGGCGG - Intronic
1157610123 18:48950674-48950696 GGCGCGGGCCGCGCGGGGTGGGG - Exonic
1157867053 18:51196768-51196790 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
1157867054 18:51196771-51196793 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1157867204 18:51197238-51197260 GGCGGCGGCGGCGGCGGGGGCGG + Exonic
1158150159 18:54358305-54358327 GTCGCGGGACGCGGCGGAGGGGG + Intronic
1158435998 18:57435837-57435859 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1159578272 18:70206001-70206023 AGCGGGCGCCGCGGCGGGCCCGG - Intergenic
1160100524 18:75916309-75916331 GCAGCGCGGCGCGGCGTGGGGGG + Intergenic
1160164300 18:76496155-76496177 CGGGCGCGCGGGGGCGGGGGAGG + Intronic
1160453449 18:78980171-78980193 GGCGCGCGGCGCGGGGCGCGGGG - Intergenic
1160453597 18:78980676-78980698 GGGGGGCGGCGCGGCGGCGGAGG - Intronic
1160500715 18:79400130-79400152 CGCGCGCGAGGGGGCGGGGGCGG + Intronic
1160668425 19:344493-344515 GGCGGGGGCCGGGGTGGGGGAGG - Intronic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160725022 19:614042-614064 GGCGGGTGCCCTGGCGGGGGAGG + Intronic
1160736121 19:663148-663170 GGCGGGTGCCGCGCGGGGGGCGG - Exonic
1160738809 19:676604-676626 GGGGGGCGCGGCGGCGGCGGCGG + Intronic
1160739634 19:680003-680025 CGCGCGGGCCGGGGCGGGGGGGG - Intronic
1160769132 19:822389-822411 GGCGGGCTCCGCGGAGGGGCGGG - Intergenic
1160809621 19:1007783-1007805 GGCGCGGGGTGAGGCGGGGGCGG + Intronic
1160829259 19:1095324-1095346 GGTGCGAGCGGCGGCGGCGGCGG - Exonic
1160860846 19:1236783-1236805 GGAGCAGGCCGCGGCTGGGGGGG + Intronic
1160861234 19:1237974-1237996 GGCGAGCGCAGCGGGGGCGGCGG - Exonic
1160869122 19:1269089-1269111 AGCGCGCGGCGGGGCGGGGCGGG - Intronic
1160873143 19:1286005-1286027 CGCGCGCGCGGAGGCGGGGGCGG + Intergenic
1160930589 19:1568000-1568022 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1160935522 19:1592772-1592794 GGCGCGCGCCCGGCTGGGGGCGG - Intronic
1160947995 19:1652316-1652338 GGCACGCGGCGCGTGGGGGGGGG + Exonic
1160968916 19:1758777-1758799 GGCGGGCTCCTCGGCGGGGGTGG + Intronic
1161027203 19:2042209-2042231 GGGCGGGGCCGCGGCGGGGGAGG - Intronic
1161076994 19:2290616-2290638 GCCGCGCACCTCGGCCGGGGTGG + Exonic
1161108696 19:2456602-2456624 CGCGCGCCCCGCGGTGGGCGGGG + Intronic
1161150108 19:2702875-2702897 GGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1161210407 19:3062551-3062573 CGTGCGCGCCGCCGAGGGGGGGG + Intronic
1161264780 19:3359285-3359307 CGCGCGCGCCGCGGCGAAGGTGG + Intergenic
1161265157 19:3360342-3360364 CGCGCGCGCGGCAGCGGGGCCGG - Intronic
1161337562 19:3722561-3722583 GGGGTGCGCCGTGGCGGGGGCGG + Intronic
1161347368 19:3775026-3775048 GGCGTGAGGCGCGGCGGGGGGGG + Intergenic
1161400655 19:4065355-4065377 GCCGCGCGCTGCGGCCGGGGCGG - Intronic
1161560372 19:4969473-4969495 GGCGCGCCCAGGGGCGGGAGCGG + Intronic
1161802582 19:6424397-6424419 CGCGCGCGCGCAGGCGGGGGAGG - Intronic
1161959486 19:7516035-7516057 GGCGACGGCCGCGGCGGGCGCGG + Intronic
1162033162 19:7925940-7925962 GGGGCGCGCCGGGGCGGGGGCGG - Intronic
1162034673 19:7932551-7932573 GGTGCCGGCTGCGGCGGGGGAGG + Intronic
1162315493 19:9936159-9936181 GGCGGGGGTCGCAGCGGGGGAGG - Intronic
1162372957 19:10289955-10289977 TCCGCGCGGCGCGGCGGGTGGGG - Intergenic
1162435231 19:10654293-10654315 GGCGCGCGCCGGGGAGGTGCGGG - Exonic
1162770378 19:12945852-12945874 GGCGCGCGGCGCGGCGCGCCTGG + Intronic
1162778651 19:12995607-12995629 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1162914197 19:13865498-13865520 GGGGCGCGGCGGGGCGGGGCGGG + Intronic
1162954503 19:14090784-14090806 CGCGCGTGCGGCGGCGGCGGCGG - Intronic
1163085860 19:14979514-14979536 GGCGTCCGGAGCGGCGGGGGCGG + Intronic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163154468 19:15432484-15432506 GGCCCGTCCCGCGGCGGCGGTGG + Intronic
1163320567 19:16572324-16572346 GGCGCGGGCCACGGCGCGGGGGG - Exonic
1163390281 19:17026655-17026677 GGGGGGCGCCGCGCCTGGGGAGG + Exonic
1163601445 19:18251679-18251701 GGCGGGGGCGGGGGCGGGGGGGG - Intronic
1163607281 19:18281998-18282020 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1163631325 19:18419368-18419390 GGCGCGCGCGGCGGGAGGAGGGG + Exonic
1163655573 19:18543304-18543326 GGGGCGCGGCCGGGCGGGGGTGG - Intronic
1163655760 19:18543760-18543782 GGCGGGGGCTGGGGCGGGGGCGG + Intronic
1163667887 19:18611666-18611688 GGGGCGGGGCGGGGCGGGGGAGG + Intronic
1163681167 19:18683525-18683547 GGCGCGCGGCGCGGGGGCGAAGG - Intergenic
1163681275 19:18683912-18683934 GGGGGGGGGCGCGGCGGGGGCGG + Intronic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1163758507 19:19120672-19120694 GGCGGGGACCGCGGTGGGGGGGG - Intronic
1163875497 19:19864342-19864364 GGCGGGCGCGGTGGCGGGCGCGG - Intergenic
1164274217 19:23702648-23702670 GGCGGGGGCGGGGGCGGGGGGGG - Intergenic
1164594768 19:29525863-29525885 GGAGCGCTCTGGGGCGGGGGCGG + Intergenic
1164693118 19:30225702-30225724 GGGGCGCGGCGCGGTGCGGGGGG + Intergenic
1164834893 19:31350217-31350239 GGCGCGGGCCGGGGCGGGTGGGG + Intergenic
1165157744 19:33798065-33798087 GGCTGGCTCCGCGGCGGAGGCGG + Intronic
1165242898 19:34481841-34481863 GGCGCGGGGCGGGGCGGGGCCGG - Exonic
1165331506 19:35143154-35143176 GGCGGGGGCGGGGGCGGGGGTGG + Intergenic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1165420077 19:35718106-35718128 GGCGGGGGCCGCGGCGGACGGGG + Exonic
1165493915 19:36141042-36141064 GGCGGCGGCGGCGGCGGGGGAGG + Exonic
1165495825 19:36151606-36151628 GGAGCGCGCCGAGCCGGGGCAGG - Intronic
1165774355 19:38395989-38396011 AGCGCGCGGCGGGGCGCGGGTGG - Exonic
1165775798 19:38403628-38403650 CGCGCGCTCTGCGGCGGGGATGG + Exonic
1165803159 19:38565278-38565300 GGCGCGTGCGGCGGCTGCGGCGG + Exonic
1165888948 19:39099159-39099181 GGCGCGCGCAGGGACGGTGGGGG + Intronic
1165928641 19:39342540-39342562 GGCCCGAGCGGCGGCGGTGGCGG + Exonic
1165994283 19:39833391-39833413 GGCCGGCCCCGCGGCGGGGAGGG + Exonic
1166105962 19:40598204-40598226 AACCCGAGCCGCGGCGGGGGCGG + Intronic
1166306905 19:41940413-41940435 GGGGCGCGCGGCGGCGGGGGAGG - Intergenic
1166546997 19:43639801-43639823 GGAGCGAGCGGCGGCGGCGGCGG - Exonic
1166807708 19:45496998-45497020 GGTGCTCGGCTCGGCGGGGGCGG + Exonic
1166888059 19:45973455-45973477 GGCGGCGGCGGCGGCGGGGGCGG + Exonic
1166888256 19:45973956-45973978 GGCGCGGGCGGCGGCGGCGACGG + Intergenic
1166975099 19:46601260-46601282 GGCGCGCGCGGCGGCCGTTGAGG + Exonic
1166984043 19:46649243-46649265 GGCGGGCGGCGCGGCCAGGGAGG + Exonic
1167040604 19:47020778-47020800 GGCGGGCGGCGCGGGGGAGGCGG + Intronic
1167072726 19:47230404-47230426 GGCGCACGTGGCGGCGGTGGGGG - Intronic
1167258105 19:48443024-48443046 GGCGGTGGCCGCGGCGGCGGGGG - Exonic
1167269371 19:48498879-48498901 GGGGGGGGCCGAGGCGGGGGGGG + Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167456152 19:49597465-49597487 GGCGCGGGAGGCGGCGGTGGCGG - Exonic
1167488286 19:49776194-49776216 GATGCGGGCGGCGGCGGGGGCGG - Intronic
1167613480 19:50518304-50518326 GGCACCGGCAGCGGCGGGGGCGG - Exonic
1167633491 19:50639823-50639845 GGCGCGCGGGGCTGCGGCGGCGG - Intronic
1167643700 19:50695081-50695103 GGCGGCGGCGGCGGCGGGGGCGG - Intronic
1167649081 19:50719734-50719756 GGAGCGGGCGGCGGCGGCGGCGG - Intergenic
1167738687 19:51311716-51311738 GGCCCGGGGGGCGGCGGGGGCGG - Intergenic
1167862492 19:52297053-52297075 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862496 19:52297059-52297081 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862500 19:52297065-52297087 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862504 19:52297071-52297093 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862508 19:52297077-52297099 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862512 19:52297083-52297105 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862516 19:52297089-52297111 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862520 19:52297095-52297117 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862524 19:52297101-52297123 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862528 19:52297107-52297129 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862532 19:52297113-52297135 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862536 19:52297119-52297141 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1168064039 19:53909381-53909403 GCCGGGCTCCGGGGCGGGGGCGG + Exonic
1168339515 19:55615136-55615158 GGCGGCGGCCGCGGCGGCGGTGG + Exonic
1168536063 19:57171998-57172020 GCCGCGGGCCGCGAGGGGGGCGG + Intergenic
926077490 2:9952260-9952282 GGCTCGCGCCGCGTCGGGACAGG + Intronic
926268115 2:11344469-11344491 GGTCCGGGCCGCGGCGGTGGCGG - Exonic
926980193 2:18560320-18560342 CGCGCGCGCCGAGGAGGCGGCGG - Exonic
927652284 2:24920005-24920027 GGCGCGGGCGGCGGCGAGCGCGG + Intergenic
927679259 2:25129323-25129345 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
927679263 2:25129329-25129351 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
927809370 2:26173115-26173137 GGCGAGCGCCGCGGCGGCCCCGG + Exonic
927811906 2:26185101-26185123 GGCGGGCGGCGCGGCGGGCTCGG - Exonic
927964881 2:27262523-27262545 GGCAGGCGCCGCGGGGGTGGCGG + Intronic
927966882 2:27275864-27275886 GGCGGGGGCGGGGGCGGGGGTGG - Intronic
927966886 2:27275870-27275892 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
927966890 2:27275876-27275898 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
928106071 2:28471399-28471421 GGCGGGAGCCAGGGCGGGGGAGG + Intronic
928904449 2:36355664-36355686 GGCGCGCGGCGCGTGGGGGTGGG + Intergenic
928928014 2:36598016-36598038 GGCGGGGGCCGAGGCGGGTGGGG - Exonic
929133504 2:38602166-38602188 GGGTCGCGGCGCGGCGGCGGCGG - Intronic
929966739 2:46542582-46542604 GGCGCGGGCCGCGCTCGGGGAGG + Intronic
930033630 2:47072639-47072661 GGCGGGGGCCGCAGTGGGGGTGG - Intronic
930136335 2:47906506-47906528 GGCCAGCCCCGCGGCGGGGAGGG - Intergenic
931253669 2:60553281-60553303 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
931321375 2:61177378-61177400 CGGGCGCGCCGCGGCAGGGCGGG + Intergenic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
932231500 2:70087559-70087581 GGGGCGGGCGGCGGCGGCGGAGG - Exonic
932496404 2:72147860-72147882 TGTGCCGGCCGCGGCGGGGGAGG + Exonic
932607672 2:73175829-73175851 AGGGCCCGCGGCGGCGGGGGCGG + Intergenic
932621870 2:73269457-73269479 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
933684713 2:85133700-85133722 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
933741713 2:85539083-85539105 GGCGCGCGGCGCCGAGGGGCGGG + Intergenic
933985111 2:87584368-87584390 GGCGCGCGCTGCGGTCGGTGCGG - Intergenic
934079111 2:88452449-88452471 GGCGCCCGGGGCGGCGGCGGTGG + Exonic
934746149 2:96760962-96760984 GGCGCGGGGAGCGGCGGCGGCGG + Exonic
934921291 2:98347054-98347076 AGTCCGCGCCGCGCCGGGGGAGG + Intronic
934993294 2:98936257-98936279 GGTGCGCGCGGCGGCCGGCGAGG - Exonic
935112121 2:100104170-100104192 GGGGCGGGCCGCCGCGAGGGAGG + Intronic
935112220 2:100104487-100104509 GGCCCGAGCCTCGGCGGCGGCGG - Exonic
935112291 2:100104736-100104758 GGCGGGCGCAGGGCCGGGGGCGG - Intronic
935237502 2:101151100-101151122 GGGGCTCGCCGGGGCGGGCGCGG - Intronic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935592446 2:104855299-104855321 GGCGGCGGCGGCGGCGGGGGCGG + Intergenic
935592498 2:104855411-104855433 GGCGGGGGGCGCGGCGGCGGCGG + Intergenic
935592499 2:104855414-104855436 GGGGGGCGCGGCGGCGGCGGCGG + Intergenic
935592550 2:104855592-104855614 GGGGCTGGCGGCGGCGGGGGTGG + Exonic
935592560 2:104855616-104855638 GGCGGCGGCGGCGGCGGGGGCGG + Exonic
936038323 2:109129645-109129667 GGCGGCCACCGCCGCGGGGGCGG + Exonic
936122683 2:109760395-109760417 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
936122851 2:109760981-109761003 GGGGCGGGCCGCCGCGAGGGAGG - Intergenic
936126707 2:109794594-109794616 GGCGGCGGCGGCGGCGGGGGGGG + Intronic
936221837 2:110610483-110610505 GGGGCGGGCCGCCGCGAGGGAGG + Intergenic
936222010 2:110611078-110611100 GGCGGGGGCGGCGGCGGCGGCGG - Intergenic
936308730 2:111366443-111366465 GGCGCGCGCTGCGGTCGGTGCGG + Intergenic
937018934 2:118633076-118633098 GGGGCGGGGCGGGGCGGGGGCGG - Intergenic
937045133 2:118847104-118847126 GGCCCTCGGCGCGGCGGCGGCGG - Exonic
937045150 2:118847182-118847204 GGCCGGCGCGGCGGCCGGGGCGG - Exonic
937221747 2:120346071-120346093 GGCGCGGGCGCGGGCGGGGGCGG + Intergenic
937221751 2:120346077-120346099 GGCGCGGGCGGGGGCGGGGCGGG + Intergenic
937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG + Intronic
937956256 2:127423194-127423216 GGCGGGCGGCGGGGCGGGGCTGG + Intronic
938319964 2:130356064-130356086 CGCGCGCGCGGCGGCCGGGCTGG + Exonic
938368840 2:130756263-130756285 GCCGCGCGCCGCGGCCGGGAGGG - Intronic
938406244 2:131034875-131034897 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
938451424 2:131424971-131424993 GACGCGCGCCCAGGCGGCGGGGG - Intergenic
939153802 2:138501750-138501772 CGTGCGCGCGGCGGCGGCGGCGG - Intergenic
939612958 2:144332353-144332375 GGCGGGCGCCGGGGAGGGGAGGG + Intronic
939629738 2:144517102-144517124 GGCGCGCGCGGCGGCTGGACCGG - Intronic
940265138 2:151828367-151828389 GGCGAGTGCCGCGGCGGCAGCGG - Exonic
941111768 2:161424243-161424265 GGTCCGGGCCGCGGCGGGGCCGG - Exonic
941686848 2:168456326-168456348 GGCGGGAGCAGCGGCGGCGGCGG + Exonic
942446071 2:176079974-176079996 GGGGCGCCCCGGGGCGCGGGAGG - Exonic
942566056 2:177265182-177265204 GGCGCCAGCCGGGGTGGGGGGGG + Intronic
942890517 2:180981087-180981109 TCCGCGAGCCGCGGCGGGGCCGG + Intronic
943033749 2:182716014-182716036 GGCGCCTGCCGCGGGCGGGGAGG - Intergenic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
944495851 2:200306835-200306857 GGGAGGCGCCGCGGCGGTGGCGG - Intronic
944831214 2:203535334-203535356 GCAGCGCCCCGCGGCGGCGGCGG + Exonic
945102502 2:206274946-206274968 GGTGAGTGCCGCGGCGGGGGCGG + Exonic
946019855 2:216633599-216633621 GGCGCGAGTGGCGGCGGCGGCGG + Exonic
946311203 2:218883542-218883564 GGAGCGCGCGGGGGCGGGGCGGG - Intronic
946386615 2:219387813-219387835 GGCAGGCGGCGCGGTGGGGGCGG - Exonic
946921434 2:224585171-224585193 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947353636 2:229271308-229271330 CGAGCGCGCGGCGGCGGCGGGGG + Intergenic
947549784 2:231037838-231037860 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947593079 2:231395969-231395991 GGCGGGCGCGGCGGCGGCGGCGG + Intronic
947605624 2:231483603-231483625 GGCGCGCGGCGAGGCCCGGGCGG + Intronic
947741730 2:232487844-232487866 GGCGGGCGGCGCGGCGGGCTCGG - Intergenic
947872480 2:233447127-233447149 CGTGGGCACCGCGGCGGGGGAGG - Intronic
947992155 2:234496680-234496702 GGTGCGGGCGGCGGCGGGCGGGG - Exonic
948046861 2:234951948-234951970 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
948046865 2:234951954-234951976 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
948046876 2:234951966-234951988 GTCCCGCGCCTGGGCGGGGGCGG - Intronic
948115941 2:235494396-235494418 GGAGCGCGCCGCGGCGGGTGCGG - Exonic
948116034 2:235494631-235494653 GGGGCGCGGGGCGGCGGCGGCGG + Exonic
948140503 2:235669588-235669610 AACGCGCGCCGGGGCGGGGCGGG - Intronic
948202858 2:236142368-236142390 GGCAGGGGCCGGGGCGGGGGCGG - Intergenic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
948208919 2:236178269-236178291 TGCGCGCGCCGGGGCGGGAGAGG + Intergenic
948645386 2:239400898-239400920 GGCTCGGGCGGCGGCGGGGACGG + Exonic
948874729 2:240820430-240820452 GGCGGGCCCCGCGGAGGGTGGGG + Intergenic
948945675 2:241217924-241217946 GGGGCGCGCAGGGGCGGGGGCGG + Intronic
948945706 2:241217988-241218010 GGGGCGCGCAGGGGCGGGGCTGG + Intronic
948945752 2:241218077-241218099 GGGGCGCGCAGGGGCGGGGCGGG + Intronic
948945777 2:241218131-241218153 GGGGCGCGCAGGGGCGGGGCGGG + Intronic
948983973 2:241508805-241508827 GCCGCGCGCCTGGGCGGGCGGGG + Intronic
948988714 2:241541256-241541278 GGGCGGGGCCGCGGCGGGGGCGG + Intergenic
949004406 2:241637184-241637206 GGCGGGGGCTGGGGCGGGGGCGG - Exonic
949079866 2:242088462-242088484 GGGGCGCGGGGGGGCGGGGGCGG - Intergenic
1169244414 20:4014994-4015016 GGCGCGCGCCTTGGGGGGTGCGG - Intronic
1169327545 20:4687249-4687271 GCCTCGGGCCTCGGCGGGGGCGG + Intronic
1169867713 20:10218746-10218768 GGGGCGGGGCACGGCGGGGGCGG - Intergenic
1170026072 20:11891013-11891035 GGCGCGCGCCCCTGCCCGGGCGG - Intronic
1170756807 20:19212491-19212513 GGGCGGCGGCGCGGCGGGGGCGG - Intergenic
1170889711 20:20367556-20367578 GGGGCGCGCCGGGGCGGTGCGGG - Intergenic
1170890175 20:20369229-20369251 CGCGCGGGCGGCGGCGGGCGCGG - Exonic
1171346351 20:24469312-24469334 GGCGCGGGCCCCGGGGGAGGAGG - Exonic
1171977592 20:31605410-31605432 GGGGCCCGCGGCGGCGGTGGCGG - Exonic
1172037015 20:32018194-32018216 GGCGGGGGCGGGGGCGGGGGAGG + Intronic
1172073655 20:32277701-32277723 GGCGGCGGCGGCGGCGGGGGCGG - Exonic
1172109416 20:32536530-32536552 CGCGTGCGCCCCGGCGGGGAGGG + Intronic
1172277176 20:33686100-33686122 GGCGGGCGCCGCGGGGCCGGTGG + Exonic
1172331162 20:34077054-34077076 GGCGCCGGCGGCGGCGGCGGTGG + Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1172978934 20:38926673-38926695 GGAGGGCGCGGCGGCGGCGGCGG + Exonic
1173548167 20:43914869-43914891 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1173672892 20:44810365-44810387 GGCGCGCGGCGTGGTGGCGGCGG + Intergenic
1173734297 20:45348465-45348487 GGGGCGGGCCGGGGCGGGGCCGG - Intergenic
1173734305 20:45348481-45348503 TGCGGGCGGCGGGGCGGGGGCGG - Intergenic
1173807470 20:45935094-45935116 GGAGCGCGCGGCGGGGCGGGGGG + Intronic
1174133219 20:48360176-48360198 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1174317520 20:49713907-49713929 AGCGGGCGCAGCGGCGGGGGCGG + Intergenic
1174386613 20:50191338-50191360 GGCGGGCGCGGGGGCGGGCGCGG - Exonic
1174386662 20:50191520-50191542 GGCGGCGGCGGCGGCGGGGGCGG - Exonic
1174467765 20:50731007-50731029 GGCGCGAGCCCCGGCGGAGCCGG + Intergenic
1174804437 20:53593711-53593733 GGCGGGCGCCCCGGCTGGCGCGG + Intronic
1175340937 20:58228605-58228627 GCGGCGGGCGGCGGCGGGGGCGG - Exonic
1175428744 20:58888781-58888803 GGCGCGCGCCGCTGGGAGGGCGG + Intronic
1175429104 20:58890254-58890276 GGCGGCGGCCGCGGCGGCGGCGG - Intronic
1175439547 20:58981197-58981219 GCCGCGCGCCTCGGCCCGGGCGG - Exonic
1175521347 20:59604386-59604408 ACCGCGCGCCGGGGTGGGGGAGG - Intronic
1175847095 20:62064981-62065003 GGCGCGGGGGGTGGCGGGGGCGG + Exonic
1175847115 20:62065019-62065041 GGCGGGCGCGGGGGCGGCGGGGG + Exonic
1175847372 20:62065827-62065849 GGCCCGAGCGGCGGCGGCGGCGG - Intergenic
1175847477 20:62066127-62066149 CGCGGGCGCCGGGGCGGTGGCGG + Intergenic
1175856360 20:62122857-62122879 GGGGCGCCCCGGGGCGGGGAGGG - Intronic
1175873682 20:62219901-62219923 GGCGGGCGAGGCGGCGGCGGCGG - Exonic
1175873837 20:62220358-62220380 GGCGCCGGGCGGGGCGGGGGCGG - Intergenic
1176016792 20:62938101-62938123 GGCGGGGGCGGGGGCGGGGGCGG - Exonic
1176016805 20:62938119-62938141 GGTGGGGGCCGCGGCGGAGGCGG - Exonic
1176131640 20:63498940-63498962 GGCGCGCGCGGGGGCGGGTGCGG + Intronic
1176149555 20:63582869-63582891 GGCTCGTGCCGCGGAGGGTGCGG + Intergenic
1176156924 20:63626751-63626773 GGCGCGGGCGGTGGCGGGCGCGG - Intronic
1176201550 20:63863043-63863065 GACGCGGGGCGGGGCGGGGGGGG + Exonic
1176242130 20:64080036-64080058 GGGGCGGGGCGCGGCGGGCGGGG - Intergenic
1176281579 20:64316622-64316644 GGAGCGGGCAGCGGCGGCGGGGG + Intergenic
1176380724 21:6111073-6111095 GGGGCGGGCCGGGGCGGGGCCGG + Intergenic
1176548599 21:8212238-8212260 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176550155 21:8217346-8217368 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176556493 21:8256446-8256468 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176567530 21:8395273-8395295 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176569083 21:8400381-8400403 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176575432 21:8439488-8439510 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1176576997 21:8444616-8444638 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1176733542 21:10522067-10522089 GGCGGGCGCCCCGGCTGGCGCGG - Intronic
1177011058 21:15730371-15730393 GGCCCCCGCGGCGGCGGCGGCGG - Exonic
1178534905 21:33403344-33403366 GGGGCGGGACGGGGCGGGGGCGG + Exonic
1178707649 21:34888856-34888878 AGCGCGCGGCGCGGCGGCGGGGG - Intronic
1178839867 21:36130046-36130068 GGGGAGCCCCGCGGCGGGGGCGG + Intergenic
1179437168 21:41369834-41369856 GGCGGGAGCGGGGGCGGGGGCGG - Intronic
1179522472 21:41954025-41954047 GGGGCGGGGCGGGGCGGGGGCGG + Intergenic
1179603397 21:42496244-42496266 GACGCGGGACGCGGCGGTGGAGG - Exonic
1179674890 21:42974689-42974711 GGCGAGAGCGGCGGCGGCGGCGG - Intronic
1179675036 21:42975103-42975125 GGCGCGCGGCGGGGCGGGGCCGG + Intronic
1179675071 21:42975205-42975227 GGGGCGCGCGGCGGCGCAGGCGG + Intronic
1179742748 21:43427167-43427189 GGGGCGGGCCGGGGCGGGGCCGG - Intergenic
1179833559 21:44012885-44012907 GGCGCGCGGCTCAACGGGGGCGG - Intronic
1179891667 21:44338759-44338781 GGGGCGGGGCGGGGCGGGGGCGG - Intronic
1180044772 21:45300202-45300224 GGCACGCGCTGCTCCGGGGGCGG + Intergenic
1180095922 21:45555292-45555314 GGCGCAGGGGGCGGCGGGGGCGG + Intergenic
1180101824 21:45590985-45591007 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1180216065 21:46324480-46324502 GGCTGTGGCCGCGGCGGGGGCGG - Intronic
1180614966 22:17120934-17120956 GGCGGCAGACGCGGCGGGGGCGG - Exonic
1180649983 22:17369600-17369622 GGCGGGCGCCGGGCGGGGGGCGG - Exonic
1180650007 22:17369673-17369695 CGCGCGGTCCTCGGCGGGGGCGG - Exonic
1180949413 22:19714464-19714486 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1181084090 22:20431361-20431383 GGCACGCGCCGCTCCGCGGGTGG + Exonic
1181478093 22:23180835-23180857 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1181934618 22:26429606-26429628 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
1182094070 22:27614476-27614498 GGCGGGCGCCGTGGCGGTGGCGG + Intergenic
1182149513 22:28018298-28018320 TGCGCGCGCGGGGGGGGGGGCGG + Intronic
1182222971 22:28773089-28773111 GGCGCCCCTCGCGGCGGGCGCGG + Intronic
1182237000 22:28883805-28883827 GGCGCAGGCGGCGGCGGCGGCGG - Exonic
1182485350 22:30635690-30635712 GGAGCGGGCGGCGGCGGGGGAGG + Exonic
1183247227 22:36703271-36703293 GGCAGGCGCGGCGGCGGCGGCGG + Exonic
1183358930 22:37373460-37373482 GGCGGGGGCAGCGGCGGGGGCGG - Exonic
1183472422 22:38016720-38016742 GGCACGCACCGCGGGGGGAGGGG + Intronic
1183486188 22:38088895-38088917 GGCGAGCGCCCGGGCGGCGGCGG - Exonic
1183535460 22:38398394-38398416 GGCGGGCGCCCCGGCTGGCGCGG + Intronic
1183601705 22:38843893-38843915 GGCAGGCGCGGCGGCGGGGTCGG + Exonic
1183642518 22:39101148-39101170 GGCGGGGGCCGGGACGGGGGCGG - Intronic
1183683683 22:39349920-39349942 CGCGCGCGCAGGGGAGGGGGCGG + Intronic
1183691005 22:39388484-39388506 GGAGCGCGGCGGGGCGGGTGAGG + Intergenic
1183720184 22:39557896-39557918 GGCGCGGGGGGCGGCGGGCGGGG - Intergenic
1183893742 22:40951272-40951294 GGCGCGCGAGGCGGAGGTGGGGG - Intergenic
1184086917 22:42270733-42270755 GGCGGGGCGCGCGGCGGGGGCGG + Intronic
1184101559 22:42343912-42343934 GCCGTGCGCGCCGGCGGGGGAGG + Intergenic
1184236670 22:43186852-43186874 GGCACGTGCGGCGGCCGGGGTGG - Intronic
1184523847 22:45010014-45010036 GGAGCGGGCCGGGGCGGCGGGGG + Intergenic
1184562112 22:45269267-45269289 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1184562116 22:45269273-45269295 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1184562120 22:45269279-45269301 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1184767036 22:46577400-46577422 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1185055325 22:48576043-48576065 GCCGGGCGGCGCGGGGGGGGGGG - Intronic
1185055401 22:48576251-48576273 GGGGGGCGCCGCGGAGGGGGCGG - Intronic
1185278855 22:49961378-49961400 GGCACGGGCGGCGGCGGCGGCGG + Intronic
1185321288 22:50201247-50201269 GGCACGGGCCGCGGCGCGGACGG - Exonic
1185374288 22:50474956-50474978 GGTTCGCTCCGCGGCGGCGGCGG + Exonic
1185409573 22:50674759-50674781 GGCGCGCCCGGCGGGGGTGGGGG - Intergenic
1185417921 22:50720273-50720295 GGCGCGGTCTGCGGCGGGGGCGG - Intergenic
1203255048 22_KI270733v1_random:133678-133700 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203261537 22_KI270733v1_random:173621-173643 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203263104 22_KI270733v1_random:178757-178779 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
950065489 3:10108333-10108355 AGCCCGAGCCGCGGCGGGGATGG + Intergenic
950345286 3:12287790-12287812 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
950345290 3:12287796-12287818 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
950509991 3:13420288-13420310 GGCGCGCGCGCGGGCGGGAGCGG - Exonic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
951080361 3:18444925-18444947 GGAGGGGGCGGCGGCGGGGGCGG + Intronic
951907805 3:27721618-27721640 GGCGGTAGCAGCGGCGGGGGCGG - Exonic
952451882 3:33440424-33440446 GGCGAACGCCGGGGCGGGGTCGG - Intronic
952867229 3:37862121-37862143 GGGGCGCGGCGCGGGGGGCGCGG - Intronic
952889165 3:38029544-38029566 GACGGGCGGCGCGGCGGGAGGGG + Intronic
953705071 3:45225203-45225225 TGCGGGCACTGCGGCGGGGGTGG + Exonic
953705141 3:45225506-45225528 GGTGGGCGCCCCGGCGGTGGCGG + Exonic
953748716 3:45594082-45594104 AGCCCGCGCCGGGGCGGAGGGGG - Intronic
953925341 3:46979799-46979821 GGCGGGCGGCGCGGAGGAGGCGG + Exonic
954249624 3:49357993-49358015 GGAGCGGGGCGGGGCGGGGGCGG - Intronic
954539767 3:51385528-51385550 GGCGAGGGCGGGGGCGGGGGCGG + Intronic
954615638 3:51967599-51967621 GGCGCGCGGGGCGGGGCGGGCGG - Intronic
954615645 3:51967611-51967633 GGGGCGCACCGCGGCGCGCGGGG - Intronic
954717515 3:52533890-52533912 GGCGCGCCCCTCGGCCCGGGGGG + Intronic
954838927 3:53494617-53494639 GGCGTGCGGCGCGGCGCGGCGGG + Intergenic
954838928 3:53494622-53494644 GCGGCGCGGCGCGGCGGGCGCGG + Intergenic
955356587 3:58237463-58237485 GGGGCGGGGCGGGGCGGGGGCGG + Intergenic
955356595 3:58237475-58237497 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
955356599 3:58237481-58237503 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
955687410 3:61561490-61561512 GGGGCGCGCGGTGGCGGCGGGGG - Intergenic
955911537 3:63863791-63863813 GGCGTGCGCGGCGGCGGCGGCGG + Exonic
955916480 3:63912634-63912656 GCCGCGCCGCGCGGCGGCGGCGG + Exonic
956596524 3:70973236-70973258 GGGGCGGGGCGGGGCGGGGGCGG - Intronic
958718958 3:97821965-97821987 GGGGCGGGCCGCGCCGGGCGAGG + Intergenic
959398369 3:105869048-105869070 GGGGCGGGGCGGGGCGGGGGCGG + Intronic
959849824 3:111072388-111072410 GACCCGCGCGGCCGCGGGGGAGG - Intronic
960625358 3:119677009-119677031 GGGGCGGGGCGGGGCGGGGGGGG + Intronic
960664216 3:120094379-120094401 GGCCCGGGCGGCGGCGGCGGCGG + Intronic
960691366 3:120349415-120349437 TGCGCGCGCCGCTCCGGGGCGGG + Intergenic
960914370 3:122681197-122681219 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
961186247 3:124917746-124917768 GGCGGGGGCGGGGGCGGGGGAGG + Intronic
961260083 3:125595304-125595326 GGCGCGCGCAGCCGGGGAGGAGG + Intergenic
961574453 3:127823220-127823242 GGCCGGCTCGGCGGCGGGGGCGG + Intronic
961673419 3:128550605-128550627 GGGGCAAGCCGCGGAGGGGGTGG + Intergenic
961780174 3:129316437-129316459 GGGGCGCCCCGCTGCGGGCGCGG - Intergenic
961827158 3:129605267-129605289 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
961827166 3:129605279-129605301 GGCGGCGGCGGCGGCGGGGGCGG - Intronic
962222354 3:133574185-133574207 GGCGGGCGGCGGGGCGGGCGCGG + Exonic
962751120 3:138435295-138435317 GCTGCGCGCCGCGGGAGGGGCGG - Intronic
963038377 3:141051391-141051413 GGAGCGGGCGGCGGCGGCGGAGG + Exonic
963061766 3:141231920-141231942 GGCGCGGGCCTGGGCCGGGGCGG + Intronic
964622727 3:158732671-158732693 GGCCCAGGCCGCGGCGGGAGAGG + Exonic
965166224 3:165196485-165196507 GACGCTCGCGGCGGCGGCGGCGG + Intronic
965648414 3:170908602-170908624 GGCGCCGGCAGCGGCGGTGGCGG + Exonic
966182330 3:177197929-177197951 GGCCCGCGCGGTGGCCGGGGTGG + Intergenic
966712033 3:182980728-182980750 GGCGGGGGGCGCGGCGGGGGAGG + Intronic
966743393 3:183254069-183254091 GAGGCGCGGCGGGGCGGGGGCGG - Intronic
966794078 3:183697772-183697794 GGCGCGCGCGGCGGCGCGCGCGG - Intergenic
966919905 3:184604505-184604527 GGGGCGCGTCCCGGCGGGGCCGG + Intronic
967055474 3:185825521-185825543 GGCGAGCGGCGGGGCGGGGAAGG + Intergenic
967118394 3:186361916-186361938 GGCGGCCGGCGCGGCGGAGGGGG - Intronic
967859680 3:194141536-194141558 GGAGCGGGCGGCGGCGGCGGCGG + Intergenic
967924181 3:194633369-194633391 GGCGCGCTCCCGGGCGCGGGCGG + Exonic
967924186 3:194633381-194633403 GGCGCGGGCGGCGGCGGCGAAGG + Exonic
968230673 3:197003119-197003141 CGCGCGGGCCGCGCCGGAGGAGG - Exonic
968434173 4:576368-576390 GGCGCGCGGGGCCGCGGGCGGGG - Intergenic
968514769 4:1011476-1011498 GGAGCCCGGCGGGGCGGGGGCGG + Intronic
968515180 4:1012670-1012692 GGCGAGCGGGGCGGCAGGGGCGG - Intronic
968521819 4:1037620-1037642 GGCCCGGGCCGCGGTGCGGGTGG + Intergenic
968653124 4:1767749-1767771 GGCGCGGGGCGCGGGGCGGGGGG - Intergenic
968701207 4:2059097-2059119 GGCGGGGGCGGCGGCGCGGGCGG - Intergenic
968850577 4:3075024-3075046 GGCGGGGGCGGCGGCGGGGGCGG - Exonic
968879890 4:3293301-3293323 GGCGCGGGGCGGGGCGGGGCGGG + Intronic
968879893 4:3293306-3293328 GGGGCGGGGCGGGGCGGGGGCGG + Intronic
968965552 4:3767499-3767521 GGGGCGCGTTGCGGCGGGGCGGG + Exonic
969240376 4:5893114-5893136 GGCGCGCGCCGGGGCGGGGCCGG + Intergenic
969285646 4:6200457-6200479 CGCGCGCGGCTCGGCGGGGCGGG + Exonic
969379415 4:6783679-6783701 GGCGCGGGGCGCGGCGCGGGGGG + Intronic
969720956 4:8892884-8892906 GGCGCGCACCGACGCGGGGAGGG - Intergenic
970333014 4:15003727-15003749 GGCGGCGGCGGCGGCGGGGGCGG + Exonic
970394837 4:15655386-15655408 GGCGCGCGCGCCGACGGGGCGGG - Exonic
970967882 4:21948857-21948879 GGCGCGCGGGGTGGCGGGGGAGG + Intergenic
971257885 4:25030725-25030747 AGCGCGCGGCGCGGCGGTGGGGG - Exonic
971257965 4:25031006-25031028 GGCCCGCCCCGCGGGGGAGGGGG + Intergenic
971457806 4:26860786-26860808 GGGATGCGCCGCGGCGGCGGCGG + Intronic
971457935 4:26861325-26861347 GCCGGCCGCCGCGGCGGGAGAGG - Exonic
972503400 4:39698176-39698198 GGCGAGCGCGGCGGCCGGGGTGG + Exonic
972671450 4:41216405-41216427 GGAGTCCGCGGCGGCGGGGGGGG + Intronic
972765859 4:42151953-42151975 GGCGCGAAGGGCGGCGGGGGCGG + Exonic
972770984 4:42196866-42196888 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
973246742 4:48017373-48017395 GGCGCCCGGGGCCGCGGGGGTGG + Intronic
975485749 4:74933053-74933075 GGCAGGCGCGGCGGCGGCGGCGG + Intergenic
977694349 4:99949950-99949972 GGCGCGCGCAGCGCCGCTGGGGG - Intronic
978072584 4:104491453-104491475 GGCGGGGGCGGCGGCGGGGGGGG - Exonic
978490068 4:109302796-109302818 GGGGCGCGCAGCAGCGGGAGCGG - Intergenic
978576711 4:110196768-110196790 GCCGCGCGCACCGGCGGGGCAGG - Intronic
979785675 4:124712786-124712808 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
979785684 4:124712798-124712820 GCCGAGCGGCGGGGCGGGGGCGG - Intergenic
980990492 4:139735062-139735084 GGCGGGGGCCGCGGAGGGGCGGG - Intronic
981504227 4:145482173-145482195 GGCGCGGGCAGCGGCGGGAAGGG + Intronic
981782878 4:148445548-148445570 GGCGCGCGGCGCGCCGCGAGCGG - Intergenic
982042365 4:151409030-151409052 GGGGCCGGCGGCGGCGGGGGCGG + Intergenic
982042393 4:151409105-151409127 GGCGGGGGCCGGGGCGGGGCAGG - Intergenic
982257641 4:153466267-153466289 GGCGCGGGGCGGGGCGGGGCGGG + Intergenic
983919808 4:173333823-173333845 GGCGCGGGCGGGGGCGCGGGCGG - Intronic
983919815 4:173333835-173333857 GGTGTGCGCCGGGGCGCGGGCGG - Intronic
984888642 4:184473243-184473265 GGCGCGGGCCGCGGCGGGGTGGG - Intronic
984999835 4:185471791-185471813 AGCGCGCGCCGCCGAGGGTGGGG - Intronic
985006006 4:185535662-185535684 CGCGCCCGCCGCGGCCCGGGAGG - Intergenic
985441450 4:189984663-189984685 GGCTGGCGAGGCGGCGGGGGTGG - Intergenic
985532685 5:443224-443246 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
985537535 5:473483-473505 GGGGTGCGCCGCGGGAGGGGAGG - Intronic
985964047 5:3326210-3326232 AGCGCCCGCCGCGGCGCGGGTGG - Intergenic
986152485 5:5140278-5140300 GGCAGCCGCGGCGGCGGGGGCGG - Intergenic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
986330613 5:6713911-6713933 GCCTCGGGGCGCGGCGGGGGCGG + Intergenic
986608610 5:9546152-9546174 GGGGCGGGGCGGGGCGGGGGTGG - Intergenic
986747943 5:10760855-10760877 GGCGCGGGCCGCGGAGAGGTCGG - Intronic
986748099 5:10761390-10761412 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
986748103 5:10761396-10761418 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
986813599 5:11384951-11384973 GCCGCGCGGCGCGGCGTAGGTGG + Exonic
986813657 5:11385156-11385178 GGCTCCCGCGGCGGCGGCGGCGG + Exonic
987087985 5:14487523-14487545 AGCGGGGGCAGCGGCGGGGGTGG + Exonic
987340447 5:16935472-16935494 GGCGCGCGCCGGGGCGCGGGCGG - Intronic
988437529 5:31193802-31193824 GGCGACCGCGGCGGCGGCGGCGG + Exonic
989637986 5:43556773-43556795 GGCCTGGGCCGCGGAGGGGGCGG - Exonic
989643183 5:43603118-43603140 GGCGCGGGCCGAGGTGGGAGCGG + Intronic
990825427 5:59893354-59893376 GCCCCGGGCGGCGGCGGGGGCGG + Exonic
990825437 5:59893366-59893388 GGCGGGGGCGGCGGCAGGGGGGG + Exonic
990955053 5:61332413-61332435 GGCGGGTGGCGCGGCGGCGGCGG + Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
990955149 5:61332808-61332830 GGCCCCCGCGGCGGCGGCGGCGG - Exonic
991913916 5:71587469-71587491 GGCGCGCGGCCCGGCGGGAGAGG - Exonic
992067325 5:73120232-73120254 GGAGCGGGCCTCGGCGGGCGGGG + Intergenic
992487495 5:77210577-77210599 GGCGGGGGCCGCGCCGAGGGAGG + Intronic
992769625 5:80035281-80035303 GGGGAGGGCCGGGGCGGGGGCGG - Intronic
992866231 5:80960196-80960218 GGCCCGGGCCGGGGCGGGCGAGG + Intergenic
993457368 5:88141734-88141756 GGCGGGGGCGGAGGCGGGGGCGG - Intergenic
993727357 5:91383421-91383443 GCGGCGCGGCGCGGCGCGGGAGG - Intergenic
993826227 5:92690271-92690293 GGCGGGCGCCGCCACGCGGGGGG + Intergenic
994367110 5:98928815-98928837 CGCGCGCGCGACGGCGGCGGCGG - Exonic
995106240 5:108381021-108381043 GGCGGGGGCTGCGGCGGCGGCGG - Exonic
995512445 5:112922317-112922339 GGGGCGCGCGGCGGCCGGGCGGG - Exonic
995512454 5:112922338-112922360 GGGGCGCGCGGCGGCCGAGGAGG - Exonic
995623753 5:114055481-114055503 AGAACGCGCCGCGGCGGCGGAGG - Intergenic
997470479 5:134114636-134114658 GGGGCGGGCCGGGCCGGGGGCGG - Intergenic
997975377 5:138438965-138438987 GGAGGCCGCCGCGGCGGCGGCGG - Intergenic
998143230 5:139711334-139711356 GACGCGCTCGGCGGCGGCGGCGG - Intergenic
998166670 5:139848281-139848303 CGCGCGCGCGGCCGCGGCGGCGG + Exonic
999326935 5:150649592-150649614 GGCCAGCCCCGCGGCGGCGGAGG + Exonic
999328265 5:150656743-150656765 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
999328269 5:150656749-150656771 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
999653945 5:153794703-153794725 GGCGAGTGCGGCAGCGGGGGAGG + Exonic
999768414 5:154756944-154756966 GGGGCGTGTGGCGGCGGGGGAGG + Intronic
999768448 5:154757050-154757072 GGTGCGGGCCGCGGCGCTGGGGG + Intronic
1001035095 5:168291805-168291827 AGCGCGCCGCGCGGCGGAGGAGG + Intronic
1001065070 5:168529574-168529596 GGCGGGGGCCGAGGCGGCGGCGG + Exonic
1001529893 5:172454418-172454440 GGGGCGCGCCGCCGCGGGCAGGG + Exonic
1001984284 5:176060897-176060919 GGCACGAGCAGCGGTGGGGGCGG + Intronic
1002057980 5:176609770-176609792 GGGGCGGGGCGGGGCGGGGGCGG - Intronic
1002233192 5:177783168-177783190 GGCACGAGCAGCGGTGGGGGCGG - Intronic
1002262787 5:178006613-178006635 GGCACGAGCAGCGGTGGGGGCGG + Intronic
1002512745 5:179733348-179733370 GGCGGGCGCCGGGGCCGTGGCGG - Exonic
1002541287 5:179907914-179907936 GGAGCGGGCCGGGGCGGGGCGGG + Intergenic
1002691365 5:181052983-181053005 GGGGCGCGCCGCGGGGCGTGCGG - Intronic
1002691372 5:181053005-181053027 GGCGCGCGCGGCGGAGGGGGCGG - Intronic
1002691382 5:181053029-181053051 AGCGCGCGCGGCGGAGGGGGCGG - Intronic
1002927281 6:1611685-1611707 GGCGCGCCCGGGGGCGCGGGCGG + Exonic
1002927310 6:1611790-1611812 GGCGGCGGCGGCGGCGGGGGAGG + Exonic
1002927344 6:1611900-1611922 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1003099012 6:3163060-3163082 AGAGCGCGGCGCGGCGGGGCGGG + Intergenic
1003107465 6:3227463-3227485 TGGGCGCGCCGCAGCGGAGGGGG - Intronic
1003107708 6:3228336-3228358 GGCCCACGCTGGGGCGGGGGCGG - Intronic
1003291273 6:4780404-4780426 GGCGGGGGCGGGGGCGGGGGGGG - Intronic
1003325240 6:5085713-5085735 AGCGCGCGCGGCAGCGGCGGCGG - Exonic
1003345265 6:5260913-5260935 GTCCCGCGCCGCTTCGGGGGCGG + Intronic
1003427882 6:6009278-6009300 GGCCCGGGGCGCGGCGCGGGCGG - Intergenic
1003942730 6:11044530-11044552 GGCGCGCGAGGCCGCAGGGGCGG - Intergenic
1004044580 6:12012111-12012133 GGCGCGCGCCGCGGCGGGGCGGG - Intronic
1004193974 6:13487711-13487733 GGAGCTGGCGGCGGCGGGGGCGG - Intergenic
1004216776 6:13711237-13711259 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1004229077 6:13814582-13814604 GACGCGCGCCGGGGGTGGGGTGG + Intergenic
1004690339 6:17987674-17987696 GGGGCGGGGCGCGGCGGCGGCGG + Intergenic
1004924470 6:20403703-20403725 GGCGGGCGCCGGTGGGGGGGTGG - Intronic
1005582947 6:27251070-27251092 GGCCCGCACCGGGGCGGAGGAGG - Exonic
1005826138 6:29632787-29632809 GGCGCGCGGCGTGGTGGGGGAGG - Intronic
1005968387 6:30742893-30742915 GGAGCGTGGCGCGGCGTGGGCGG - Intergenic
1006300734 6:33192508-33192530 GGCGGGGGCCGGGCCGGGGGCGG - Intergenic
1006337438 6:33427995-33428017 GCCGCCCGGCGCGGTGGGGGCGG - Intronic
1006472658 6:34237331-34237353 GGGGCCCGCGGCGGCGGCGGCGG + Intronic
1006547467 6:34791947-34791969 GGCGCGCGCAGCGCCGGGGCTGG - Intergenic
1006599701 6:35217239-35217261 GGGGGGAGGCGCGGCGGGGGGGG + Intronic
1006671435 6:35731941-35731963 GGCGCCGGGCGCGGCGGGAGTGG + Intergenic
1006814318 6:36840041-36840063 GGCGCCCGCAGGGGCCGGGGCGG + Intergenic
1006950671 6:37819431-37819453 GGCGCACGCCGGGGAGGGGGCGG + Intergenic
1007413291 6:41677667-41677689 GTCACGCGCCGCAGCGAGGGGGG - Intergenic
1007473384 6:42104766-42104788 GGCGCGCGCTACGCCGGGGCTGG - Exonic
1007478316 6:42133830-42133852 GGGGCGGGGCGGGGCGGGGGAGG + Intronic
1007479035 6:42137828-42137850 GGGGCGGGGCGGGGCGGGGGAGG + Intronic
1007665297 6:43509944-43509966 GGCGGAGGCTGCGGCGGGGGCGG + Exonic
1007739633 6:44002760-44002782 AGAGCGCGCGGCGGCGGCGGCGG + Exonic
1007739653 6:44002831-44002853 CGCGCGCGCCCCGTCGGCGGCGG - Exonic
1007785232 6:44276021-44276043 GGGACGCGCTGCGGCGGGGCAGG + Exonic
1007902044 6:45422026-45422048 GGCGGCCGCCGCGGAGGCGGCGG + Intronic
1007902063 6:45422094-45422116 GCGGCGCGGCGCGGCGGTGGCGG + Intronic
1007927806 6:45663790-45663812 GGCGCGCTTCGCTGCTGGGGAGG - Intronic
1007937069 6:45741896-45741918 GGCGCGGGGCGGGGCTGGGGTGG - Intergenic
1008013245 6:46491005-46491027 GGCGGGGGCGGTGGCGGGGGTGG - Intronic
1008013251 6:46491017-46491039 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1008013255 6:46491023-46491045 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1008027399 6:46653336-46653358 GGCACGCGCCGCGCTGGGGGAGG + Intronic
1008673317 6:53794984-53795006 GCTCCGCGCGGCGGCGGGGGCGG + Exonic
1009952629 6:70413955-70413977 GACGCGCGCAGGGGCAGGGGCGG - Intronic
1010032868 6:71288734-71288756 GGCGCGCGCGGCGGCGGTCCCGG + Intergenic
1010244790 6:73653502-73653524 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1010244794 6:73653508-73653530 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1011734253 6:90296386-90296408 GGCGCGCGGGGCGGGCGGGGAGG - Intronic
1012400009 6:98835090-98835112 GGCGGTGGCGGCGGCGGGGGGGG + Exonic
1012400020 6:98835111-98835133 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1012887256 6:104859847-104859869 GGCGCGAGCAGAGGCGGCGGCGG - Exonic
1012895350 6:104940837-104940859 GGCGCGCGGCGGGGCCGGGAGGG - Intergenic
1012939651 6:105403124-105403146 GGCGGGCCCAGCGGCGGCGGCGG + Intergenic
1013117557 6:107114716-107114738 GGCGCGCGGCGCGAGTGGGGCGG + Intronic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013272553 6:108558092-108558114 GGCGCGACCCGCCGAGGGGGCGG - Intergenic
1013369316 6:109455786-109455808 GGCGGGGGCGGGGGCGGGGGCGG + Exonic
1013512556 6:110858212-110858234 GGCGCGCGCTGCGGCAGGATGGG - Intronic
1014137542 6:117907194-117907216 GGCGCCGGCGGCGGCGGCGGCGG - Intergenic
1014137624 6:117907479-117907501 GGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1015315060 6:131808060-131808082 GGCGGGAGCCGCGGCGGCGAGGG + Exonic
1016010750 6:139135501-139135523 GGCGGGAGCGGCGGCCGGGGGGG + Exonic
1016330258 6:142946522-142946544 GGCGCGCGGGGCGACGGGGGAGG + Intergenic
1016340899 6:143060784-143060806 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1016340907 6:143060796-143060818 GGGGCGGGGCGGGGCGGGGGCGG - Intronic
1016340910 6:143060801-143060823 GGCGCGGGGCGGGGCGGGGCGGG - Intronic
1016713995 6:147203734-147203756 AGCGCGGGCCGCGGCGGTGGCGG - Intergenic
1016982088 6:149863421-149863443 GGCGCGCGCGGTGGCCAGGGCGG + Exonic
1017662380 6:156687312-156687334 CGCGCGCCCCGCGCCGGGCGGGG - Intergenic
1017671983 6:156777762-156777784 GGCGCCGGCCGCGGCCCGGGGGG - Intergenic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017672311 6:156778949-156778971 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1018013595 6:159693330-159693352 GGCGGGGCCCGCGGGGGGGGGGG - Intronic
1018613101 6:165662355-165662377 GGAGGGCGCAGCGGCGGCGGCGG - Intronic
1018635401 6:165855291-165855313 GGCGCGGGAAGTGGCGGGGGGGG + Intronic
1018876520 6:167826850-167826872 GGCGCGCACGGCGGCGGGCGGGG + Intergenic
1018876642 6:167827270-167827292 GGGGCGCGGCGCAGCGGGCGGGG - Intronic
1019111927 6:169724009-169724031 GGCCCGCGCGGCGGCGGCGGCGG - Exonic
1019298222 7:290105-290127 GGCGGGCGGCGCGGAGGAGGCGG + Intergenic
1019343702 7:519894-519916 GGCGGGGGCGGGGGCGGGGGAGG - Intronic
1019473391 7:1232955-1232977 GGCGCGGGCCGGGGCCGGGGCGG - Exonic
1019474520 7:1237522-1237544 GGGGAGCGCCGGGGCGGGCGGGG - Intergenic
1019536167 7:1530921-1530943 GGCCCGGGCCGCGGCGGGGACGG + Intronic
1019828226 7:3301272-3301294 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1019989508 7:4682101-4682123 GGCGCGCGCCAGCGCGGGGCTGG - Intergenic
1020105347 7:5420155-5420177 GGCGGGCGCTGCGCCGGGGCGGG - Intronic
1020162214 7:5781384-5781406 GGCGCGGGCCGAGGCCCGGGCGG - Intronic
1020274364 7:6615675-6615697 GGCGGGCGCCGCGGCAAGGCCGG - Exonic
1020274372 7:6615698-6615720 CGCGGGGGCCGGGGCGGGGGCGG - Exonic
1020560568 7:9726206-9726228 GGGGGGCGCCGCGCCTGGGGAGG - Intergenic
1021998337 7:26201635-26201657 GGCGCGCGCCCGGCGGGGGGAGG - Intronic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022101991 7:27174342-27174364 GGCGCCCGCCGCGGTGCGGGGGG - Intronic
1022103808 7:27184604-27184626 GGCGACCTCCGCGGCGGCGGCGG - Exonic
1022207974 7:28180822-28180844 GGCGGGGGCGGGGGCGGGGGGGG + Intergenic
1022230776 7:28410154-28410176 GGCGCGCGCCCGGGGAGGGGAGG + Intronic
1022375559 7:29807581-29807603 GGCGGGCGCCGGGGCGGCGTGGG + Intronic
1022715150 7:32891888-32891910 GGCGGGGGCGGGGGCGGGGGCGG - Exonic
1022923260 7:35037186-35037208 GGCGCGCCGCCCGCCGGGGGCGG - Intronic
1023881935 7:44325662-44325684 GGCGGGCGCGGCGGCGGCGGCGG - Intronic
1023937118 7:44748418-44748440 GGGGCGGGCCCCGGCGGAGGAGG - Intergenic
1023955711 7:44885305-44885327 AGCGAGCGCGGCGGCGGCGGTGG - Exonic
1024043798 7:45574411-45574433 GGCGCGGGGCGCGGGGCGGGCGG - Intronic
1024043857 7:45574550-45574572 GGGGCGCCGCGCGGCGGAGGCGG + Exonic
1024471681 7:49773523-49773545 GGCCCGCGCTGCCCCGGGGGAGG - Intergenic
1024639378 7:51316926-51316948 GGGGCGGGGCGGGGCGGGGGCGG - Intergenic
1026006891 7:66607124-66607146 GGAGCGGGCAGCGGCGGAGGCGG - Intergenic
1026013453 7:66654498-66654520 TGCGCAGGCCGCGCCGGGGGCGG + Intronic
1026840413 7:73667720-73667742 GCGGCGCGGCGCGGCCGGGGCGG + Intergenic
1027228596 7:76260038-76260060 AGCGGCCGCCGCGGCGGGGGTGG + Intronic
1027250050 7:76393347-76393369 GCCGCGCACTGCGGCGTGGGAGG - Intronic
1028231058 7:88306835-88306857 GGTGCGCGCCGCGGGCCGGGCGG + Exonic
1028417633 7:90596540-90596562 GGCGCGCGCCGCGGGGAAAGCGG - Intronic
1028556784 7:92134122-92134144 GGCGCGCGCCGCAGCTGAGGCGG - Intronic
1029123191 7:98281722-98281744 GGCGGGGGACGCGGCGGCGGCGG - Exonic
1029206082 7:98870064-98870086 GGCGCGCGGCGCGGCTGACGTGG - Intronic
1029708340 7:102286842-102286864 GGCGCGCGCCTCGCGGGCGGAGG + Intronic
1029708347 7:102286863-102286885 GGGGCGCGCCGCGCTGGGGCTGG + Intronic
1029896403 7:103989367-103989389 AGGGCGCGCGGCGGCGGCGGCGG - Exonic
1029996756 7:105014159-105014181 GGCGGCCGCGGCGGCGGCGGCGG - Exonic
1029996757 7:105014162-105014184 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1030138734 7:106284667-106284689 GGCGCGGGCGGCGGCGGCTGGGG - Intronic
1030215991 7:107044596-107044618 CCCGCGCACCGCGGCGGGGCGGG + Intergenic
1030348334 7:108456709-108456731 AGCGCGTGTGGCGGCGGGGGTGG + Intronic
1030682662 7:112450138-112450160 GGGGCGCGCCGAGGCAGGGGTGG + Intronic
1031051881 7:116953438-116953460 CGCCCGGGCCGCGGCGGCGGCGG + Exonic
1031134834 7:117873337-117873359 GGCGGGGGCCGCGGCGGAGGCGG - Exonic
1031406798 7:121396172-121396194 GGCGCGCGCGGCGGAGAGGCGGG - Exonic
1031689221 7:124766349-124766371 GGCGAGGGGCGGGGCGGGGGAGG + Intergenic
1032125318 7:129188996-129189018 GGCGCGCGGAGCGTCCGGGGGGG + Exonic
1032174560 7:129612307-129612329 GGCGGGCGGCGCGGTGGGGCCGG + Intronic
1032298797 7:130668393-130668415 GGCGCGCGCGGGCGCCGGGGCGG + Intronic
1033365928 7:140672862-140672884 GGCGGGCGGAGCGTCGGGGGCGG - Intronic
1033732824 7:144195631-144195653 GGGGCGGGCCGCGGGTGGGGCGG - Exonic
1033750227 7:144355386-144355408 GGGGCGGGCCGCGGGTGGGGCGG + Exonic
1034147060 7:148883588-148883610 GGCGCGGGCCGCTGCCGGGGTGG - Intronic
1034448008 7:151123195-151123217 GGCAAGCGCGGCGGCGGCGGCGG - Intronic
1034483541 7:151341737-151341759 GGCGACAGCGGCGGCGGGGGCGG + Exonic
1034494288 7:151410547-151410569 GGTGCGAGCCGCTGCGGGGTCGG + Intronic
1034618150 7:152436202-152436224 GCCGCGGGGCCCGGCGGGGGCGG + Intergenic
1035004512 7:155644950-155644972 GGACCGCGCCGCGGTGGGCGGGG + Intronic
1035021648 7:155804159-155804181 GCCGCGCCCCGCGCCGGGGCGGG - Intronic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035450392 7:158973934-158973956 GGGGCGCGGAGAGGCGGGGGGGG - Intergenic
1035601952 8:902346-902368 GGCGGGCGCGGGGGCTGGGGGGG + Intergenic
1035627257 8:1080270-1080292 CGCGGGCGGCGGGGCGGGGGTGG - Intergenic
1035717178 8:1763604-1763626 GGGGCGCGGCGCGGGGGGCGGGG - Intronic
1035717181 8:1763609-1763631 GGGGCGGGGCGCGGCGCGGGGGG - Intronic
1035747837 8:1974333-1974355 GGCGGGACCCTCGGCGGGGGCGG - Intronic
1036390290 8:8318856-8318878 GGCGGGAGCCGGGGCGGGGGCGG + Exonic
1036785312 8:11681484-11681506 GGCGCTCGCGGGGGGGGGGGGGG + Intronic
1037535151 8:19817111-19817133 GGCGGGGGCGGAGGCGGGGGCGG - Intergenic
1037901771 8:22692978-22693000 GGAGCGAGCGGCGGCGGTGGCGG - Exonic
1037902298 8:22695092-22695114 GGCGGGAGAGGCGGCGGGGGTGG - Intergenic
1038035410 8:23682631-23682653 GCCCCGCGCCGCGCCGGAGGAGG - Exonic
1038296155 8:26292035-26292057 GGCTGGCGCCGTGGCGGGGGTGG + Intronic
1038540345 8:28385862-28385884 GGCCGGGGCCGCGGCGGGCGGGG - Intronic
1038644386 8:29350505-29350527 GGCGCGCAGAGCGGAGGGGGAGG + Exonic
1038808062 8:30812649-30812671 GGCGCGCGGCCGGGCGGGGAAGG - Exonic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1039903262 8:41767658-41767680 GGTGCGCGCGGGGGCGCGGGCGG + Intronic
1039948943 8:42153035-42153057 AGCGCGCGCGGCGGGCGGGGCGG + Exonic
1040038829 8:42896733-42896755 GGCGCGCCCGGCGGCAGCGGCGG + Intronic
1040355884 8:46617708-46617730 GGCTCGCGGGGCGGCTGGGGCGG + Intergenic
1041167368 8:55102741-55102763 GGCCCGGGCGGCGGCGGGGCGGG + Exonic
1041281029 8:56211401-56211423 GGCGGGCGCAGCGGCGGGCGGGG - Intergenic
1041355339 8:56993766-56993788 GGCGCGCGGGGCGGCGTTGGTGG - Exonic
1041673608 8:60516826-60516848 GGCGCGGGGCGGGGCGGGGCGGG + Intergenic
1041690396 8:60680409-60680431 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1042155419 8:65840913-65840935 GGCGAGCGCCGCGGGGCGCGCGG + Intronic
1042217378 8:66439564-66439586 GGGGAGCGGCGCGGCGGGGACGG + Intronic
1042962668 8:74320756-74320778 GGCGGGCGCGGGCGCGGGGGTGG + Intronic
1043053190 8:75407228-75407250 GGCGTGACCCGGGGCGGGGGAGG + Intergenic
1043053279 8:75407535-75407557 TGCGCGCGCCGAGGCGGTGGCGG + Intergenic
1043149394 8:76694690-76694712 GGCGGGGGCAGAGGCGGGGGCGG - Intronic
1043463856 8:80486549-80486571 GGAGCGCGGCGGGGCGGGGGTGG + Exonic
1043527473 8:81112155-81112177 GGGGCGGGCCGCGGGGCGGGAGG + Intergenic
1044832186 8:96261566-96261588 GGCGTGCGGCGCGGCGGGACGGG - Exonic
1046031462 8:108787606-108787628 AGCGCCCGCCACGGCGGGCGGGG + Exonic
1047739306 8:127794312-127794334 GCCGCGCGCGGAGGCGGGGCGGG - Intergenic
1047998619 8:130358727-130358749 GGCGGGGGCCGGGCCGGGGGCGG - Intronic
1048214139 8:132480499-132480521 GGCGCGCAGGGCGGCGGGGGCGG - Exonic
1048472150 8:134713097-134713119 GCCGCGCTCGGCGCCGGGGGAGG - Intergenic
1048833397 8:138497153-138497175 GGCGCGCGGCGCGGCGCGGAGGG - Intergenic
1048981173 8:139703923-139703945 GGCGGGCGCGGCGGCGGCGGCGG + Intergenic
1049109849 8:140635780-140635802 GGCGGGGTCCGCGGCGGCGGCGG + Intergenic
1049194636 8:141308504-141308526 GGTGCGCGCGGGGGCGGGGCAGG - Intergenic
1049457335 8:142700394-142700416 GGCGCGCGCCCCGGGGCGGGCGG + Exonic
1049457337 8:142700396-142700418 CGCGCGCCCCGGGGCGGGCGGGG + Exonic
1049532247 8:143160355-143160377 GGCGGGGGCCGCGCGGGGGGCGG + Intronic
1049570620 8:143368814-143368836 GGCCCGCGGCGCGGCTGGGCGGG - Intergenic
1049585495 8:143430782-143430804 GGCGCGCGCCCCTCCCGGGGAGG - Intergenic
1049767274 8:144360683-144360705 GGTGGGCACCTCGGCGGGGGTGG + Exonic
1049791091 8:144473051-144473073 GGTGGGCGCCGGGGCGGGGCAGG + Exonic
1049801017 8:144517576-144517598 AGCGCGCGGCGGGGCGGCGGGGG - Intronic
1049803079 8:144527142-144527164 GGCGCGCGCCGTGGGGAGCGGGG + Exonic
1049850529 8:144827792-144827814 ACCTCGCGCCGCCGCGGGGGAGG - Intronic
1049879433 8:145052226-145052248 GGGGCGGGGCGCGGCTGGGGTGG - Intergenic
1050472543 9:6008037-6008059 TGCGCGCGCCGCCGCCGGGGGGG - Intergenic
1051079604 9:13279326-13279348 TGCGCGCGCGCCGGCGGGGAAGG - Intronic
1051174012 9:14346113-14346135 GGGGCGCGCCGCGGGCGCGGGGG + Intronic
1051774515 9:20620548-20620570 GGCGAGCGCGGCGCGGGGGGCGG + Intronic
1052048548 9:23821753-23821775 GCGGCGCGGCGCGGCGCGGGTGG - Intronic
1052494689 9:29212328-29212350 AGCGGGCGCCGCGGAGCGGGTGG - Intergenic
1052991791 9:34522943-34522965 CGGTCGCGCCGCGGCGGGAGCGG - Exonic
1052991820 9:34523029-34523051 AGCGAGCGCCGCGGCCGCGGAGG - Exonic
1053230097 9:36400896-36400918 GGGGCGCGGCGGGGCGGGGAGGG - Intronic
1053550926 9:39078741-39078763 GGCCCGCTGCGCAGCGGGGGCGG - Exonic
1053697401 9:40650740-40650762 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1053815035 9:41898820-41898842 GGCCCGCTGCGCGGCGGGGGCGG - Exonic
1054308706 9:63450186-63450208 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054407370 9:64773879-64773901 GGCGGGGGCCGCGGCGGCGGGGG + Intergenic
1054489437 9:65762641-65762663 GGCGGGGGCCGCGGCGGTGGGGG - Intergenic
1054615561 9:67288621-67288643 GGCCCGCTGCGCGGCGGGGGCGG + Intergenic
1054731318 9:68705205-68705227 GGCGGCTGCCGCGGCTGGGGAGG - Intergenic
1055514160 9:77020147-77020169 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1056154154 9:83817840-83817862 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1056992570 9:91424465-91424487 GGGGCGCGCTGCGGCGGGGAAGG + Intergenic
1057313505 9:93955408-93955430 GGCGCGGGGCGGGGCGGGGCGGG - Intergenic
1057643781 9:96854184-96854206 GGCGCGAGCGGCGGCGGGGGTGG - Exonic
1058005150 9:99906591-99906613 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1058439083 9:104991213-104991235 GGCCGGCGCTGGGGCGGGGGAGG - Intergenic
1058467546 9:105244587-105244609 GGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1058687321 9:107489917-107489939 GGCGCACGTGGGGGCGGGGGAGG + Intronic
1058885839 9:109320702-109320724 AGAGCGCGCGGCGGCGGCGGCGG - Exonic
1059230674 9:112718301-112718323 GGCGTGGCCCGGGGCGGGGGAGG + Intergenic
1060477984 9:123999795-123999817 GCCGCGCGCCGCAGCCCGGGTGG + Intergenic
1060596817 9:124853498-124853520 GGAGCCCGCCGGGGCGGGGCGGG + Exonic
1060700489 9:125746596-125746618 CGCGCGCACCGCCCCGGGGGCGG + Intergenic
1060700686 9:125747189-125747211 GCCGGGCTCCGCGGCGGTGGCGG - Intergenic
1060849194 9:126860678-126860700 GGCGCCGGCGGCGGCGGAGGGGG + Intronic
1060952596 9:127613104-127613126 GGCGCGGCCCGGGGCGGGGGAGG - Intronic
1060979890 9:127785891-127785913 GGCGGGGGCAGCGGCGGCGGCGG + Intronic
1061028958 9:128068275-128068297 GGCGCGGGCGGGAGCGGGGGCGG - Exonic
1061128221 9:128689764-128689786 GGGGCGCGGCGCGGCCGGGCGGG + Intronic
1061299646 9:129697348-129697370 GGTGCGCGCCCCGGCCGGGCGGG - Intronic
1061348128 9:130042995-130043017 GGCGCTCCGCGCGGCGGGCGCGG + Exonic
1061348181 9:130043186-130043208 GGCGGGCGCTGCGGCGGCCGCGG - Intronic
1061365786 9:130172095-130172117 GGCCCCCGCCGCGGCGGGGAGGG - Intergenic
1061472119 9:130835197-130835219 GGCGCAGGCGGCGGCGGGGCGGG + Intronic
1061472158 9:130835310-130835332 GGCGCGCGGGGCGGCGGTGAGGG + Intronic
1061802762 9:133121183-133121205 GGCCCGGCGCGCGGCGGGGGCGG + Intronic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1061975879 9:134067879-134067901 GGCGCGGGCGGCGGCGGGCCGGG - Intronic
1062162468 9:135087826-135087848 GGCGCGCGGGGCGGCGGCGGCGG + Exonic
1062162489 9:135087897-135087919 GGCGGGCACCGCGGCGGGCAGGG - Exonic
1062272121 9:135714433-135714455 GGCGGGCGGCCGGGCGGGGGCGG - Intronic
1062306005 9:135907431-135907453 GGCGGGCGCGGGGGCGGGAGCGG + Intergenic
1062341412 9:136095308-136095330 CGGCCGCACCGCGGCGGGGGCGG + Intergenic
1062367253 9:136216770-136216792 GGTGCCCCCCGCGGTGGGGGCGG - Intronic
1062408673 9:136410461-136410483 GACGCGGGCCGCGGCACGGGCGG - Exonic
1062462019 9:136666074-136666096 GGCGGGCGGCGCGGCGGGGAGGG + Intronic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062583871 9:137240419-137240441 AGGGCGCGCAGCTGCGGGGGAGG + Intergenic
1062653544 9:137590476-137590498 GGTGCGCGCGGTGGCGGTGGCGG - Exonic
1202779769 9_KI270717v1_random:24098-24120 GGCGGGGGCCACGGCGGCGGGGG + Intergenic
1203469883 Un_GL000220v1:111690-111712 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203471448 Un_GL000220v1:116818-116840 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1203477704 Un_GL000220v1:155662-155684 GACGGCCGCCGCGGCGGCGGCGG - Intergenic
1203479269 Un_GL000220v1:160790-160812 GCCGCGCGCCGAGGAGGAGGGGG - Intergenic
1186426070 X:9465133-9465155 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1186768057 X:12791455-12791477 GGGGCGCGCGGCGGCGGAGGAGG - Exonic
1187172996 X:16869996-16870018 GGCGCGCGCCGGGGCCGCGGGGG - Intronic
1187226038 X:17375965-17375987 GGCGCGGGCAGTGGCGGCGGCGG - Exonic
1187547362 X:20266946-20266968 GGCGCGGGAACCGGCGGGGGGGG - Intronic
1187547389 X:20267065-20267087 GGTGCGCGCGGCGGTGGTGGCGG - Intronic
1187648323 X:21374140-21374162 CGCGTGCGCGGCGGCGGAGGCGG - Intergenic
1187768184 X:22666512-22666534 GGGGCGGGGCGGGGCGGGGGCGG - Intergenic
1187826180 X:23334762-23334784 GGCGCCCGCGGCGGCGGCGACGG - Exonic
1188004081 X:25005484-25005506 GGCGGCCGCGGCGGCGCGGGTGG - Intronic
1189310623 X:40014926-40014948 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1189325633 X:40109267-40109289 GGAGCGCGCGGGGGTGGGGGTGG - Intronic
1189331360 X:40146680-40146702 GGCGGGCGCGGCGGGCGGGGAGG - Intronic
1189332777 X:40153551-40153573 GGAGCGCCCCGCGGGGGGTGGGG - Intronic
1189534507 X:41923166-41923188 GGCGACCGCCCCGGCGCGGGCGG + Intronic
1190099765 X:47513549-47513571 GGCCCGCGCGGCCGCAGGGGCGG - Intergenic
1190149885 X:47936665-47936687 GGGGCGGGCAGCGGCAGGGGCGG + Intronic
1190266925 X:48832164-48832186 GGCGCGGGCCGAGGCGCAGGAGG - Exonic
1190324889 X:49200225-49200247 GGCGCGGGGCGCGGCGGGGGCGG + Exonic
1190712927 X:53082571-53082593 GGCGGCGGCGGCGGCGGGGGCGG - Exonic
1190984427 X:55488527-55488549 GGCGGGGGTGGCGGCGGGGGCGG + Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192925004 X:75747091-75747113 GGCGGCCGCGGCGGCGGCGGCGG - Intergenic
1192925005 X:75747094-75747116 GGCGGCGGCCGCGGCGGCGGCGG - Intergenic
1195113023 X:101666150-101666172 GGCGGGCGGTGGGGCGGGGGCGG + Intergenic
1195239273 X:102935040-102935062 GGCGGGGGCGGGGGCGGGGGAGG + Intergenic
1195625105 X:106999563-106999585 GGGGCGGGCCGGGGCTGGGGTGG - Intronic
1197753519 X:129980751-129980773 GGGGCGGGGCGCGGCGGGAGGGG + Intergenic
1197754448 X:129984131-129984153 GGCGGGCGGCGGGGCGGGGCCGG + Intronic
1197774681 X:130111193-130111215 GTCGTGCGCCGCGGCCCGGGCGG + Intergenic
1199500385 X:148500727-148500749 GGCGGCAGCGGCGGCGGGGGCGG - Exonic
1199679390 X:150214876-150214898 GGCGAGCTCGGCGGCGGGGAGGG + Intergenic
1199695837 X:150342173-150342195 GGCGAGCTCGGCGGCGGGGAGGG - Intergenic
1199699510 X:150365109-150365131 GGCGGCGGCGGCGGCGGGGGTGG - Intronic
1199772398 X:150983441-150983463 TGCGGGCGCTGCGGCGGCGGCGG - Intronic
1200003195 X:153072530-153072552 GCTGCGCGCCGCTGCGGCGGCGG - Exonic
1200004528 X:153077479-153077501 GCTGCGCGCCGCTGCGGCGGCGG + Intergenic
1200058742 X:153474704-153474726 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1200058746 X:153474710-153474732 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1200092953 X:153644287-153644309 GGCGGGTGCGGGGGCGGGGGCGG + Intronic
1200126811 X:153819099-153819121 AGAGCGCGCCGCGACGGCGGCGG + Intronic
1200128911 X:153830650-153830672 GGCGGGCCCCGCGGGCGGGGAGG - Intergenic
1200129002 X:153830918-153830940 CGCGCCCACGGCGGCGGGGGAGG + Intergenic
1200138515 X:153886190-153886212 CGTGCGCGCAGGGGCGGGGGAGG + Intronic
1200163333 X:154020007-154020029 GGGGCGCCCCGCGCCGGGGAGGG + Intergenic
1200229448 X:154436863-154436885 GGGGCGGGGCGCGGCGGGTGGGG + Intergenic
1200229467 X:154436948-154436970 GGCGCGGGGCGGGGCGGGCGGGG - Exonic
1200249751 X:154546755-154546777 GGCGGGCGCCGCGCAGGCGGAGG - Intronic