ID: 910982728

View in Genome Browser
Species Human (GRCh38)
Location 1:92974956-92974978
Sequence ACCTGGTGGTCCCCTACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910982723_910982728 -1 Left 910982723 1:92974934-92974956 CCAGTTCACTCCTCCTTAGGCAA No data
Right 910982728 1:92974956-92974978 ACCTGGTGGTCCCCTACTACTGG No data
910982721_910982728 5 Left 910982721 1:92974928-92974950 CCTGGGCCAGTTCACTCCTCCTT 0: 9
1: 29
2: 91
3: 139
4: 342
Right 910982728 1:92974956-92974978 ACCTGGTGGTCCCCTACTACTGG No data
910982720_910982728 21 Left 910982720 1:92974912-92974934 CCTGCTCTGTTTCTGACCTGGGC 0: 15
1: 32
2: 87
3: 153
4: 407
Right 910982728 1:92974956-92974978 ACCTGGTGGTCCCCTACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910982728 Original CRISPR ACCTGGTGGTCCCCTACTAC TGG Intergenic
No off target data available for this crispr