ID: 910983092

View in Genome Browser
Species Human (GRCh38)
Location 1:92977997-92978019
Sequence TTAAAGATACACATAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910983092_910983095 -9 Left 910983092 1:92977997-92978019 CCTTTGTCTATGTGTATCTTTAA No data
Right 910983095 1:92978011-92978033 TATCTTTAAGGAAATCCCCTGGG No data
910983092_910983094 -10 Left 910983092 1:92977997-92978019 CCTTTGTCTATGTGTATCTTTAA No data
Right 910983094 1:92978010-92978032 GTATCTTTAAGGAAATCCCCTGG No data
910983092_910983097 -7 Left 910983092 1:92977997-92978019 CCTTTGTCTATGTGTATCTTTAA No data
Right 910983097 1:92978013-92978035 TCTTTAAGGAAATCCCCTGGGGG No data
910983092_910983099 -5 Left 910983092 1:92977997-92978019 CCTTTGTCTATGTGTATCTTTAA No data
Right 910983099 1:92978015-92978037 TTTAAGGAAATCCCCTGGGGGGG No data
910983092_910983096 -8 Left 910983092 1:92977997-92978019 CCTTTGTCTATGTGTATCTTTAA No data
Right 910983096 1:92978012-92978034 ATCTTTAAGGAAATCCCCTGGGG No data
910983092_910983098 -6 Left 910983092 1:92977997-92978019 CCTTTGTCTATGTGTATCTTTAA No data
Right 910983098 1:92978014-92978036 CTTTAAGGAAATCCCCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910983092 Original CRISPR TTAAAGATACACATAGACAA AGG (reversed) Intergenic
No off target data available for this crispr