ID: 910985455

View in Genome Browser
Species Human (GRCh38)
Location 1:93000593-93000615
Sequence CATGTAGGCAGGTCAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910985455_910985459 0 Left 910985455 1:93000593-93000615 CCTGCTGTTGACCTGCCTACATG No data
Right 910985459 1:93000616-93000638 ATTAGTCTCAGGCTGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910985455 Original CRISPR CATGTAGGCAGGTCAACAGC AGG (reversed) Intergenic
No off target data available for this crispr