ID: 910986653

View in Genome Browser
Species Human (GRCh38)
Location 1:93011620-93011642
Sequence CTCGGTCTGATGCAAGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910986653_910986657 19 Left 910986653 1:93011620-93011642 CCTGACACTTGCATCAGACCGAG No data
Right 910986657 1:93011662-93011684 ATCAAGAGCTAGAATGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910986653 Original CRISPR CTCGGTCTGATGCAAGTGTC AGG (reversed) Intergenic
No off target data available for this crispr