ID: 910989369

View in Genome Browser
Species Human (GRCh38)
Location 1:93039127-93039149
Sequence TTTGAGTCACAACTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910989366_910989369 -5 Left 910989366 1:93039109-93039131 CCTATGAAGTAGTTCTTATTTGA No data
Right 910989369 1:93039127-93039149 TTTGAGTCACAACTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910989369 Original CRISPR TTTGAGTCACAACTGGAGGA TGG Intergenic
No off target data available for this crispr