ID: 910990800

View in Genome Browser
Species Human (GRCh38)
Location 1:93053801-93053823
Sequence GGGGCTGTCCTGCGCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910990800_910990807 21 Left 910990800 1:93053801-93053823 CCTGCAATGCGCAGGACAGCCCC No data
Right 910990807 1:93053845-93053867 CCCAAACGTCGATAATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910990800 Original CRISPR GGGGCTGTCCTGCGCATTGC AGG (reversed) Intergenic
No off target data available for this crispr