ID: 910992009

View in Genome Browser
Species Human (GRCh38)
Location 1:93066446-93066468
Sequence CGAGCTCTGGCAAGTGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910992009_910992012 11 Left 910992009 1:93066446-93066468 CCACTGACACTTGCCAGAGCTCG No data
Right 910992012 1:93066480-93066502 ATTTGAGGATTAAGCCTTCCAGG No data
910992009_910992015 16 Left 910992009 1:93066446-93066468 CCACTGACACTTGCCAGAGCTCG No data
Right 910992015 1:93066485-93066507 AGGATTAAGCCTTCCAGGGAGGG No data
910992009_910992013 12 Left 910992009 1:93066446-93066468 CCACTGACACTTGCCAGAGCTCG No data
Right 910992013 1:93066481-93066503 TTTGAGGATTAAGCCTTCCAGGG No data
910992009_910992014 15 Left 910992009 1:93066446-93066468 CCACTGACACTTGCCAGAGCTCG No data
Right 910992014 1:93066484-93066506 GAGGATTAAGCCTTCCAGGGAGG No data
910992009_910992017 26 Left 910992009 1:93066446-93066468 CCACTGACACTTGCCAGAGCTCG No data
Right 910992017 1:93066495-93066517 CTTCCAGGGAGGGAGTGAGCTGG No data
910992009_910992011 -4 Left 910992009 1:93066446-93066468 CCACTGACACTTGCCAGAGCTCG No data
Right 910992011 1:93066465-93066487 CTCGCATCAAGTGTGATTTGAGG No data
910992009_910992018 27 Left 910992009 1:93066446-93066468 CCACTGACACTTGCCAGAGCTCG No data
Right 910992018 1:93066496-93066518 TTCCAGGGAGGGAGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910992009 Original CRISPR CGAGCTCTGGCAAGTGTCAG TGG (reversed) Intergenic
No off target data available for this crispr