ID: 910992010

View in Genome Browser
Species Human (GRCh38)
Location 1:93066459-93066481
Sequence ATCACACTTGATGCGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910992010_910992017 13 Left 910992010 1:93066459-93066481 CCAGAGCTCGCATCAAGTGTGAT No data
Right 910992017 1:93066495-93066517 CTTCCAGGGAGGGAGTGAGCTGG No data
910992010_910992013 -1 Left 910992010 1:93066459-93066481 CCAGAGCTCGCATCAAGTGTGAT No data
Right 910992013 1:93066481-93066503 TTTGAGGATTAAGCCTTCCAGGG No data
910992010_910992012 -2 Left 910992010 1:93066459-93066481 CCAGAGCTCGCATCAAGTGTGAT No data
Right 910992012 1:93066480-93066502 ATTTGAGGATTAAGCCTTCCAGG No data
910992010_910992014 2 Left 910992010 1:93066459-93066481 CCAGAGCTCGCATCAAGTGTGAT No data
Right 910992014 1:93066484-93066506 GAGGATTAAGCCTTCCAGGGAGG No data
910992010_910992018 14 Left 910992010 1:93066459-93066481 CCAGAGCTCGCATCAAGTGTGAT No data
Right 910992018 1:93066496-93066518 TTCCAGGGAGGGAGTGAGCTGGG No data
910992010_910992015 3 Left 910992010 1:93066459-93066481 CCAGAGCTCGCATCAAGTGTGAT No data
Right 910992015 1:93066485-93066507 AGGATTAAGCCTTCCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910992010 Original CRISPR ATCACACTTGATGCGAGCTC TGG (reversed) Intergenic
No off target data available for this crispr