ID: 910992014

View in Genome Browser
Species Human (GRCh38)
Location 1:93066484-93066506
Sequence GAGGATTAAGCCTTCCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910992010_910992014 2 Left 910992010 1:93066459-93066481 CCAGAGCTCGCATCAAGTGTGAT No data
Right 910992014 1:93066484-93066506 GAGGATTAAGCCTTCCAGGGAGG No data
910992009_910992014 15 Left 910992009 1:93066446-93066468 CCACTGACACTTGCCAGAGCTCG No data
Right 910992014 1:93066484-93066506 GAGGATTAAGCCTTCCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910992014 Original CRISPR GAGGATTAAGCCTTCCAGGG AGG Intergenic
No off target data available for this crispr