ID: 910994739

View in Genome Browser
Species Human (GRCh38)
Location 1:93092238-93092260
Sequence TTCTAAAGAATGTTAATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910994739 Original CRISPR TTCTAAAGAATGTTAATAGT TGG (reversed) Intronic
901568124 1:10136002-10136024 TTATAAATAATGTTACTACTGGG - Intronic
903399793 1:23033582-23033604 TTCTAAACAAATTTAAAAGTTGG - Intronic
905152238 1:35939496-35939518 TTGTAGAGGATGTTGATAGTAGG + Intronic
907881278 1:58551210-58551232 TTCCAAATACTGTTAATATTGGG - Intergenic
908213898 1:61931127-61931149 GTCTAAAGCATGTTAAGAGCTGG + Intronic
908895744 1:68896509-68896531 ATATAAAGAATGTTAAAGGTAGG - Intergenic
909153269 1:72036102-72036124 TTCTAAAAACTGTGAATTGTAGG - Intronic
909866798 1:80683970-80683992 TTGTTAAACATGTTAATAGTAGG - Intergenic
910299184 1:85686254-85686276 TTAAAAAGAATGTTAAGGGTGGG - Intronic
910994739 1:93092238-93092260 TTCTAAAGAATGTTAATAGTTGG - Intronic
911629748 1:100169689-100169711 TTCTAATGAATGTGAATATTTGG + Intronic
911869871 1:103083376-103083398 TTCTACATAATGTTATTACTTGG - Intronic
912178926 1:107194139-107194161 TTCTGAAGAATGCTAAGAGTTGG - Intronic
912660259 1:111521718-111521740 CTCTTAAGAATGTAAAAAGTTGG - Intronic
913618124 1:120582412-120582434 TTCTGCAAAATGTTAATTGTGGG + Intergenic
914996927 1:152552094-152552116 TTCTTAAGAATGTTGAATGTTGG + Intronic
915709543 1:157882365-157882387 TGCAAAAGAATGTTCATTGTTGG - Intronic
916400571 1:164443814-164443836 TTATAAAAAATTTTAACAGTGGG - Intergenic
916434845 1:164768448-164768470 ACCCAGAGAATGTTAATAGTAGG - Intronic
919863792 1:201763187-201763209 TTCTAAAGATTTTGATTAGTGGG + Intronic
919964406 1:202507609-202507631 TTCTAAAGAATGTCATTAGTTGG - Intronic
921009799 1:211130324-211130346 TACCAAAGAAAGTTAAAAGTCGG + Intronic
921528098 1:216243281-216243303 TTTTAAAAAATGATAATAATGGG + Intronic
922658598 1:227408956-227408978 TGCTAAAAAATGTTAATGATAGG + Intergenic
923356966 1:233166839-233166861 TTCTAAAGAAATTTAAAAATAGG + Intronic
923970289 1:239194498-239194520 AACTAAAAATTGTTAATAGTGGG + Intergenic
924549896 1:245065853-245065875 TTCTAAAGAGTGTAAACAGAAGG - Intronic
1062859449 10:798925-798947 TCCTTAAGAATGCTGATAGTAGG - Intergenic
1063979139 10:11439860-11439882 TTCTAAAGAATGTGGCTATTTGG + Intergenic
1065183025 10:23145793-23145815 TGCTAAAGAATTATGATAGTTGG - Intergenic
1067781578 10:49211313-49211335 CTCTAAAAAATCTTAATAATTGG + Intergenic
1067859432 10:49829461-49829483 TTATAAAAAATGTTCATGGTGGG - Intronic
1068280449 10:54862056-54862078 TTCTAAAGAATCTTCAGAGATGG + Intronic
1070944472 10:80377678-80377700 GTCTAAAGAATATTATTAGTTGG - Intergenic
1073011245 10:100361455-100361477 TTCTAAAGCAGGTAAATTGTCGG + Exonic
1073804096 10:107077524-107077546 TTATAAAGACAGTTAATAATTGG + Intronic
1074270259 10:111946528-111946550 TTTTAAAGAATGTTAAATATTGG - Intergenic
1075760766 10:124854563-124854585 TTCCAGAGAATGGTAATAGATGG - Intergenic
1075774614 10:124973542-124973564 TTTTAGAGAAAGTTACTAGTAGG + Intronic
1077963597 11:7102272-7102294 TTCTAAATAATAGTAAGAGTTGG + Intergenic
1078788338 11:14519091-14519113 TCTTAATGAATGTTAAGAGTTGG - Intronic
1080670700 11:34373857-34373879 TTCTTAAAGATGTTAATAATAGG - Intergenic
1081020713 11:37945384-37945406 TTCTTAAGAATACTAAAAGTAGG + Intergenic
1081087754 11:38822462-38822484 TTATGCAGAATGTTGATAGTAGG - Intergenic
1081251612 11:40842303-40842325 TTCTGAAGAATGTTAAGAGTTGG - Intronic
1081295979 11:41389894-41389916 TTCTTAAGTATGTTAATTTTGGG - Intronic
1084109798 11:67006782-67006804 TTCTAGAAAATGTTAATTGGGGG + Exonic
1085948568 11:81302041-81302063 ATTTAAAGAAAGCTAATAGTGGG + Intergenic
1086603225 11:88661580-88661602 TTTTAAAAAATTCTAATAGTGGG + Intronic
1087093161 11:94296063-94296085 CTCTGAAAAATGTTAATAGTTGG - Intergenic
1087491373 11:98831364-98831386 TTCTAGAGAATGTTCTTAATTGG - Intergenic
1087521765 11:99247173-99247195 TTACAATGAATGTTAAGAGTAGG + Intronic
1087710183 11:101539677-101539699 TTCTAAAGTATGTTTAGATTAGG - Intronic
1088132200 11:106506831-106506853 TTCTAAAGAACATTAGGAGTTGG + Intergenic
1088524277 11:110736042-110736064 TTGGAAAGAGTGTTAATATTTGG - Intergenic
1088801584 11:113312134-113312156 TTTTAATGAATGCTAATAGGTGG + Intergenic
1090631565 11:128653657-128653679 TTCAGAAGAATGTTAATGGAAGG - Intergenic
1090878048 11:130808709-130808731 CTCTAAAGGATGTTAATCTTGGG - Intergenic
1093572707 12:20685919-20685941 TTCTCAAGAATGTTTAAATTTGG + Intergenic
1095542615 12:43328624-43328646 CTGTAAAGAATGTCAATGGTAGG + Intergenic
1097885438 12:64724370-64724392 CTCTAAAGAATGCTAAATGTGGG + Intronic
1098995766 12:77117728-77117750 TTCTATGCAATGTTTATAGTGGG + Intergenic
1099337063 12:81375942-81375964 TTCTAAATTATTTTAATTGTAGG - Exonic
1099589413 12:84568384-84568406 GTCTAAAGAGTGTCAATTGTAGG + Intergenic
1099866401 12:88287728-88287750 TTCTGTAGGATGTTAATATTAGG + Intergenic
1100454919 12:94742444-94742466 TTTTAAAAAATGTTAGTCGTCGG - Intergenic
1100846702 12:98666475-98666497 TTATATAAAATGTTAATATTAGG - Intronic
1101002313 12:100368969-100368991 TCGTAAAGAATGTTAAGAATTGG + Intronic
1104169091 12:126262606-126262628 TTTTAAAGAATCCTAGTAGTGGG - Intergenic
1105338161 13:19494236-19494258 TTCTAAACAATGTTAAAATGTGG + Intronic
1106666402 13:31855698-31855720 TACTAAAGAAGGTAAATTGTAGG + Intergenic
1107776484 13:43849181-43849203 TTCAAAAGAATCTTAACAGAGGG + Intronic
1108467499 13:50731446-50731468 TACTTAAAAATGTTAAAAGTTGG + Intronic
1108534424 13:51359089-51359111 TTCTCAAGATTGTTTATAGGTGG - Intronic
1108740401 13:53331512-53331534 TTCAAATGACTGCTAATAGTGGG + Intergenic
1109880182 13:68462892-68462914 TTCTAAAAAATATTACTGGTGGG + Intergenic
1109993459 13:70089387-70089409 TTTTAGAGAATGTTAATAGCAGG + Intronic
1110674406 13:78223210-78223232 TTCTAAAGACTGTAACTGGTAGG - Intergenic
1110691767 13:78438716-78438738 ATCTAAAGAATTTTTATTGTAGG - Intergenic
1114844657 14:26306811-26306833 TTCTAAAGAATGTAAACAATGGG - Intergenic
1115286541 14:31719903-31719925 TTTAAAAGAATATTAATAGCAGG - Intronic
1116437883 14:44914241-44914263 TTATAAAGTAAGTTAATAGCTGG - Intergenic
1116710733 14:48365303-48365325 TTTTAAAAAATGTTAAAAGCTGG - Intergenic
1116912913 14:50490394-50490416 TTCTAAATGATGTTAACATTGGG + Intronic
1118534721 14:66748462-66748484 TGGTAAAGAATGTTGATAATGGG - Intronic
1118588927 14:67385822-67385844 TTCTTAATAATGTTCAAAGTTGG + Exonic
1119940218 14:78632933-78632955 TTAAAAAGACTGGTAATAGTCGG + Intronic
1120925659 14:89794858-89794880 TCATATATAATGTTAATAGTAGG - Exonic
1121970803 14:98354389-98354411 TTCTTAGGAATGTTAATTGTGGG - Intergenic
1122277077 14:100597256-100597278 TTCCAAAGTCTGTTACTAGTTGG - Intergenic
1123541030 15:21291654-21291676 TTACAAAGAATGTTAAAATTTGG + Intergenic
1123952509 15:25295293-25295315 TTTTAAAGGATTTTAAAAGTTGG - Intergenic
1124872431 15:33556424-33556446 TTCCAAACAATGATAATAGTGGG + Intronic
1125129205 15:36261503-36261525 TTATAAAGTTTGTTCATAGTTGG - Intergenic
1125151137 15:36533619-36533641 TTCTTAAGAATGAAAATACTTGG - Intergenic
1126246806 15:46516895-46516917 ATCTAAAGAAAGCTAATAGTGGG + Intergenic
1126338687 15:47615639-47615661 TTCTAATGTATTTGAATAGTTGG + Intronic
1126843083 15:52735953-52735975 CTCTTAGGAATGTTAATATTAGG - Intergenic
1127218368 15:56849182-56849204 TTCTAACCATTATTAATAGTAGG - Intronic
1202949343 15_KI270727v1_random:18795-18817 TTACAAAGAATGTTAAAATTTGG + Intergenic
1132812188 16:1805830-1805852 TTCTGAAGATTGTGAATGGTTGG + Intronic
1133508493 16:6434983-6435005 ATCCAAAGAATGTTAATAAATGG - Intronic
1133614711 16:7465167-7465189 TTGTAAAGAATGTCAAAAGGAGG - Intronic
1137586675 16:49668042-49668064 TGCTAAAGAAAGTTTGTAGTTGG - Intronic
1138936901 16:61737513-61737535 TTGGAAATAATGTCAATAGTGGG + Intronic
1143917167 17:10302601-10302623 TTCTGAGGGATGTTAATAGCAGG - Intronic
1144248430 17:13391547-13391569 TTCTATAAGATGTTAATATTAGG - Intergenic
1145184978 17:20786249-20786271 TTCTAAAGCAGGTAAATTGTTGG + Intergenic
1146807922 17:35880084-35880106 TTCATAAGAATGTAAATAATGGG + Intronic
1148155452 17:45422461-45422483 TTTCAAAAAATGATAATAGTAGG + Intronic
1148921526 17:51039426-51039448 TTGTAAATCATGTTACTAGTTGG - Intronic
1149394385 17:56224617-56224639 TTCTAATGAGTGTCAATTGTAGG + Intronic
1150104382 17:62451460-62451482 TTTTAAAAAATGTTAAAAATAGG + Intergenic
1150143796 17:62751456-62751478 TTCTCATGAATGTTAATGTTTGG + Intronic
1150221780 17:63499780-63499802 ATCTAAAGAATGATACTATTGGG - Intronic
1150275237 17:63893498-63893520 TTCTAAAGAAGATTAATTGGGGG + Intergenic
1150910145 17:69379392-69379414 ATATAAAAAATGTTAAAAGTTGG - Intergenic
1150992559 17:70276752-70276774 TTCTACATAATGTTAGGAGTGGG + Intergenic
1153926249 18:9837863-9837885 TTCTATGGAATGTTGATAATTGG + Intronic
1154366860 18:13718395-13718417 AACTACAGAATGTTAAGAGTTGG + Intronic
1154504039 18:15017049-15017071 CTCTTAAGTATGTTTATAGTAGG - Intergenic
1154532584 18:15362662-15362684 CTCTAAAGAATGTTATCTGTTGG + Intergenic
1155503013 18:26505720-26505742 TACAAAAAAATGTTATTAGTTGG - Intronic
1156123536 18:33874941-33874963 AGCTAATGAATGTTAAGAGTTGG + Intronic
1156217913 18:35019907-35019929 TTCTTAAGAATATTATTATTTGG - Intronic
1156233438 18:35178069-35178091 TTCAAAAGATTGTTATTAATGGG + Intergenic
1157958978 18:52131353-52131375 TTCTAGTGAATATTAATAATGGG + Intergenic
1158051616 18:53227596-53227618 TTGAGAAGTATGTTAATAGTAGG + Intronic
1158092785 18:53734787-53734809 TTCCAAAGAATGTGAATTTTGGG + Intergenic
1158159108 18:54459819-54459841 TTCTCAAGAGTGATAATACTGGG + Intergenic
1158285691 18:55879555-55879577 TACTAAAGCATGTTGATGGTGGG - Intergenic
1159412721 18:68102878-68102900 TTTTAAAGCATGTTATTAGTGGG + Intergenic
1164797801 19:31048536-31048558 TTCTAATGTATGTTAATAGTGGG - Intergenic
925648021 2:6056983-6057005 TTCTTAAAAATGTTAGTATTTGG + Intergenic
926822219 2:16864765-16864787 TACTAAAGAATCTTAAAAATTGG - Intergenic
928621861 2:33097963-33097985 TCTTAAAGAATGTGATTAGTAGG + Intronic
928994961 2:37279261-37279283 TTTTACAAAATGCTAATAGTCGG + Intronic
929327250 2:40630869-40630891 TTCTACTTATTGTTAATAGTGGG - Intergenic
931251992 2:60540097-60540119 TTTGAAATAATGTTAAAAGTGGG + Intronic
932878157 2:75474553-75474575 TTCCAAAGAATGTGAACAGCAGG + Intronic
933487952 2:82947123-82947145 TTCCAAATAATGTTAAAAGAGGG - Intergenic
933501740 2:83120890-83120912 TTTTGAAAAATGTTAATACTTGG - Intergenic
935680699 2:105634538-105634560 TTCTAGAAATGGTTAATAGTTGG + Intergenic
936878223 2:117217997-117218019 TTCTAAACAGTGCTGATAGTTGG - Intergenic
939677152 2:145086620-145086642 TTCTAAAGAAAGGTGATGGTGGG - Intergenic
939937168 2:148307054-148307076 TTGTCAAAAATGTTAAAAGTTGG + Intronic
940050939 2:149464048-149464070 TTGTAAGGAATATTAATAATAGG - Intronic
940230052 2:151441302-151441324 TTCAAAGGACTGCTAATAGTTGG - Intronic
941272029 2:163442056-163442078 CTCTAAAGAATTTTAACAGGGGG + Intergenic
941628179 2:167853570-167853592 TGTTAATAAATGTTAATAGTGGG + Intergenic
943396776 2:187347672-187347694 TTCTATAGAATGTTTGTAATTGG - Intronic
943439818 2:187915005-187915027 TGGCAAAGAATGTCAATAGTAGG - Intergenic
943661272 2:190561900-190561922 TTTTAAAAAATTTTAAAAGTTGG - Intergenic
943910513 2:193560632-193560654 TTCTATAAACTGTTAATATTAGG - Intergenic
944469534 2:200038138-200038160 TTTTAAATAATGATAATACTGGG - Intergenic
945604956 2:211917643-211917665 TGCTAAAAAATGCTAAAAGTGGG + Intronic
946694873 2:222345318-222345340 TTGTCATGAATTTTAATAGTTGG + Intergenic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
947931772 2:233970640-233970662 CTCTAATGAATGTTAATTGATGG + Intronic
948744434 2:240076470-240076492 TGCTGAAGGATGTTAATATTAGG + Intergenic
1170286254 20:14712909-14712931 TTGAAAAGACTGTCAATAGTGGG + Intronic
1170383447 20:15787689-15787711 TTTTAAAGCATTTTAAAAGTTGG - Intronic
1171475321 20:25404239-25404261 GTCTAAAGACTGTCAATAGAAGG - Intergenic
1172464498 20:35146136-35146158 TACAAAGGAAAGTTAATAGTTGG + Intronic
1173349290 20:42230449-42230471 TTTTAAAGGATATTAAGAGTTGG - Intronic
1173444740 20:43107305-43107327 TTCTAAAGGTGGTGAATAGTTGG - Intronic
1174850748 20:53991920-53991942 TTCTCCAGAATGTTAGTAGAAGG - Intronic
1175181401 20:57150429-57150451 TTCTGAAGAATTTTAATATTAGG - Intergenic
1176764776 21:13005547-13005569 CTCTAAAGAATGTTATCTGTTGG - Intergenic
1177587947 21:23123290-23123312 TTATAAAGAATTTTAATATCTGG - Intergenic
1177993187 21:28062886-28062908 CTCTTAAGTATGTTTATAGTAGG + Intergenic
1178575290 21:33782723-33782745 ATCTTAAGAATGTTAATTCTTGG + Intronic
1179295846 21:40061624-40061646 TTCAAAACAATGTGAATCGTAGG - Intronic
1184952914 22:47857781-47857803 TTCTAGATTATGTTAATATTTGG + Intergenic
949090472 3:22064-22086 TTCTAAAGCATTTTAATCATTGG - Intergenic
950327752 3:12128243-12128265 TCATAAAGAATGTAAATAATTGG - Intronic
953095687 3:39773471-39773493 TTAGAAAGAATAATAATAGTAGG + Intergenic
953283755 3:41584118-41584140 TTATAAAGAATGGTATCAGTGGG + Intronic
954978443 3:54721402-54721424 TTTTAAAGAATGTTTTTAATGGG + Intronic
955635051 3:61019272-61019294 TTATAAAGAATTATATTAGTCGG + Intronic
955991947 3:64637350-64637372 TTTAAAAGGATCTTAATAGTTGG - Intronic
956280661 3:67552979-67553001 TTCTAAATTATGTGATTAGTGGG - Intronic
957030803 3:75238284-75238306 TTCTAAAGCATTTTAATCATTGG - Intergenic
957366607 3:79232570-79232592 TTCTTTAGAATGTTTAGAGTTGG - Intronic
957825472 3:85436788-85436810 TGGCAAAGGATGTTAATAGTGGG - Intronic
958009011 3:87850971-87850993 TTCTAAAAATTGTTATTATTTGG + Intergenic
959811996 3:110630251-110630273 ATCTAATGAATCTTAAAAGTAGG - Intergenic
960106122 3:113798985-113799007 TTCCAAAAAAGGTTAATATTAGG + Intronic
960368499 3:116804878-116804900 TTATAAAGAATTTTGATACTCGG + Intronic
960717335 3:120589738-120589760 TTTTCTAGAATGTCAATAGTTGG - Intergenic
961073240 3:123957441-123957463 TTCTAAAGAATGTACATAAAAGG - Intronic
961310440 3:125995641-125995663 TTCTAAAGAATGTACATAAAAGG + Intergenic
962041179 3:131708755-131708777 TTCAAAAGAAAGTGAAAAGTTGG + Intronic
963288010 3:143455647-143455669 TTCAAAAAAATGTAAATACTTGG - Intronic
964459132 3:156902936-156902958 TTAAAAATAATGTTTATAGTAGG - Intronic
964828539 3:160857197-160857219 TTTTAAAGAATGTAATTAGAAGG - Intronic
965892566 3:173532911-173532933 TTCTAAAGACTGCCAACAGTGGG + Intronic
965994752 3:174867793-174867815 TTTTCAAGAATAATAATAGTTGG + Intronic
966104327 3:176317610-176317632 TTCTAAAGAAGGTTTATATATGG - Intergenic
966236784 3:177710241-177710263 TTCTAATGATTTTTAATAGGTGG + Intergenic
966574857 3:181488933-181488955 TTATAAAGAATGTTATTACTAGG + Intergenic
967930048 3:194684618-194684640 TTCAAAGGAAGGTTAAAAGTTGG + Intergenic
968244836 3:197134357-197134379 TTAAAAAGAATGCTACTAGTAGG + Intronic
969079438 4:4607091-4607113 TCCTAAAGAATGTTACTAGGGGG - Intergenic
969991230 4:11265171-11265193 TTCTTCAAAATGTTAATACTTGG + Intergenic
971148321 4:24004003-24004025 TTTCAAAGAATGTTAAAATTTGG + Intergenic
971550341 4:27947176-27947198 TTCAGAAGAAGGTTAATTGTTGG + Intergenic
972825229 4:42750607-42750629 TCCTAGAGAGTGTCAATAGTGGG + Intergenic
972881542 4:43429212-43429234 CTCAAAAGAAAGTTAATTGTGGG + Intergenic
973234280 4:47881803-47881825 TTTTCCAGAATGTCAATAGTTGG - Intronic
973537974 4:51903897-51903919 TTCTAGAACATGTTTATAGTAGG + Intronic
974226795 4:59056829-59056851 TTATAAATAATGTCAATAATAGG + Intergenic
974552385 4:63395505-63395527 TTATAAAGATAGTTATTAGTAGG - Intergenic
974959936 4:68685427-68685449 TTCAAAAACATGGTAATAGTTGG + Intergenic
975701149 4:77067875-77067897 TGCTAAAGAATGTGAAAAGGTGG + Intronic
977276678 4:94985906-94985928 TTCTACAGACTGTTAGGAGTTGG + Intronic
978136247 4:105264216-105264238 TTTTAAACACTATTAATAGTTGG + Intronic
978253081 4:106656978-106657000 ATCTAAATAATGCTAATAATAGG - Intergenic
980288399 4:130811696-130811718 TCATAAAGAATATTAAAAGTCGG - Intergenic
980552936 4:134363897-134363919 TTCTAAAGAAGAAAAATAGTTGG - Intergenic
981159369 4:141479071-141479093 TTCAAAAAAATTTTAAAAGTTGG - Intergenic
982043851 4:151422090-151422112 CTCTAATGAATGTTCCTAGTGGG - Intronic
983337123 4:166410446-166410468 TTCTAAAGAATATTTTTACTAGG - Intergenic
983785080 4:171720152-171720174 TTCTTAAGAATGTTAAAAATAGG - Intergenic
984202967 4:176749296-176749318 TTTAAAAGAAGTTTAATAGTTGG - Intronic
984720884 4:182971468-182971490 TTCCACAGAATATTAATATTAGG - Intergenic
986107389 5:4672809-4672831 TTCAAAAAAATGTTAAGGGTGGG + Intergenic
986525440 5:8669251-8669273 ATATAAAGAATGGAAATAGTGGG - Intergenic
986732606 5:10646326-10646348 TTGTATAAAATGTTAATAATCGG + Intronic
987043456 5:14084910-14084932 GGCTACAGAATGTTAATAGGTGG + Intergenic
992108843 5:73473468-73473490 CTCTAAAGTCTGTTAGTAGTGGG - Intergenic
992732386 5:79685114-79685136 TTTAAAAGAATGTTAATAGTTGG - Intronic
993061222 5:83041500-83041522 TTCTAGAGGATGTTATTAGGAGG + Intergenic
994037587 5:95219815-95219837 TTCTAAATGAGCTTAATAGTGGG - Intronic
994074045 5:95631172-95631194 TGCTAAAGTATGTCAATAGCAGG - Intergenic
994077412 5:95669139-95669161 TTCTACAGAATGTTAACACTGGG - Intronic
994965622 5:106667082-106667104 TAATATAAAATGTTAATAGTAGG + Intergenic
995258468 5:110074082-110074104 TTTTAAAGAATGTTGAATGTTGG + Intergenic
995862494 5:116656506-116656528 TTCTATTGCATGTTCATAGTAGG - Intergenic
996425639 5:123311257-123311279 TTTTAAAGAATGTTAAATTTTGG + Intergenic
996546439 5:124683794-124683816 TTCTAAGGAATCTTAATACAAGG + Intronic
1000277029 5:159747002-159747024 TTCAAAAAATTGTTAGTAGTTGG + Intergenic
1000894940 5:166844276-166844298 TTCTAAAGAATAAAAATAGAGGG + Intergenic
1001208282 5:169785423-169785445 CTCTAAAATGTGTTAATAGTGGG - Intronic
1001407289 5:171485031-171485053 TTCAAAATAATGATAATGGTAGG + Intergenic
1001741233 5:174054552-174054574 TTTTAAAGACTTTTAATAGACGG + Intronic
1003727074 6:8777048-8777070 TTATTAAGAATGTTAATTGGTGG + Intergenic
1003954864 6:11153235-11153257 TATTAAAGCATGTTAATATTTGG - Intergenic
1004188023 6:13438678-13438700 ATCTATAAAATGTTAACAGTGGG - Intronic
1005090810 6:22055141-22055163 TACTAAAGAAAGTTAACAATTGG - Intergenic
1006395880 6:33787561-33787583 TTGTAAAGAGTATTAAAAGTTGG + Intronic
1008118567 6:47583198-47583220 TGGTACAGAATGTTAACAGTGGG - Intronic
1008624373 6:53303248-53303270 TTCTAAAGCTTGTTAGTACTTGG - Intronic
1008871918 6:56282242-56282264 TTCTAAAGAATTTTAAAAATGGG + Intronic
1009221551 6:60990291-60990313 TTTTTAAGAATGCTAAAAGTAGG + Intergenic
1009483119 6:64185557-64185579 TTTTAAAGCAGGTTCATAGTAGG - Intronic
1011452762 6:87512955-87512977 TTCTAAATGTTGCTAATAGTAGG - Intergenic
1011485055 6:87832646-87832668 TTGGAAAGGATGTCAATAGTTGG - Intergenic
1012069707 6:94598199-94598221 TTCTAAAGAATTTTAAGAATAGG + Intergenic
1012093824 6:94933124-94933146 TCTTAAAGAATGATATTAGTAGG + Intergenic
1012211927 6:96530236-96530258 TTTTATAGAATGTTCATTGTTGG + Intronic
1012807987 6:103919564-103919586 TTCAAAAGAATGTTCACAGTTGG + Intergenic
1013223366 6:108100023-108100045 TGGTAGAGCATGTTAATAGTAGG + Intronic
1013385435 6:109625100-109625122 TTCCAGAGCATGTTAATAATTGG + Intronic
1013759427 6:113499648-113499670 ATTTCAAGAATGATAATAGTTGG - Intergenic
1013942932 6:115687723-115687745 GTCCAAAGAATGTTAAAAGTTGG + Intergenic
1014034702 6:116752851-116752873 TTCTAACATATGTTAATAATGGG + Intronic
1015442745 6:133267846-133267868 TTCTTAGGAAAGTTAATACTGGG + Intronic
1015747696 6:136527659-136527681 TTATAAAGTATAATAATAGTTGG - Intronic
1016903667 6:149128181-149128203 TTTTATAGAATGTTAATATTGGG + Intergenic
1017475470 6:154786849-154786871 TTTTAAATAATTTTAATACTTGG - Intronic
1020638201 7:10722702-10722724 TTCTAAAGATTTTTAAATGTAGG - Intergenic
1020892145 7:13891681-13891703 TTCAAAAAGATGGTAATAGTTGG - Exonic
1021945445 7:25721582-25721604 TTCACAAGAATGTCAATAGGTGG + Intergenic
1022298598 7:29081230-29081252 TTATAAAGAAAGTTAATTATGGG + Intronic
1022299212 7:29087124-29087146 TACTAAAGAATGCTAACAGCCGG + Intronic
1024466350 7:49715348-49715370 TTCTAAAGAAAGAGTATAGTAGG + Intergenic
1025032306 7:55567815-55567837 TTCTAAAAACTCTTAAGAGTGGG + Intronic
1026073118 7:67140447-67140469 TTTTAAAAAATGTTTAAAGTTGG + Intronic
1026626117 7:71994089-71994111 TTCTTAAAAATTTTTATAGTAGG - Intronic
1027926402 7:84469869-84469891 TTCCAAATCATGTTGATAGTTGG + Intronic
1028307822 7:89288896-89288918 CTCTAAAGTATGATAATAATAGG + Intronic
1028433305 7:90772851-90772873 TTCTACAGAACTTTAATAATTGG - Intronic
1030509232 7:110464250-110464272 TTCTACAAAGTGTTAATAATAGG + Intergenic
1030591128 7:111483131-111483153 TTCTATATAATGTTAATATTAGG + Intronic
1031371786 7:120976975-120976997 TCACAAAGAATATTAATAGTTGG - Exonic
1034627067 7:152501845-152501867 TTTTAAAGAATTGTTATAGTAGG + Intergenic
1035845584 8:2860999-2861021 TTTTAAACACTGTCAATAGTTGG - Intergenic
1035939425 8:3880241-3880263 TTCTCATGAATGTTAAGAGAAGG - Intronic
1039201628 8:35100806-35100828 TTCTAAAGAATGTTTACAAGTGG - Intergenic
1043085199 8:75822583-75822605 TTCTATATGATATTAATAGTGGG + Intergenic
1043274828 8:78379786-78379808 TTCTAAAGAAATTTAGTAGTGGG + Intergenic
1043376410 8:79654692-79654714 TTCTATAGAATGTGGCTAGTTGG - Intronic
1044158222 8:88877622-88877644 TTCTAAAGAATATTTTTACTTGG + Intergenic
1044172605 8:89074139-89074161 TGGTAAAGAATGTCAACAGTAGG + Intergenic
1044617902 8:94161015-94161037 TCCTAAAGAAGGTTATAAGTAGG + Intronic
1044789794 8:95835643-95835665 TCCTAAATGATGTTAAGAGTGGG + Intergenic
1045804383 8:106140117-106140139 TTGTAAAGAATGTTCATTCTGGG - Intergenic
1045905635 8:107341367-107341389 TTCTTAAGAATGTCAATATCAGG + Intronic
1046066942 8:109208490-109208512 TTCTAAAGCCTGTTAATTATAGG - Intergenic
1046418399 8:113945490-113945512 CTGTAATGAATGTTAATATTTGG - Intergenic
1046440917 8:114253298-114253320 TTCTCAACAGTGATAATAGTAGG + Intergenic
1046470944 8:114673015-114673037 TTTTAAAGAATATTTATATTAGG + Intergenic
1048289123 8:133166384-133166406 TTTTAAAAGATATTAATAGTTGG + Intergenic
1048521055 8:135155695-135155717 TTATAAAGAATGTCGATACTAGG - Intergenic
1048715195 8:137260743-137260765 TTCTTTAGAATATTAATAATGGG - Intergenic
1050214111 9:3303032-3303054 GTCTAAAAAAAGTTAACAGTAGG - Intronic
1050385333 9:5083958-5083980 CTCAAAAGAATATTAATAATGGG - Intronic
1051490901 9:17663375-17663397 TTTTAAAAAATTTTAATAGGAGG - Intronic
1051802223 9:20948564-20948586 TTCAAAAAAATTATAATAGTTGG - Intronic
1052342057 9:27373597-27373619 TTCTATAGAATTTTCATTGTAGG - Intronic
1052482646 9:29051098-29051120 TCCTAAGGAATGTTGATAATAGG - Intergenic
1052811241 9:33062494-33062516 GTATATAAAATGTTAATAGTGGG - Intronic
1057332833 9:94131721-94131743 TGATATAGAATGTTAATAATAGG + Intergenic
1058285090 9:103168121-103168143 TTCTAAAGAACTTGAATATTGGG + Intergenic
1059728670 9:117034631-117034653 TTGTAAAGAATATTAATATGTGG + Intronic
1060099178 9:120823112-120823134 GTCTCAAGAATTTTAATAATTGG + Intronic
1060631256 9:125161006-125161028 TTCTTAAAAATGTAAATATTTGG - Intronic
1060708312 9:125829454-125829476 TTCTTAAGAATTCTAATATTAGG + Intronic
1188221848 X:27550253-27550275 TTTTAAATTATGTTAATAATTGG + Intergenic
1188605504 X:32024111-32024133 TTCCAAAGAATGTTAGTATGAGG - Intronic
1189452834 X:41155237-41155259 ATCTAAATAATGTTTATAGGAGG - Intronic
1191093704 X:56652682-56652704 TTATAAAGAGACTTAATAGTGGG - Intergenic
1193762691 X:85487575-85487597 TTTTAAAGAATGTTGAATGTTGG + Intergenic
1194309694 X:92289992-92290014 TTTTATATAAGGTTAATAGTGGG + Intronic
1196263404 X:113613030-113613052 TGGTGCAGAATGTTAATAGTGGG - Intergenic
1196642093 X:118073932-118073954 TTATAAAGTATGTTAAGGGTAGG - Intronic
1196764693 X:119232385-119232407 TTTTTAAGAATGGTAATACTTGG - Intergenic
1197028065 X:121779654-121779676 TTCTTAAGATTAATAATAGTAGG + Intergenic
1198588162 X:138145933-138145955 TTCAAAAGAAGGTAAAGAGTTGG + Intergenic
1200483020 Y:3731790-3731812 TTCTAAAGAATGTTGAATATAGG - Intergenic
1200617987 Y:5404259-5404281 TTTTATATAAGGTTAATAGTGGG + Intronic
1202300043 Y:23403480-23403502 TTCTAAAGAATGTCATTAGTTGG - Intergenic
1202570767 Y:26267118-26267140 TTCTAAAGAATGTCATTAGTTGG + Intergenic