ID: 911002534

View in Genome Browser
Species Human (GRCh38)
Location 1:93180703-93180725
Sequence CGTCCCAACGGCTCCCGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911002529_911002534 5 Left 911002529 1:93180675-93180697 CCGGGGCGGGGCAGTGACCGGGT 0: 1
1: 0
2: 0
3: 16
4: 215
Right 911002534 1:93180703-93180725 CGTCCCAACGGCTCCCGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 50
911002523_911002534 21 Left 911002523 1:93180659-93180681 CCTCACGCAGTCTGCGCCGGGGC 0: 1
1: 0
2: 1
3: 7
4: 104
Right 911002534 1:93180703-93180725 CGTCCCAACGGCTCCCGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911002534 Original CRISPR CGTCCCAACGGCTCCCGCGG CGG Exonic