ID: 911002534 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:93180703-93180725 |
Sequence | CGTCCCAACGGCTCCCGCGG CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 56 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 50} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
911002529_911002534 | 5 | Left | 911002529 | 1:93180675-93180697 | CCGGGGCGGGGCAGTGACCGGGT | 0: 1 1: 0 2: 0 3: 16 4: 215 |
||
Right | 911002534 | 1:93180703-93180725 | CGTCCCAACGGCTCCCGCGGCGG | 0: 1 1: 0 2: 0 3: 5 4: 50 |
||||
911002523_911002534 | 21 | Left | 911002523 | 1:93180659-93180681 | CCTCACGCAGTCTGCGCCGGGGC | 0: 1 1: 0 2: 1 3: 7 4: 104 |
||
Right | 911002534 | 1:93180703-93180725 | CGTCCCAACGGCTCCCGCGGCGG | 0: 1 1: 0 2: 0 3: 5 4: 50 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
911002534 | Original CRISPR | CGTCCCAACGGCTCCCGCGG CGG | Exonic | ||