ID: 911002572

View in Genome Browser
Species Human (GRCh38)
Location 1:93180885-93180907
Sequence GAGCGACTGCGCCTTGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911002567_911002572 -1 Left 911002567 1:93180863-93180885 CCCCAGCGACGATTTGGGTGGTG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 911002572 1:93180885-93180907 GAGCGACTGCGCCTTGGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 149
911002563_911002572 13 Left 911002563 1:93180849-93180871 CCGGGTGGGTCTCTCCCCAGCGA 0: 1
1: 0
2: 1
3: 16
4: 108
Right 911002572 1:93180885-93180907 GAGCGACTGCGCCTTGGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 149
911002568_911002572 -2 Left 911002568 1:93180864-93180886 CCCAGCGACGATTTGGGTGGTGA 0: 1
1: 0
2: 0
3: 0
4: 36
Right 911002572 1:93180885-93180907 GAGCGACTGCGCCTTGGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 149
911002569_911002572 -3 Left 911002569 1:93180865-93180887 CCAGCGACGATTTGGGTGGTGAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 911002572 1:93180885-93180907 GAGCGACTGCGCCTTGGCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911002572 Original CRISPR GAGCGACTGCGCCTTGGCGT GGG Intronic