ID: 911002948

View in Genome Browser
Species Human (GRCh38)
Location 1:93185626-93185648
Sequence CATAAGGAGAGGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 572}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911002948 Original CRISPR CATAAGGAGAGGAGGGAAGT GGG Intronic
901300772 1:8198688-8198710 GAGAAGGGGAGGAGGAAAGTGGG - Intergenic
901737326 1:11320614-11320636 CATGGGCAGAGGAGGGAAGGTGG - Intergenic
902290558 1:15432215-15432237 CTTAATGAGAGGAGGGAACCTGG - Intergenic
902777102 1:18682157-18682179 CTCAAGGAGAGGAGGGAGGGAGG - Intronic
902830699 1:19010495-19010517 TGGAAGGAGAGGAGGGAAATGGG + Intergenic
904497615 1:30895904-30895926 GAGATGGAGAGGAGGGAGGTTGG + Intronic
904591803 1:31619128-31619150 CAGAGGGAGAGGAGGGAGCTTGG - Exonic
905564016 1:38948889-38948911 AAGAAGGAAAGGAGGGAAGGAGG + Intergenic
905602791 1:39268680-39268702 GATTAGGAGAGGAAGGAAATGGG + Intronic
905864937 1:41371621-41371643 CCTAAGGGCAGGAGGGAACTTGG - Intronic
905876198 1:41433408-41433430 TAAAAGGACAGGAGGGAGGTGGG - Intergenic
906438908 1:45823071-45823093 CATAAAAAGAAGAGTGAAGTTGG - Intronic
906450882 1:45946430-45946452 CATAAAGAGAGGGAGGAAATTGG - Intronic
908010503 1:59771706-59771728 CACAAGGAGGGGAAGTAAGTTGG - Intergenic
908333615 1:63097318-63097340 CATAATGAGAGGAAGTAAGTGGG + Intergenic
908677229 1:66619083-66619105 TTTAAGAAGAGGAGGTAAGTTGG - Intronic
909217933 1:72915553-72915575 TAGAAGTAGAGGAGGGAAATAGG - Intergenic
909883355 1:80908787-80908809 CGAAAGGAGAGGAGAGAAGAGGG + Intergenic
910734907 1:90442955-90442977 CAGAAGGAAAGGAGGGAGGGAGG + Intergenic
910735239 1:90446691-90446713 AATAAGGTGAGGAGGGAAGAAGG - Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911173734 1:94797184-94797206 CATAAACAGAGGAAGGAAGATGG + Intergenic
911461854 1:98201441-98201463 AAAAAGGAGAGAAGGCAAGTGGG + Intergenic
911584200 1:99671568-99671590 CATAAAGAAAGGAGAGAACTTGG - Intronic
911616544 1:100018446-100018468 AATCAGGAGAGGAGTAAAGTTGG - Intronic
911730351 1:101286410-101286432 CCTGAGGAGAGCAGAGAAGTCGG - Intergenic
911774560 1:101791774-101791796 CATAGGGACAGGAGGCATGTGGG + Intergenic
912214618 1:107594144-107594166 CAAAAGGAGAGAAGGGGTGTAGG - Intronic
913682621 1:121200992-121201014 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
914034464 1:143988621-143988643 CAGAAGTAGAAGAGGGGAGTAGG - Intergenic
914154988 1:145079349-145079371 CAGAAGTAGAAGAGGGGAGTAGG + Intronic
915509541 1:156378906-156378928 GATAAGGAGAGGAAGGGTGTTGG + Intronic
915532166 1:156508956-156508978 CATCAGCAGTGGAGGGAGGTGGG + Intergenic
915863619 1:159474702-159474724 CATAAGGAAAGGCTGGAAGATGG - Intergenic
917070170 1:171141896-171141918 AAGAAGGAGAGGTGGGAAGGAGG - Intronic
917600033 1:176564925-176564947 GGAAAGGAGGGGAGGGAAGTGGG - Intronic
918344887 1:183598404-183598426 AATACGGAGATGAGGGAAGTGGG + Intergenic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
918687868 1:187442224-187442246 CAGAAGGGGAGGGGGGGAGTTGG - Intergenic
919742722 1:200990462-200990484 CAAAAGGAGCAGAGGGAAGTGGG + Intronic
920469933 1:206219510-206219532 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
920634485 1:207686188-207686210 GAGAAGGAAAGGAGGGAAGGAGG - Intronic
922381119 1:225027571-225027593 CAGAAGGTGAAGAGGGAAGCAGG + Intronic
923051636 1:230394569-230394591 CACAAGGAGAGGAGGGGAGGGGG - Intronic
923051932 1:230395588-230395610 CATGAGGAGAGGAGGGGAGGGGG - Intronic
923658738 1:235940573-235940595 CATAAGTAGGGCAGGGAAGTGGG - Intergenic
924002969 1:239574316-239574338 AAGAAGGAGAGGAGGGCAGCTGG - Intronic
924300856 1:242636464-242636486 CAGAAGGTGAGCATGGAAGTAGG - Intergenic
924585721 1:245359659-245359681 AGTAAGGAAAGGAGGGAAGGAGG - Intronic
1062935098 10:1379661-1379683 CAGAAGTAGAGGAGGGGAGGAGG + Intronic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063223414 10:3992441-3992463 GACGAGGAGAGGAGGGGAGTGGG - Intergenic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063497787 10:6526455-6526477 ACTAAGCAGAGGAGGGAGGTGGG + Intronic
1063498035 10:6528112-6528134 CTTAAGGAGAGGGGGCAAGCAGG - Intronic
1063517308 10:6709600-6709622 CAGAGGGTGAGGAAGGAAGTGGG + Intergenic
1063638636 10:7809950-7809972 CAAAAGGAGAGGACAGAAGTTGG - Intergenic
1063708084 10:8450722-8450744 GATGAGGTGAGGAGGGAAATGGG - Intergenic
1063922279 10:10944953-10944975 CATCAGGAGAGGGGAGAAGGGGG + Intergenic
1064137000 10:12759489-12759511 AATGATGAGAGGAGAGAAGTTGG + Intronic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1064405683 10:15060050-15060072 CAGAAGGAGAGAAGAGAAGAGGG - Intronic
1065109379 10:22424892-22424914 TATAGGGAGAAGGGGGAAGTAGG + Intronic
1065153340 10:22845006-22845028 TATAAGGAGGTGAGGGATGTAGG + Intergenic
1066093500 10:32050077-32050099 CTAAAGGAAAGGAAGGAAGTTGG + Intronic
1066199200 10:33129052-33129074 CTTGAGGAGAGGGAGGAAGTTGG + Intergenic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067726516 10:48774951-48774973 GACAAAGAGAGGAGGGAACTGGG + Intronic
1068390503 10:56390297-56390319 AATAAGGAGAGGAGGCAAAAAGG - Intergenic
1068402003 10:56539926-56539948 CATAAAGAGAAGAGAGATGTTGG + Intergenic
1069004967 10:63307483-63307505 CATAAGGACAGGGGCAAAGTGGG + Intronic
1069294952 10:66831984-66832006 CATAAGGAAAGGAATGAATTTGG + Intronic
1069802934 10:71093541-71093563 GTTAAGGGGAGGAGGAAAGTTGG - Intergenic
1069824079 10:71244661-71244683 CAAGAGGAGAGGAGGGAGGAGGG + Intronic
1070054751 10:72924056-72924078 GATAACAAGAGGAGGGCAGTGGG + Intronic
1070063716 10:73012585-73012607 CATACGGAGAGGAAGGAGATAGG + Intronic
1071522642 10:86340699-86340721 TAGAAGGGGAGGAGGGAAGAAGG + Intronic
1073775869 10:106785350-106785372 AAGGAGGAGAGGAGGGATGTAGG - Intronic
1074056494 10:109926854-109926876 AATGGGGAAAGGAGGGAAGTAGG - Intergenic
1074258492 10:111828177-111828199 TATAAGGGGAAGAGGGAAGACGG + Intergenic
1074580837 10:114717909-114717931 CAAAAGGAGAGGAGAGAAGGGGG + Intergenic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075699442 10:124459718-124459740 CATAAGGGAAAGAGGGAAGCAGG - Intergenic
1075939417 10:126376806-126376828 TAAAAGGAGAGGAGGGGAGAAGG + Intronic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1075981442 10:126743691-126743713 GAAAAGGAAATGAGGGAAGTTGG + Intergenic
1076527155 10:131119057-131119079 CATTTGGAGAGGAGGTAAGGTGG + Intronic
1076773341 10:132679140-132679162 CACAGGGAGATGAGGGAGGTGGG + Intronic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1079387649 11:19995051-19995073 GATAAGGAAAGGAGTGCAGTAGG + Intronic
1079698726 11:23517830-23517852 AATTAGGTGAGGAGTGAAGTAGG - Intergenic
1079943512 11:26712187-26712209 CATAAGAAAGAGAGGGAAGTAGG + Intronic
1081622257 11:44625516-44625538 CATAAAAAGAGGAGAGGAGTAGG + Intergenic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1084122249 11:67076502-67076524 CCAAATAAGAGGAGGGAAGTCGG + Intergenic
1084775545 11:71372343-71372365 AATCAAGAGAGGAGGGAGGTTGG + Intergenic
1085294056 11:75420824-75420846 CACAAGGAGAAGAGGCAACTCGG + Intronic
1085322575 11:75583803-75583825 AAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1085405581 11:76259882-76259904 CATAAGGAGTTGAGGGCAGCAGG + Intergenic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086088446 11:82980815-82980837 TATAAGGATGGGAGGGAAGGAGG + Exonic
1087816633 11:102665385-102665407 CATAAGGAGATGATGTAAGCTGG + Intergenic
1087978009 11:104574366-104574388 CATATGCAGAGGATTGAAGTTGG + Intergenic
1088376954 11:109151737-109151759 AATAAGGAGGGGAGGGGAGAGGG - Intergenic
1088966521 11:114727624-114727646 AGTAAGGAGAGGAAGGATGTAGG - Intergenic
1089111659 11:116062302-116062324 CACAAGAAGCGGAGGGAAGGAGG + Intergenic
1090283941 11:125482520-125482542 CAAAAAAAGAGGAGGGAGGTTGG + Intronic
1090432634 11:126658987-126659009 CACAAGGAGACGAGGCCAGTGGG + Intronic
1090531104 11:127592110-127592132 AATAAAGAAAGGAGGGAAGGAGG + Intergenic
1090531135 11:127592219-127592241 AATAAAGAAAGGAGGGAAGGAGG + Intergenic
1090649917 11:128797520-128797542 GAAAACCAGAGGAGGGAAGTAGG - Intronic
1091121469 11:133061395-133061417 GATATGGGGAGAAGGGAAGTGGG + Intronic
1093742704 12:22706497-22706519 TATTTGGAGAGGAGGGAGGTAGG - Intergenic
1095475729 12:42585661-42585683 CTTCAGGAGAGAGGGGAAGTGGG + Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1097957195 12:65497993-65498015 CATGTGGAGAAGAGGGAAATAGG - Intergenic
1098167205 12:67710718-67710740 CAGAATGAGAGGAGGGAAGGAGG + Intergenic
1098912694 12:76225811-76225833 AATAAGGAGAGGTGGGAGATAGG + Intergenic
1099503119 12:83438036-83438058 CATGAGGAGAGATGGGAAGATGG + Intergenic
1099957849 12:89368643-89368665 CATCAGGTGGGGAGGGCAGTGGG + Intergenic
1100591707 12:96035793-96035815 CTGAAGAAGAGGAGGGGAGTAGG + Intronic
1101334711 12:103786231-103786253 GATAAGGAGAGGAAGCAAGGAGG + Intronic
1101840230 12:108322671-108322693 CATGAGGAGAGGAGGGAGAGAGG - Intronic
1101860947 12:108481973-108481995 CCCAAGGAGAAGAGGGAGGTGGG + Intergenic
1102900057 12:116629412-116629434 CAGAAGGAGAGGAGAGAAGGCGG + Intergenic
1103361016 12:120353676-120353698 GATGAGGACAGGAGGGAAGCAGG - Intronic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104311156 12:127655308-127655330 CATTAGAAGAGGGAGGAAGTGGG - Intergenic
1106012303 13:25836591-25836613 CAGAAGTGGAGGAGGGCAGTGGG - Intronic
1106028260 13:25975222-25975244 CATCAGCACAGCAGGGAAGTTGG - Intronic
1107157972 13:37191970-37191992 CATGGGGAGAGGAGGGAGCTGGG + Intergenic
1109249870 13:60006646-60006668 GAAAAGGAGAGCAGGGAAGGGGG + Intronic
1110523628 13:76509694-76509716 CATAAGGAGACAATGAAAGTCGG + Intergenic
1111053915 13:82923064-82923086 ATTAAGTAGAGGAGGCAAGTTGG - Intergenic
1112158159 13:96840005-96840027 AAGAAGGAAAGGAGGGAAGGGGG + Intergenic
1112171823 13:96980590-96980612 CATAAGAAGAAGAGTGAAGATGG + Intergenic
1112296873 13:98195573-98195595 CACAAGGAAGGGAGGGCAGTGGG + Intronic
1113146044 13:107208835-107208857 AATAAGGGAAGGAGGGAAGGAGG - Intronic
1114136523 14:19858172-19858194 CATAAGGTGATGAGGAAAGAAGG - Intergenic
1114720623 14:24877528-24877550 AATAAGGAAAAGAGGGAAGGAGG - Intronic
1114934808 14:27520859-27520881 CAAAAGGAGAGGAAGGAAAGAGG + Intergenic
1115320415 14:32075093-32075115 AAAAAGGAGAGAAGGGAATTTGG - Intergenic
1115450613 14:33543133-33543155 CAGAAAGAGATGAGGGAAGGAGG - Intronic
1115504131 14:34078217-34078239 CATGAGGAAAAAAGGGAAGTGGG + Intronic
1115760797 14:36578477-36578499 GAAAAGGAGAGAAAGGAAGTGGG + Intergenic
1116865101 14:50025410-50025432 TATTAGGAGAGGAGTGAAGAAGG - Intergenic
1117171927 14:53109162-53109184 CAAGAGGAAAGGAAGGAAGTGGG - Intronic
1117738099 14:58787982-58788004 AAGAAAGAGAGGAGAGAAGTAGG - Intergenic
1118812038 14:69282286-69282308 CAATAGGAGATGAGGAAAGTCGG - Intronic
1119671646 14:76524379-76524401 CATAAGAAGAGGTGGAAAGAAGG - Intergenic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1120150321 14:81025467-81025489 CATGAGAAGAGATGGGAAGTTGG + Intronic
1120653191 14:87159572-87159594 GAAAAGGAGAGGAAGGAAGAAGG + Intergenic
1120719315 14:87873139-87873161 AATTAGGAGAAGAGAGAAGTAGG + Intronic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1121889820 14:97579108-97579130 CATAAGGTTAGAAGGCAAGTGGG - Intergenic
1122570468 14:102695500-102695522 AAGAAGGAAAGGAGGGAAGGAGG + Intronic
1124904683 15:33857603-33857625 CATGAGCAGAGGAGGAAAGATGG - Intronic
1125077600 15:35637674-35637696 CATTCAGAGAGGAGGTAAGTAGG + Intergenic
1125397102 15:39261025-39261047 GAGAAGGAGAGGAGAGAAGAAGG + Intergenic
1125431069 15:39593898-39593920 CAGACAGAGAGGAGGGAAGGAGG - Intronic
1125525392 15:40370855-40370877 TATGAGGAGAGCAGGGCAGTTGG - Exonic
1125622245 15:41073960-41073982 CACAAGGAGAGGGAGGAATTGGG - Intronic
1126704933 15:51397807-51397829 CAGAAGGAGGGAAGGGGAGTGGG - Intronic
1127569666 15:60229748-60229770 CAGAGGGAGAGGAGAGGAGTCGG - Intergenic
1127695570 15:61443449-61443471 AAAAAGGAGAGAAGGGAAGAAGG - Intergenic
1127782060 15:62325724-62325746 CATAAGGAGGGGAGGCTCGTAGG + Intergenic
1128136084 15:65264649-65264671 CATAAGCAGAGAATGGATGTGGG - Intronic
1128147252 15:65338628-65338650 TATAAGGAAGGGAGGGAAGGAGG - Intronic
1128799588 15:70489208-70489230 AATAAGCTGAGGGGGGAAGTGGG + Intergenic
1129085323 15:73083581-73083603 CCTAAGGAGACAAGGGAAATGGG - Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1130226093 15:82059152-82059174 GAGAAGGAGAGGAGGGGAGGGGG - Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130847155 15:87758169-87758191 GAGAAGGAAAGGAGGGAAGGAGG + Intergenic
1130894916 15:88162463-88162485 CAGAAGGAGAGGGGAGAAGGGGG + Intronic
1131066176 15:89436214-89436236 CATAAGGAGAGGAGAGGAGGAGG - Intergenic
1131066454 15:89437813-89437835 CTTAAGGAGAGGAGAGGAGGAGG - Intergenic
1131440062 15:92453104-92453126 GATGAGGAGAGGAAGGAAGCTGG + Intronic
1131571818 15:93545407-93545429 CATAAGGATGGGGAGGAAGTTGG - Intergenic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131768294 15:95705332-95705354 CATAAGAAGAGGTGGGAAGAGGG - Intergenic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1133417100 16:5615503-5615525 CATGAGGACAGGAGGGACATTGG + Intergenic
1133433136 16:5755922-5755944 CATAATGAAGAGAGGGAAGTAGG + Intergenic
1133844713 16:9443222-9443244 AGGAAGGAGAGGAGGGAAGCAGG + Intergenic
1134212473 16:12289304-12289326 CCAAGGGAGAGGAGGGAAGAAGG - Intronic
1134368652 16:13603232-13603254 CATAAGGGGCTGAGGGAGGTAGG + Intergenic
1134692204 16:16198195-16198217 CAGAAGGAGAGAAGTAAAGTGGG + Intronic
1134857492 16:17532500-17532522 CACAAAGAGTGGAGGGAAGCTGG + Intergenic
1135956366 16:26959725-26959747 GAGAAGGAGAGGAGGGAGATAGG - Intergenic
1136405071 16:30040545-30040567 CATGAGGGGAGGAGAGAAGGTGG + Intronic
1138130960 16:54479539-54479561 AATAAGGAAGGGAGGGAAGATGG - Intergenic
1138147912 16:54628653-54628675 CAGAAGGAAAGAAGGGAAGCAGG + Intergenic
1138247816 16:55480151-55480173 CATAAGGATGGGAGGGAGCTTGG + Intronic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1140551466 16:75870616-75870638 CAGAAGGAGAGGAGACAAGCAGG + Intergenic
1140943608 16:79747090-79747112 GAGAAGGAGACGAGGGAAGAGGG + Intergenic
1141319406 16:82993236-82993258 CATCTGGAAAGGAGGGAACTTGG - Intronic
1141529804 16:84638286-84638308 TATAGGGAGAAGAGGGAAATAGG + Intergenic
1142005804 16:87689106-87689128 CGAAAGGTGGGGAGGGAAGTCGG + Intronic
1142366051 16:89650342-89650364 CAGAAGGAGAGGAGGGATCTAGG - Intronic
1142500917 17:332483-332505 CATCAGGAAGGGAGGGAAGGAGG - Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1146086340 17:29833730-29833752 AAGAAGGAAGGGAGGGAAGTAGG - Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146410508 17:32579649-32579671 GATAGGGAGGGGAAGGAAGTAGG - Intronic
1146819013 17:35969569-35969591 TACAAGGAGAGGTGGGAAGGTGG + Intergenic
1147196577 17:38770547-38770569 GACAAGGAGAGCAGGGAAGAAGG + Intronic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1147773679 17:42885421-42885443 CTATAGGAGAGGAGGGAAGGAGG - Intergenic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148338703 17:46860234-46860256 AAGGAGGAGAGGAGGGAAGCGGG + Intronic
1148585413 17:48775196-48775218 CATAAAGTGAGTTGGGAAGTAGG - Intronic
1149622078 17:58053205-58053227 CATCATGAGAGGAGGAAAGGTGG - Intergenic
1151145765 17:72039369-72039391 TATAAGGAGAGGGGAGAAGAAGG + Intergenic
1151159432 17:72152422-72152444 AATAAGTAGAGGAGTGAACTTGG - Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152310680 17:79547985-79548007 GATAGGGTGAGGAGGGAAGCTGG - Intergenic
1153194098 18:2574216-2574238 CATAGGGAGAAGACGGAAATAGG + Intronic
1153660789 18:7324415-7324437 GACAAGGAGAGGAAGGGAGTAGG - Intergenic
1153675312 18:7451802-7451824 CCTAAGGGGAGGGGGGAAGGAGG - Intergenic
1153827909 18:8893670-8893692 CTGGAGGAGAGGAGGGAAGGGGG + Intergenic
1154199491 18:12289373-12289395 TGGAAGGAGGGGAGGGAAGTGGG + Intergenic
1156050917 18:32933135-32933157 AATAAGCCAAGGAGGGAAGTTGG - Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157429928 18:47616289-47616311 AATGAGGAGAGGATAGAAGTAGG + Intergenic
1157488184 18:48104311-48104333 CATCATGAGAGGAAGGAAGCAGG - Intronic
1157675489 18:49565594-49565616 CACAAGGAAAGGGGGGAAGAGGG - Intronic
1157809420 18:50684087-50684109 GCTAAGGAAAGAAGGGAAGTCGG + Intronic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1160067182 18:75586577-75586599 CATATGGAGAGGAGAGAGGAGGG - Intergenic
1160107704 18:75993991-75994013 CAGAAAGAGAGGAGGGAAAAGGG - Intergenic
1160501157 18:79401663-79401685 CATAAAGAGAGGTCGGGAGTGGG - Intronic
1160538283 18:79606975-79606997 CATGAGGTGAGGAAGGAAGACGG + Intergenic
1160950837 19:1666518-1666540 AATAAGGAGAAGAAGGAAGAAGG - Intergenic
1161154325 19:2724256-2724278 CCTTTGGAGAGGAGGGCAGTGGG + Intronic
1162450485 19:10751347-10751369 CAAAGGGAGAGGAGAGGAGTAGG + Intronic
1163018530 19:14471018-14471040 CAAAAGTGGAGGAGGGAAATGGG - Intronic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163647892 19:18500543-18500565 CAAAAGGAGAGACGGGAACTGGG + Intronic
1163736268 19:18983008-18983030 CATTAGGAGAGCAGAGAAATTGG + Intergenic
1163752458 19:19085828-19085850 CAAGAGGAGAGGAGGGGAGAGGG + Intronic
1164249733 19:23466302-23466324 AATAAGGAGAGGAGAGGAGGAGG - Intergenic
1164506064 19:28862468-28862490 GATGAGCAGAGGAGGGAAGGAGG - Intergenic
1164691577 19:30214675-30214697 CACAAGTACAGCAGGGAAGTTGG - Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164788151 19:30953446-30953468 CAAAAGGAGAGGAGAGAATGTGG - Intergenic
1165796608 19:38523580-38523602 AAAATGGAGAGGAGGGAAATGGG - Intronic
1165798833 19:38535331-38535353 CTTAAGGACAAGAAGGAAGTTGG + Exonic
1165976106 19:39678146-39678168 AATAAGCAGAGGATGGATGTGGG + Intergenic
1166159431 19:40940936-40940958 GATGAGGAGAGGAGGGAAGAGGG + Intergenic
1166168366 19:41008859-41008881 GATGAGGAGAGGTGGGAAGAGGG + Intronic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167286655 19:48602221-48602243 AAGAAGGAGAGGAGGGAGGAGGG + Intronic
1168519399 19:57036519-57036541 CGTGAGGAGAGGAGGGAAGACGG + Intergenic
924995799 2:359311-359333 GATAAGGAGTGCAGGGCAGTGGG - Intergenic
926917051 2:17902121-17902143 CAGAAGCAGAGGAGGTCAGTAGG + Intronic
927088066 2:19690202-19690224 GATAAGGAGAGGAGAGGAGGAGG + Intergenic
927305298 2:21564585-21564607 CATAAAGAGAGGATGGGAGCAGG - Intergenic
927413471 2:22852811-22852833 AAAGAGGTGAGGAGGGAAGTTGG + Intergenic
927615502 2:24589606-24589628 CATAGGGAGAGGAAAGAGGTTGG + Intronic
928349424 2:30535296-30535318 CATAAAGACAGGAGGGCAGAAGG - Intronic
929488501 2:42375808-42375830 CGTCAGGGGAGGAGAGAAGTGGG + Intronic
929962044 2:46504299-46504321 AAGAAGGGGAGGAGGGAACTGGG - Intronic
930034975 2:47079700-47079722 TATAAGGAGAGGAGGCAGATGGG - Intronic
930244662 2:48970924-48970946 TCACAGGAGAGGAGGGAAGTAGG - Intronic
930487743 2:52028448-52028470 CTTATGGAGAGAGGGGAAGTGGG - Intergenic
930609240 2:53522982-53523004 TATAAGGAGAGAAGAGAAGAGGG + Intergenic
930612960 2:53563416-53563438 GATAAGGAGAGGCTAGAAGTTGG - Intronic
931424668 2:62159754-62159776 GGTAAGGGCAGGAGGGAAGTGGG + Intergenic
931710508 2:64986156-64986178 CAAAAGGAGAGGAAGAAAGAGGG + Intergenic
931831334 2:66054604-66054626 CAAAAGGAGAAAAGGGAAGCAGG - Intergenic
932223986 2:70024606-70024628 AGTGAGGAGAGGAGGGAAGGAGG - Intergenic
934165438 2:89290046-89290068 CATAAGAAAGGGAGGGAAGAAGG - Intergenic
934201835 2:89892416-89892438 CATAAGAAAGGGAGGGAAGAAGG + Intergenic
934869671 2:97851794-97851816 CTTGAGGAGAGGAAGGGAGTTGG - Intronic
935340914 2:102059085-102059107 CATAAGGAAAGGACGGAGGCAGG - Intergenic
935404781 2:102697602-102697624 CATAGGTAGAGCAGGGAAGTAGG - Intronic
935404789 2:102697661-102697683 CACAGGTAGAGCAGGGAAGTGGG + Intronic
935447458 2:103171817-103171839 AATAAGGAAAGGAGGGAAACTGG - Intergenic
935538092 2:104317819-104317841 CATGGGGAGAGGAAGGAAGCAGG + Intergenic
935878032 2:107533810-107533832 CAAGATGAGAGGAGGCAAGTCGG - Intergenic
936093142 2:109513705-109513727 CACAAGGGAAGGAGGGAGGTGGG + Intergenic
937246350 2:120496572-120496594 CCTAAGGATAAGAGGGAAGGGGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937430682 2:121835716-121835738 CAGAAGGGGAGGAGGGGAGGAGG - Intergenic
937444077 2:121941876-121941898 AATAAAGAGAGTAGAGAAGTTGG - Intergenic
937862773 2:126723909-126723931 CAGAAGCAGAGGAGGGGAGCAGG + Intergenic
938762159 2:134435812-134435834 GATAAGGAGATAAGGCAAGTTGG + Intronic
938998115 2:136702190-136702212 CAGAAGAAGAGGAGAGATGTAGG - Intergenic
939515693 2:143165319-143165341 CAAAAGTAGTGGAGGAAAGTTGG - Intronic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
941000094 2:160193665-160193687 CAGAAGGAAAGGAGGAAAATAGG - Intronic
941336162 2:164246188-164246210 GAGAAGGAGAGGATGGAAATGGG + Intergenic
941363971 2:164587617-164587639 AATAAGGAAAGGAAGGAAGGAGG + Intronic
941393748 2:164948767-164948789 CAAATGGAGAGAGGGGAAGTTGG - Intronic
941487056 2:166095298-166095320 CCTAAGGAGATTAGTGAAGTTGG - Intronic
944089945 2:195895688-195895710 AGCAAGGAGAGGAGGGAAGGAGG - Intronic
944963103 2:204899216-204899238 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
945153972 2:206817810-206817832 CATAAGGGAAGGAAGGAATTGGG - Intergenic
945240795 2:207675056-207675078 CATAAGAACAGAAGGCAAGTAGG + Intergenic
945988765 2:216375647-216375669 AATTAGGAGAGGTGGGAAGAGGG + Intergenic
946225183 2:218260770-218260792 CATCAGCTGAGGCGGGAAGTCGG + Intronic
946739343 2:222786594-222786616 CATATGGAAAGGAGGAATGTTGG - Intergenic
947251776 2:228114782-228114804 CTGAAGGAGAGTAGAGAAGTAGG - Intronic
947926900 2:233929371-233929393 CAGAAGGTGAGAAGGGAAGGGGG + Intronic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948856353 2:240732253-240732275 CATGAGGGGAGGAGGGATGAAGG + Intronic
948871899 2:240804989-240805011 AAAAAGGAGAGGAGAGAAGAAGG + Intronic
949021206 2:241742408-241742430 GATGAGGACAGGAGGGACGTTGG - Intronic
1169423533 20:5478379-5478401 CACAAAGAGAGCAGGGAAGGGGG - Intergenic
1169866661 20:10208156-10208178 CAAAAGGAGATGAGAGAAATGGG - Intergenic
1170172711 20:13433311-13433333 CATAAGCAGAGGATGGACATGGG - Intronic
1170369451 20:15632822-15632844 AAGAAGGAGAGGAGGGAAGGAGG - Intronic
1170461355 20:16579606-16579628 ATGGAGGAGAGGAGGGAAGTAGG - Intergenic
1170781588 20:19430394-19430416 AATAAAGGAAGGAGGGAAGTTGG + Intronic
1170939381 20:20835713-20835735 CACATGGCGAGGAGGGAAGAGGG + Intergenic
1171133484 20:22676253-22676275 AATCAGGAGAGGAGGGAGGTAGG - Intergenic
1171236687 20:23532776-23532798 CCTAAGGAGAGGAGAGAGATGGG + Intergenic
1172071646 20:32261694-32261716 CAAAAGGGGTGGAGGGCAGTGGG - Intergenic
1172107398 20:32524894-32524916 GAAAAGGAGAGGAGGCACGTAGG + Intronic
1172964449 20:38824467-38824489 CAGAAGGAGAAGAAGGAACTGGG - Intronic
1172997295 20:39080557-39080579 CTTAGGGAGAAGAGGGAAGGTGG + Intergenic
1173234091 20:41228000-41228022 CAGAAGGAGAGGAAGGAATGGGG - Intronic
1173252295 20:41370358-41370380 CAGAAGCAGAGGAGGAAAGGAGG + Intergenic
1173285846 20:41670898-41670920 GGTAAGGAGAGGAGGGAGCTGGG - Intergenic
1173465960 20:43281630-43281652 CAGTAGGAGAGAGGGGAAGTGGG - Intergenic
1173563899 20:44025751-44025773 CATCAGGAGAGCAGGGACCTTGG + Intronic
1173927198 20:46789650-46789672 CATAAGGTCAGAAGGGAAGTGGG - Intergenic
1174454917 20:50642074-50642096 CAAATGTAAAGGAGGGAAGTGGG - Intronic
1174471885 20:50767656-50767678 CAAATGTAAAGGAGGGAAGTGGG + Intergenic
1175059619 20:56230336-56230358 GATAAAGAGAGGAAGGAAGGAGG + Intergenic
1175362232 20:58421704-58421726 AAGAAAGAGAGGAGGGAAGCAGG + Intronic
1175413344 20:58785691-58785713 AAGAAAGAGAGGAGGGAAGGGGG + Intergenic
1176335434 21:5593540-5593562 CATAAAGTGAGAAGGGAAATAGG + Intergenic
1176392323 21:6227408-6227430 CATAAAGTGAGAAGGGAAATAGG - Intergenic
1176469096 21:7088766-7088788 CATAAAGTGAGAAGGGAAATAGG + Intergenic
1176492657 21:7470544-7470566 CATAAAGTGAGAAGGGAAATAGG + Intergenic
1176507985 21:7667839-7667861 CATAAAGTGAGAAGGGAAATAGG - Intergenic
1177109421 21:17006663-17006685 CATATGCAGAGGAGGGAAATTGG + Intergenic
1177452600 21:21290791-21290813 CTTAATGAGAGGGGAGAAGTCGG - Intronic
1178246902 21:30961617-30961639 CATTGGGAGATGAGGGAAGAAGG - Intergenic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1178711862 21:34924193-34924215 AATGAGGAGAGGAGCTAAGTTGG - Intronic
1179193788 21:39145666-39145688 GAGAAGGAAAGGAGGGCAGTAGG + Intergenic
1179927267 21:44542359-44542381 TACAAGGAGAGGAGTGAAATAGG + Intronic
1180645705 22:17337146-17337168 AAGAAGGAGAGGATGGATGTTGG - Intergenic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1180938557 22:19641897-19641919 GAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1181646838 22:24235931-24235953 CATCAGGAGACCAGGGAGGTGGG - Intronic
1181891335 22:26066337-26066359 AATAAGGGGAAGAGGGAGGTGGG - Intergenic
1182510211 22:30814364-30814386 CATAAGAAGAGGAGGAAATGAGG - Intronic
1182799183 22:33017103-33017125 CGTAGGCAGAGGAGTGAAGTTGG - Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1182939554 22:34262263-34262285 CATAGGGAGTGGAGGGAAAGGGG + Intergenic
1183229699 22:36574051-36574073 CCTAAGGAGAGGAGGCAGGCGGG + Intronic
1183368296 22:37418628-37418650 CAACAGGAGAGGAGGGTAGTTGG - Intronic
1183492865 22:38126084-38126106 CATAAGGAGATCAGGGAGGGAGG + Intronic
1183583304 22:38738269-38738291 CAAAGAGAGCGGAGGGAAGTGGG + Intronic
1183746258 22:39693810-39693832 CAGAAAGAGAGGAGGGGAGATGG - Intergenic
1183799699 22:40151937-40151959 CAGAAGGAGAGAACAGAAGTTGG + Intronic
1183877260 22:40793990-40794012 TGTAAGGAGAGAAGGGAGGTGGG + Intronic
1184286852 22:43476814-43476836 GACAAGGAGAGGAGGGGAGGTGG + Intronic
1184369702 22:44074654-44074676 CCTGAGAAGAGGAGGGGAGTGGG + Intronic
1184537114 22:45094703-45094725 CATGAGGAGGGGGGGGAAGAGGG - Intergenic
1184654495 22:45934292-45934314 CAGGAGGAGAGGGGGGATGTGGG + Intronic
949196703 3:1318563-1318585 CCAAAGGAAAAGAGGGAAGTGGG + Intronic
950585126 3:13886864-13886886 AAGAAGGAGAGGTGGGAAGGAGG + Intergenic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951568579 3:24038065-24038087 AACAAGGAGACAAGGGAAGTTGG + Intergenic
951836384 3:26987899-26987921 AATAAGGAGAGGATGGGAGATGG + Intergenic
951989509 3:28661106-28661128 CCTAGGGAGCGGAGGAAAGTGGG - Intergenic
952224839 3:31365008-31365030 AAACAGGGGAGGAGGGAAGTTGG - Intergenic
952226337 3:31380559-31380581 CATAAAGAGAGAAGGGAAAGAGG + Intergenic
952812141 3:37413595-37413617 CTTGAGGGGAGGAGGGTAGTTGG + Intronic
953034902 3:39203022-39203044 CATGAGAAGATGAGGGAAGGAGG + Intergenic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
953114344 3:39977158-39977180 GATAACGTGAGGAGGGAAGTGGG - Intronic
953704994 3:45224876-45224898 AAGACGGAGAGGAGGGAAATGGG - Exonic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
954449256 3:50562910-50562932 CCTGAGGAGAGGGAGGAAGTGGG + Intronic
954580901 3:51702476-51702498 AATTAGGAGAGGGGGGAATTTGG - Intronic
954793467 3:53149327-53149349 CCTGAGGGGAGGAGGGAAGGGGG - Intergenic
954857119 3:53653742-53653764 CAGAAGGAGAGGAGAGAAAGAGG + Intronic
955987789 3:64592928-64592950 TAATAGGAGATGAGGGAAGTTGG + Intronic
956171965 3:66440027-66440049 AAAAAGGAGTGGAGGGAGGTGGG + Intronic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
956838782 3:73117725-73117747 CAGAAAGAAAGGAGGGAAGAGGG - Intergenic
956885824 3:73558639-73558661 GATAAGGAAAGGGGAGAAGTAGG + Intronic
957207869 3:77221219-77221241 CATAAGGACAGCAAGGAATTGGG - Intronic
957350363 3:79016996-79017018 CAGAAGGAGAAGCTGGAAGTGGG + Intronic
959254511 3:103992012-103992034 CACGAGGAGAGGAGGTAAGGAGG + Intergenic
959896838 3:111615736-111615758 AGTGAGGGGAGGAGGGAAGTGGG + Intronic
961492412 3:127264917-127264939 CATAAGCATAGGAGAGAAGGAGG + Intergenic
961532275 3:127547100-127547122 CAAGAGGAGAGGAGGGGAGAGGG + Intergenic
962026365 3:131552020-131552042 TATAAGGAGAGGGGGGAACATGG - Intronic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
962627182 3:137237444-137237466 CAGAGGCAGATGAGGGAAGTGGG + Intergenic
963009984 3:140760023-140760045 TATAAGGAGAGGGGAGTAGTGGG - Intergenic
963432034 3:145219786-145219808 CATTAGGTGAAGAGGGAAATGGG - Intergenic
964459855 3:156912387-156912409 CATAAGGAGTGGGGGGTAGCAGG + Intronic
964835135 3:160929863-160929885 CTGAAGGAGAGGTGGGAAGGTGG - Intronic
965368949 3:167836832-167836854 CAAAAGGAGAGGAAGTAGGTGGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965792715 3:172406744-172406766 CATAAGGAAAACAGGGAAATGGG - Intergenic
965853644 3:173062285-173062307 CACAAGGCAAGGAGGGAAGAAGG - Intronic
966238175 3:177726043-177726065 ATGAAGGAGAGGAGGGAAATGGG - Intergenic
966242036 3:177765611-177765633 AATGAGGAAAGGAGGGAAGAAGG + Intergenic
967574086 3:191069850-191069872 AAAAAGGAGATGAGGAAAGTAGG + Intergenic
968074935 3:195811108-195811130 AATAAGAAGAGGAGAAAAGTGGG - Intronic
968645980 4:1740708-1740730 CAGGAGGAGAGGTGGGCAGTGGG - Intronic
969464112 4:7344559-7344581 CAGAAGGGGAGTAGGGCAGTGGG + Intronic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
971059050 4:22946617-22946639 GATAAGGTGAGGAGGGAAGTGGG + Intergenic
971371411 4:26022311-26022333 CATAAAGGAAGGAGGGAAGAGGG + Intergenic
972409867 4:38782809-38782831 AATATTGAGGGGAGGGAAGTAGG - Intronic
973238749 4:47934273-47934295 CATAAGGACAGGAGTGAGGGTGG - Intronic
974134667 4:57800134-57800156 CTTAAAGAAAGCAGGGAAGTGGG - Intergenic
974700061 4:65431587-65431609 AAAAAGGAAAGGAGGGAGGTCGG - Intronic
975663883 4:76714777-76714799 AATAAGTAGAGGAGAGAAATAGG - Intronic
975948760 4:79742426-79742448 ATTGAAGAGAGGAGGGAAGTGGG + Intergenic
976281894 4:83334403-83334425 GAGAATGAGAGGCGGGAAGTGGG + Intronic
976361306 4:84181808-84181830 CATTTGGAGAGTAGAGAAGTGGG + Intergenic
977547807 4:98405510-98405532 CAAAAGGAGAGTAGAGAAGGTGG + Intronic
978595613 4:110374136-110374158 CATGAGGTGAGGGGGCAAGTTGG - Intronic
979111626 4:116764303-116764325 CAAAAGGAAAGGAAGGAAGGAGG + Intergenic
980520806 4:133931802-133931824 CAGAAGGAGAGGGGGGTACTGGG - Intergenic
981221011 4:142234913-142234935 CATAAAGAGAAGAGAGAAGAGGG + Intronic
981425168 4:144594646-144594668 ATTAAGGAGAGGAGGGATGGAGG + Intergenic
981974835 4:150713355-150713377 CATAGGTAGAGAAGGAAAGTTGG + Intronic
982919949 4:161260488-161260510 CAAAAGGAGAGAAGTGAAGTGGG - Intergenic
984212892 4:176872638-176872660 CATAACGAAAGCAGGGAAGTAGG + Intergenic
984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985196214 4:187432486-187432508 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985196228 4:187432555-187432577 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
986124655 5:4874129-4874151 CACAAGGTGAGGAGAGAAGAAGG - Intergenic
986179316 5:5378598-5378620 CACAAGCACAGGAGGGAAGAAGG + Intergenic
986424561 5:7617746-7617768 CACCAGGAGAGGAAGGAAGGTGG + Intronic
986445284 5:7815964-7815986 CACAAGGAGAGGAAGGAAAGAGG - Intronic
987372312 5:17204336-17204358 CATGAGGAGAGGATGGTAGTGGG - Intronic
987529375 5:19097631-19097653 CATGAGGAGAGGAGGAGAGAAGG - Intergenic
987639188 5:20589660-20589682 CACCAGGAGAGGAGAGAACTAGG - Intergenic
988388294 5:30594939-30594961 CTTAATGAGGCGAGGGAAGTTGG - Intergenic
988392520 5:30653961-30653983 TATAAATGGAGGAGGGAAGTGGG + Intergenic
988629794 5:32916746-32916768 GATAAGGAGATGAGGGCACTTGG - Intergenic
990534051 5:56702499-56702521 CCTAGGGAGAGGAGGTAAGGAGG + Intergenic
990738706 5:58890874-58890896 CAAAGGGAGAGAAGGGAAGCGGG - Intergenic
990766198 5:59186056-59186078 GAGAAAGAGAGGAGGGAAGAAGG - Intronic
990805141 5:59652124-59652146 CCTATGGAGGGGAGGGAAGAAGG - Intronic
991624466 5:68585677-68585699 CATAATGAGAGGATGCAAGTGGG - Intergenic
992729940 5:79653968-79653990 CATAAGCAGAGAAAGGAAATAGG + Intronic
993630150 5:90276939-90276961 GCTAAGGAGAGGAAGGAACTAGG + Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
995253486 5:110019554-110019576 CATAAGGAAAAGAGGTCAGTGGG + Intergenic
995450094 5:112291036-112291058 CATTAGGGGAGTAGGGGAGTAGG - Intronic
995608473 5:113883986-113884008 CAGAAGGAGAAGAGAGAAATGGG - Intergenic
995860838 5:116638923-116638945 GAAAAGGAAAGGAGGGAAGCAGG + Intergenic
995909131 5:117164391-117164413 CAAAAGGAGAGGAGAGGAGAGGG - Intergenic
995938745 5:117551925-117551947 CAAAGGGAGAGGTTGGAAGTAGG - Intergenic
997584676 5:135037318-135037340 CACGAAGAGAGGAGGGAAGGGGG + Intronic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998375388 5:141687178-141687200 AAAAATGTGAGGAGGGAAGTGGG - Intergenic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1000279535 5:159770250-159770272 AATGAGAAGAGGAGGGAAGGAGG + Intergenic
1000497335 5:162001288-162001310 TGTAAGGGGAGGAGGGAAATGGG + Intergenic
1000662161 5:163950325-163950347 CATAAGGAGAGAAGGGGAAGGGG - Intergenic
1001217354 5:169868349-169868371 TATAAGGAGAGGAAGGCAGTTGG - Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001917409 5:175573462-175573484 CATAGGGAAAGGAGGGAATGGGG + Intergenic
1001935543 5:175701048-175701070 GATAAGCAGTGGAGGGAAATGGG + Intergenic
1002173549 5:177388535-177388557 CCTAAGGCGATGTGGGAAGTTGG - Intronic
1002886993 6:1306273-1306295 CACAAGGAGGGGAGGGAAGAAGG - Intergenic
1002940100 6:1708356-1708378 GATGAGGAGTGGAGGGAAGGCGG + Intronic
1003858259 6:10297739-10297761 TAGAGGGAGAGAAGGGAAGTAGG + Intergenic
1003949210 6:11102804-11102826 CCGGAGGAGAGGAGGGAATTTGG + Exonic
1004367696 6:15025897-15025919 CATAAGGACAAGAGAGAAGCAGG + Intergenic
1004471647 6:15934648-15934670 AATAAGAAGAGGAGGGAGCTAGG - Intergenic
1004681302 6:17897502-17897524 AATAGTTAGAGGAGGGAAGTGGG - Intronic
1005008294 6:21311961-21311983 CAGAAGGGGAGTAGGGAGGTGGG - Intergenic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1005851957 6:29828877-29828899 CACAAGGAGAGGAGGAAAATGGG + Intronic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1007919100 6:45589953-45589975 CACAAGGAGGTGTGGGAAGTGGG - Intronic
1008927541 6:56902778-56902800 ATTAAGGAGAAGAGGGAACTGGG + Intronic
1009027359 6:58016039-58016061 CTTCAGGAGAGAAGGGAAGAAGG - Intergenic
1009395005 6:63189578-63189600 GATAATGAGAGGAGGGATGTAGG - Intergenic
1009495552 6:64341996-64342018 TATAAGAGGAGGAGGGAAATGGG + Intronic
1009553354 6:65129109-65129131 CATATGCAGAAGAGTGAAGTTGG + Intronic
1010521324 6:76841755-76841777 CATAGGGAGAACAGAGAAGTGGG + Intergenic
1011411101 6:87067318-87067340 GACAAAGAGAGGAGGGAAATCGG + Intergenic
1011495070 6:87929555-87929577 AATAAAGAGAGGAGGGAGGCAGG - Intergenic
1012196229 6:96344363-96344385 CAAAAGGAGAGCAAGGAAGCTGG + Intergenic
1013002444 6:106037445-106037467 TATAAGGAGAAGAGGGAAAAGGG - Intergenic
1014558628 6:122863647-122863669 CATAAAGAGAGGAAGGAATTTGG + Intergenic
1014644390 6:123954991-123955013 CAGAAGGGGAGGAGGGGAGAAGG + Intronic
1015018487 6:128443310-128443332 AAGAAGGAGATGAGGGAAGAGGG + Intronic
1015023960 6:128510325-128510347 CATTAGGAGAGGAGGTAGCTAGG + Intronic
1015597073 6:134875943-134875965 TATTAGTAGAGGAGGGAGGTAGG - Intergenic
1015635237 6:135268250-135268272 CCTAGGGAGAGAAGGGAAGTTGG + Intergenic
1016166262 6:140948248-140948270 GGTAAGGAGAAGAAGGAAGTGGG - Intergenic
1016438427 6:144060750-144060772 TATATGGAGATGAGGGATGTGGG - Intronic
1016896776 6:149061255-149061277 GATGAAGAGAGGTGGGAAGTGGG + Intronic
1016944272 6:149514192-149514214 CATAGTGAAAAGAGGGAAGTTGG - Intronic
1018062630 6:160102658-160102680 AAGAAGGAGAGGAGGTAAGCGGG + Exonic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1018844737 6:167547611-167547633 GACAAGGTGAGGAGGGAAGAGGG - Intergenic
1019018761 6:168900464-168900486 GGTGAGAAGAGGAGGGAAGTAGG + Intergenic
1019325347 7:435638-435660 CATAAGCCGAGGAGTGAAATGGG - Intergenic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1020104141 7:5413369-5413391 GATGGGGAGAGGAGGGAAGGAGG - Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020652617 7:10893786-10893808 TATAAAGAGAGCAGAGAAGTGGG - Intergenic
1020677842 7:11201825-11201847 CCTTAGGAGAAGAGGGGAGTGGG + Intergenic
1022636600 7:32142181-32142203 CAGAAGGAGAAGGGGGAAGGAGG + Intronic
1023956627 7:44891820-44891842 CCAGTGGAGAGGAGGGAAGTTGG + Intergenic
1023979293 7:45057821-45057843 CATAAGGTGAGGATGGAAGTGGG - Intronic
1024088525 7:45917053-45917075 TGTAAGGAGAGGAGAGAGGTAGG + Intronic
1025965387 7:66265218-66265240 CAGAAGGAGAGGAGAGATGGTGG + Intronic
1026852606 7:73734658-73734680 GGTAAGGAGAGGAGGGAAGAAGG - Intergenic
1026870812 7:73850294-73850316 GATAAGGAGAGGAAAGAAGCTGG - Intergenic
1026927423 7:74204121-74204143 GGGAAGGAGAGGAGGGAAGGAGG + Intronic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1028296663 7:89141059-89141081 CCAAAGGAGAGGAGGGGAGATGG + Intronic
1029411033 7:100410831-100410853 CAGATGGAGAGGATGGTAGTGGG - Intronic
1029525229 7:101089778-101089800 CAGAAGCAGAGGAGGCAGGTGGG + Exonic
1030424441 7:109356285-109356307 CAGAAAGAAAGGAGGGAAGGAGG + Intergenic
1030683908 7:112463478-112463500 CAAAAGGAGTGTAGGGGAGTTGG - Intronic
1030721340 7:112874486-112874508 CAAACGTAGAGGAGGGAGGTAGG + Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1031985870 7:128164438-128164460 CACAAGGGTAGGAGGGAATTAGG - Intergenic
1031992569 7:128207742-128207764 CCTAGGGGGAGGAGGGGAGTGGG - Intergenic
1032089950 7:128906533-128906555 CATCAGGAGACGATGGGAGTGGG - Intronic
1032518154 7:132522201-132522223 CATAAGAGTAGGAGGGCAGTGGG - Intronic
1034959825 7:155358305-155358327 CACGAGGAAAGGAGGGAAGGTGG + Exonic
1035114606 7:156514195-156514217 CAAAGGGACAGGAGGGAATTTGG + Intergenic
1035122509 7:156580000-156580022 CATAAAGAGAAAAGGGAAGAAGG + Intergenic
1035237166 7:157506036-157506058 CATAAAAAGAGGAGAGAAGGGGG - Intergenic
1035587144 8:785491-785513 CCTGAGGGGAGGAGGGAAGCTGG - Intergenic
1035587154 8:785525-785547 CCTGAGGGGAGGAGGGAAGCCGG - Intergenic
1035587213 8:785692-785714 CCTGAGGGGAGGAGGGAAGCCGG - Intergenic
1035689886 8:1553189-1553211 CCTGAGGACAGGAGGGAAGGAGG - Intronic
1036027616 8:4927790-4927812 GAGAAGGAGAGGAGCCAAGTTGG - Intronic
1037154047 8:15677676-15677698 CATAAGGCAAAGAGGGAAGGTGG + Intronic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1038829256 8:31038771-31038793 CATATGGAAAAGAGTGAAGTTGG - Intronic
1039228491 8:35417238-35417260 CAGAAGGTGAGAAGGGTAGTGGG - Intronic
1040491711 8:47929349-47929371 CAGAACAAGAGGAGGGAAGGTGG + Intronic
1040895696 8:52366221-52366243 GGTAAGCAGAGGTGGGAAGTAGG - Intronic
1041576031 8:59396303-59396325 CAGAAGGTGGGGAGGGAACTGGG - Intergenic
1042030918 8:64474696-64474718 CCTAAGGAGAGGTGGGATGCTGG - Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042893349 8:73637191-73637213 CAGAAGGAGAGGAGGAAAAGGGG + Intronic
1042918317 8:73896982-73897004 TATAGGGAGAGGAGAGAAGCTGG + Intergenic
1042928709 8:73992784-73992806 CCAAAGGAGGAGAGGGAAGTGGG - Intronic
1043524454 8:81081567-81081589 GGTAGGGACAGGAGGGAAGTGGG - Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1046155856 8:110289356-110289378 TAGAATGAGAGGAAGGAAGTGGG - Intergenic
1046393363 8:113606601-113606623 AATTGGGAGAGGAGTGAAGTAGG + Intronic
1047096974 8:121636386-121636408 CAGAAGGGGAGAAGGGAGGTTGG - Intronic
1047278344 8:123423248-123423270 CAGAAAGAAAGGAGGGAAGGAGG - Intronic
1047618724 8:126585093-126585115 TGGAAGGAGAGGAGGGAAGACGG - Intergenic
1047907001 8:129483131-129483153 AAGGAGGAGAGGAGGGAAGGGGG + Intergenic
1048271361 8:133030744-133030766 CATAAGGGAAGGAGGGAGTTTGG + Intronic
1049023938 8:139975766-139975788 CATGAAGAGAGGAGGGGCGTTGG - Intronic
1049763193 8:144340061-144340083 CTCAAGGAGAGGAGGGAATTGGG + Intergenic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1049925997 9:407648-407670 CATAGGGAGAGAAGGAAAGAAGG - Intronic
1051044002 9:12851664-12851686 AAGAAGGAAAAGAGGGAAGTGGG + Intergenic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1055027953 9:71742426-71742448 CTCAAGTGGAGGAGGGAAGTAGG - Intronic
1055083041 9:72286085-72286107 CATATGCAGAAGAGTGAAGTTGG - Intergenic
1055259345 9:74414597-74414619 AATGAGTTGAGGAGGGAAGTAGG + Intergenic
1055587559 9:77771231-77771253 CATAAGGGGATGGGAGAAGTGGG + Intronic
1056232636 9:84562495-84562517 CATGAGGAAAGAAGGGAAGGTGG + Intergenic
1056965166 9:91159365-91159387 AAGAAAGAGAGGAGGGAAGGAGG + Intergenic
1057100131 9:92351524-92351546 GATGAGGAGAGGGAGGAAGTGGG - Intronic
1057267337 9:93627571-93627593 CATAAGATGAGGAGGAAAATAGG - Intronic
1057794376 9:98145075-98145097 CATAAGGAGAGGGGTGATGAAGG - Intronic
1060505169 9:124192167-124192189 CATCAGGGAAGTAGGGAAGTGGG + Intergenic
1060651094 9:125327930-125327952 CATAATGAGGGGAGAGAAGAGGG - Intronic
1060935032 9:127509787-127509809 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1060935039 9:127509808-127509830 GGGAAGGAGAGGAGGGAAGGAGG - Intronic
1062262925 9:135671799-135671821 CATGAGGAGAGGAGGGGATGGGG + Intergenic
1062328768 9:136026460-136026482 CAGAAGGAGAGGAGGAGAGGAGG + Intronic
1062573415 9:137195707-137195729 CAAGAGGGGAGGAGGGGAGTAGG + Intronic
1203426202 Un_GL000195v1:41362-41384 CATAAAGTGAGAAGGGAAATAGG - Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1186240014 X:7555506-7555528 AATAAGGGAAGGAGGGAAGGAGG + Intergenic
1186435483 X:9539489-9539511 CATGAGGAGAAGAGGGGAGTAGG - Intronic
1187092847 X:16115566-16115588 CATATGGAAAGTAGAGAAGTGGG - Intergenic
1187555550 X:20347915-20347937 CATAAGGAGAGGCTCTAAGTGGG - Intergenic
1188153114 X:26703846-26703868 AATAAGGAAAGGAGGGAGGGAGG + Intergenic
1188337371 X:28953570-28953592 AATACGTAGAGGAGGGAATTGGG + Intronic
1188566881 X:31536711-31536733 CATCAGGGGAGAAGGGAAGGAGG - Intronic
1188607441 X:32049391-32049413 CATAAAGAGGTGAGGTAAGTAGG + Intronic
1189122302 X:38407745-38407767 CAGAAGCAGAGGATGGAGGTGGG + Intronic
1190178421 X:48170570-48170592 CATGAGGAGAGGAGAGTAGAGGG + Intergenic
1190710477 X:53064719-53064741 GACAAAGAGAGAAGGGAAGTGGG + Intronic
1191702385 X:64056955-64056977 CAGAAGGAGAAGAACGAAGTTGG - Intergenic
1191904904 X:66077254-66077276 GAGAAGGAGAGAAGGGAAGGAGG - Intergenic
1192262075 X:69511448-69511470 GGTAACGAGAGAAGGGAAGTGGG - Intronic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192774194 X:74224874-74224896 CATAATGAGAGGAGAGAAAAGGG + Intergenic
1193231414 X:79051175-79051197 CATAAGTAGAAGCGGTAAGTGGG - Intergenic
1193487371 X:82103130-82103152 CTTGAGGAGAGGAGAGAAGTCGG - Intergenic
1193487659 X:82107094-82107116 CTTGAGGAGAGGAGAGAAGTAGG - Intergenic
1193667575 X:84341154-84341176 CTGAAGGAGAGTGGGGAAGTAGG - Intronic
1194847181 X:98824789-98824811 CATTAAGAGAGGAGTGAAGGAGG + Intergenic
1195064901 X:101231946-101231968 CATAAGGAAAGGAAGGGTGTTGG + Intronic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1197706180 X:129636249-129636271 CATAAGGGGAGGACAGCAGTTGG + Intergenic
1198250838 X:134877848-134877870 CATAAGGGTAGGAAGGAAGGAGG - Intergenic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1201458958 Y:14201452-14201474 CTGGAGGAGAGGAGGGAAATGGG + Intergenic
1201774126 Y:17645742-17645764 CCTGAGGACAGGAGGGAATTTGG + Intergenic
1201827431 Y:18260247-18260269 CCTGAGGACAGGAGGGAATTTGG - Intergenic
1201907435 Y:19100196-19100218 AATAAGAGGAGGAGGGAAGAAGG - Intergenic
1202051074 Y:20781437-20781459 AAAGAGGGGAGGAGGGAAGTGGG - Intergenic