ID: 911003338

View in Genome Browser
Species Human (GRCh38)
Location 1:93190921-93190943
Sequence CGATATGACAGGAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 10, 2: 11, 3: 18, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911003338_911003341 -9 Left 911003338 1:93190921-93190943 CCACTCTGCTTCCTGTCATATCG 0: 1
1: 10
2: 11
3: 18
4: 210
Right 911003341 1:93190935-93190957 GTCATATCGACACTTTCCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 54
911003338_911003340 -10 Left 911003338 1:93190921-93190943 CCACTCTGCTTCCTGTCATATCG 0: 1
1: 10
2: 11
3: 18
4: 210
Right 911003340 1:93190934-93190956 TGTCATATCGACACTTTCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911003338 Original CRISPR CGATATGACAGGAAGCAGAG TGG (reversed) Intronic
900364757 1:2306558-2306580 CGATCTGAAAGGGAGCCGAGTGG - Exonic
901139391 1:7018679-7018701 CTACATGACAGGAAGGAGAGCGG - Intronic
901168661 1:7237891-7237913 CTATATGACAGGCAGCACACCGG + Intronic
904468795 1:30723363-30723385 CGATATGGCAGGGAGCACACGGG - Intronic
905849719 1:41264723-41264745 CATTATGACAGGAAGCAGTATGG - Intergenic
907072471 1:51549175-51549197 CCAGATGACAGGAAGTAGGGTGG - Intergenic
907246341 1:53111459-53111481 ACAGAGGACAGGAAGCAGAGAGG + Intronic
907260770 1:53216919-53216941 CCATTTGGCAGGAAGGAGAGGGG - Intronic
907787967 1:57632500-57632522 CGCTAAGACAGGATGCAGATGGG + Intronic
908071446 1:60464871-60464893 CGATGTGCCAGGGAGTAGAGAGG - Intergenic
908705322 1:66947708-66947730 GGATATAACAGGAAGCTGGGAGG - Intronic
909989485 1:82205349-82205371 CGATACTACAGCAAGAAGAGAGG + Intergenic
910559788 1:88577997-88578019 CATTATGACAGGAAGCAGAGTGG + Intergenic
911003338 1:93190921-93190943 CGATATGACAGGAAGCAGAGTGG - Intronic
911675312 1:100652064-100652086 TATTATGACAGGAAGCAGAGTGG + Intergenic
912441776 1:109704454-109704476 CGAAATGACAGGAGGGTGAGGGG - Intronic
912863963 1:113240189-113240211 CCACAGGACAGCAAGCAGAGAGG + Intergenic
912953803 1:114138491-114138513 CTATACGGCAGGCAGCAGAGTGG + Intronic
916716015 1:167447315-167447337 CTATATGACAGGAACCCCAGAGG - Intronic
918300641 1:183200641-183200663 GGTTAGGACAGGAAGCAAAGGGG - Intronic
919106515 1:193158700-193158722 TGATATTTCAGGAAACAGAGTGG + Intronic
919442169 1:197649349-197649371 AGAAATGACTGGAAGGAGAGAGG + Intronic
920505432 1:206512321-206512343 TGATAAGACAGGAAGCAGGGAGG - Intronic
922797290 1:228346649-228346671 CGGTATGCCAGGATGGAGAGTGG + Intronic
923978849 1:239297309-239297331 GGAGATGCCAGGAAGGAGAGGGG - Intergenic
924203536 1:241686406-241686428 CAATATGACATTAAACAGAGTGG - Intronic
924847678 1:247789628-247789650 TGATATTGCAGGGAGCAGAGGGG - Intergenic
1064185641 10:13159650-13159672 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1065521080 10:26573348-26573370 CAATATGAAAGGATGTAGAGTGG - Intergenic
1065652226 10:27904326-27904348 CGTCATGGCAGGAAGCAGAGCGG + Intronic
1067990398 10:51205475-51205497 CGAAATGTCAGGAGGCAGGGTGG - Intronic
1070641084 10:78170635-78170657 TGATATGAAAGGAAGAGGAGGGG + Intergenic
1071315024 10:84387305-84387327 CGATACAACAGGAAGGAGAAAGG - Intronic
1071789272 10:88937317-88937339 CCATGTCACAGGAAGTAGAGGGG - Intronic
1073354496 10:102843223-102843245 CGAAATGACAGGAGGGTGAGGGG + Intergenic
1074205856 10:111282169-111282191 CGATAAGAAAGGAAGGAGATGGG + Intergenic
1075218056 10:120556002-120556024 AGCTAAGACAGAAAGCAGAGGGG - Intronic
1077290967 11:1792670-1792692 CGTTATGACAGGAAGCAGAGTGG + Intergenic
1078777904 11:14410646-14410668 CCATAAGAAAGGATGCAGAGTGG + Intergenic
1078839870 11:15068588-15068610 CGAAATGACAGGAGGGTGAGGGG + Intronic
1079029395 11:16974874-16974896 CGTTATGACAGGAAGCAGAGTGG - Intronic
1079854760 11:25588656-25588678 CGCTATGATCAGAAGCAGAGTGG - Intergenic
1082960217 11:58912693-58912715 CAATTTGACAGAAAACAGAGGGG + Intronic
1082980163 11:59113840-59113862 CAATTTGACAGAAAACAGAGGGG + Intronic
1084223608 11:67700386-67700408 CGAAATGACAGGAGGGTGAGGGG - Intergenic
1084292068 11:68179037-68179059 TGATATAACAGGAACCAGAAAGG - Intronic
1085206765 11:74738657-74738679 CATTATAACAAGAAGCAGAGTGG - Intergenic
1088895456 11:114074861-114074883 ACATATGACAAGAACCAGAGAGG - Intronic
1090185435 11:124736577-124736599 CCACATGTCAGGAAGGAGAGGGG - Intergenic
1090453560 11:126827789-126827811 TCAAATGACAGGCAGCAGAGAGG + Intronic
1090534081 11:127621317-127621339 CAGTATGAGAGAAAGCAGAGAGG - Intergenic
1090931035 11:131298161-131298183 AGAAATGACACTAAGCAGAGAGG - Intergenic
1091846091 12:3657340-3657362 CCATATGACAGGAACCCCAGGGG - Intronic
1094585795 12:31776301-31776323 TCATATGCCAGCAAGCAGAGTGG - Intergenic
1095397828 12:41780839-41780861 CAATATCACAGGAAGGAGAGGGG + Intergenic
1095765978 12:45896292-45896314 TGCTATGATTGGAAGCAGAGTGG + Intronic
1097285282 12:57872479-57872501 CCATATGCCAGAAGGCAGAGAGG - Intergenic
1097774925 12:63634307-63634329 AGATATGAAAGGATGGAGAGAGG + Intronic
1099067149 12:77995926-77995948 GGAAATGAGATGAAGCAGAGAGG - Intronic
1099555858 12:84107664-84107686 CGAAATGACAGGAGGGTGAGGGG + Intergenic
1101295494 12:103419462-103419484 TGACGAGACAGGAAGCAGAGAGG + Intronic
1104468358 12:129008124-129008146 AGATGGTACAGGAAGCAGAGTGG - Intergenic
1106369490 13:29117658-29117680 CGCTGTGACAGAAAGCTGAGGGG + Intronic
1108021882 13:46136046-46136068 CGATGGGCAAGGAAGCAGAGAGG - Intronic
1108270910 13:48758693-48758715 CAATATGACCTGAAGAAGAGGGG - Intergenic
1112427127 13:99312816-99312838 CCAGATGAGGGGAAGCAGAGAGG + Intronic
1113019653 13:105870557-105870579 CCATAGGAGAGGAAGCAGAAAGG - Intergenic
1113251238 13:108455377-108455399 AGATTTGAAAGGAAGGAGAGAGG - Intergenic
1113735236 13:112673817-112673839 CCACATGAGAGGGAGCAGAGGGG - Intronic
1115303467 14:31910935-31910957 GGCCATGATAGGAAGCAGAGTGG - Intergenic
1116820015 14:49618965-49618987 CGCTATGATCGGAAGCAGAGTGG - Exonic
1117533620 14:56683602-56683624 CGTTACGACAGGAAGGAGAGTGG - Intronic
1119167902 14:72510976-72510998 CAATATGAGAGGAAGAAAAGGGG + Intronic
1119352034 14:73973920-73973942 CGAGATGGTTGGAAGCAGAGTGG - Exonic
1119615000 14:76093095-76093117 AGCTAGGTCAGGAAGCAGAGGGG + Intergenic
1119617866 14:76110728-76110750 CCATATGCCAGGAAAGAGAGAGG - Intergenic
1120665874 14:87306294-87306316 GGGTCTGACAGGAGGCAGAGGGG + Intergenic
1122641463 14:103162181-103162203 GGATCTGTCAGGAGGCAGAGAGG - Intergenic
1122974257 14:105164548-105164570 AGAAAAAACAGGAAGCAGAGTGG + Intronic
1125016574 15:34943197-34943219 CGTTATGACAGGAAGCAGAGTGG + Intronic
1125169065 15:36744975-36744997 CCATAAGTCAGGAAGCAGAAAGG + Intronic
1125302552 15:38271901-38271923 CTATATGGCAGGAAGGAGGGAGG - Intronic
1127964677 15:63914678-63914700 CAAATGGACAGGAAGCAGAGAGG - Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129181317 15:73878852-73878874 CAATGTGGCAGGAAGCAGAAGGG - Intronic
1130524310 15:84690650-84690672 AGATAGGGAAGGAAGCAGAGTGG + Intronic
1131100733 15:89688112-89688134 CATTATGACAGGAAGCAGAGTGG - Intronic
1133218990 16:4310393-4310415 AGAGATGACAGGAATCAGAATGG - Intergenic
1133427323 16:5704134-5704156 GGACATGACAGCAAGAAGAGGGG + Intergenic
1134467460 16:14492092-14492114 CGATATGAAAGGAAGCATGAAGG - Intronic
1137604407 16:49777910-49777932 GGATACGACAGGAAGCAAACAGG + Intronic
1139908460 16:70381927-70381949 CGGGATGACAGGGAGGAGAGGGG + Intronic
1141082612 16:81065646-81065668 TGATAAGACAGGAGGCACAGGGG + Intronic
1141468873 16:84225172-84225194 GGATATTACAGGAAGATGAGGGG + Intronic
1142648729 17:1332000-1332022 GGATAGAACAGGAAACAGAGAGG + Intergenic
1146509184 17:33431009-33431031 CTATGTGAGAGGATGCAGAGGGG + Intronic
1146531305 17:33609841-33609863 GGATAAGAGAGGAAGGAGAGAGG + Intronic
1149928653 17:60727346-60727368 CGCTATGATCGGAAGCAGAGTGG - Intronic
1150090457 17:62320001-62320023 TGTTATGACAGGAAGCAGAGTGG + Intergenic
1150673677 17:67224842-67224864 CGTTATGACATGAAACAGAGTGG + Intronic
1151344531 17:73493464-73493486 GGAGATGACAGGAAGAAGTGAGG + Intronic
1151634806 17:75338944-75338966 CGTTATGACAGGAAGCAGAGTGG + Intronic
1153664331 18:7354746-7354768 GGATATGACATGGAGCAGCGTGG + Intergenic
1154388911 18:13919784-13919806 CGTTATAACAGGAAGCAGAGTGG - Intergenic
1158640138 18:59196634-59196656 AGATAGGACAGGAGGCAGAGAGG + Intergenic
1160554309 18:79716197-79716219 CGCCAGGACAGGAAGCAGATTGG - Intronic
1162316420 19:9941267-9941289 CTCCATGACAGGAAGCAGGGAGG + Intergenic
1163375314 19:16926798-16926820 AGATAGGAGAAGAAGCAGAGAGG - Intronic
1164013723 19:21233452-21233474 CATTATGACAGGAAGCAGAATGG + Intronic
1164336281 19:24324255-24324277 CGAAATGACAGGAGGATGAGGGG - Intergenic
1164849575 19:31470477-31470499 CGATATGCCAGGCAGCAAAGAGG - Intergenic
1165136197 19:33671101-33671123 GGATATGACAACAAGCAGCGGGG + Intronic
1165863300 19:38920360-38920382 GGAAATGAGAGGAGGCAGAGAGG + Intronic
1167374595 19:49104045-49104067 GGAAATGGCAGGGAGCAGAGAGG - Intronic
1167494759 19:49811242-49811264 GGATAGGACTGGAAGCTGAGAGG + Intronic
1167741134 19:51325587-51325609 TGAAATAACTGGAAGCAGAGTGG - Intronic
1168222920 19:54973925-54973947 TGTTATGACAGGAAGCAGAGTGG + Intronic
926129058 2:10289546-10289568 CTATAGGACAGAAAGCAGATAGG - Intergenic
926286292 2:11491524-11491546 TGATATGACTGAAATCAGAGAGG + Intergenic
926606874 2:14906910-14906932 AGAGAGGACAGGAAGCAGACTGG - Intergenic
926721687 2:15965888-15965910 TGAGATGACAGGAAGCCGGGTGG - Intergenic
930057905 2:47265869-47265891 GGATATGACAGGCAGAAGGGAGG - Intergenic
932175240 2:69594922-69594944 CGTTATGACAGGAAGCAGAGTGG - Intronic
938909632 2:135874976-135874998 CATAATGAAAGGAAGCAGAGTGG + Intronic
939871328 2:147529202-147529224 GGATTTGACATGAAGCAGGGAGG + Intergenic
940039301 2:149343351-149343373 TGATAGGACAGGAATCAGATAGG - Intronic
940627518 2:156193965-156193987 AGAAATGAGAGGAAGCAAAGAGG + Intergenic
942831045 2:180237729-180237751 AAATACGAGAGGAAGCAGAGTGG + Intergenic
942865418 2:180667744-180667766 AGGGATGACAGGAAGCAGAATGG - Intergenic
943116110 2:183672759-183672781 CCATATGAAAGGAAACAAAGTGG + Intergenic
944926192 2:204467571-204467593 AGAAATGAAAGGAAGGAGAGGGG + Intergenic
945982798 2:216327694-216327716 AGATAAGAAAGGAGGCAGAGTGG + Intronic
1172813980 20:37671952-37671974 GGCTCTGACAGGGAGCAGAGAGG + Intergenic
1174849963 20:53984396-53984418 CTGTATGACAGGAAGCAAACAGG + Intronic
1174865683 20:54133418-54133440 TGATATGACAGGAAGGAGGTGGG - Intergenic
1177896421 21:26859538-26859560 AAATACCACAGGAAGCAGAGGGG + Intergenic
1179078021 21:38142480-38142502 GGATTGGTCAGGAAGCAGAGGGG + Intronic
1180681147 22:17627908-17627930 CTATATGATAGGAAACAGTGCGG - Intronic
1182143731 22:27984096-27984118 GCATGTGACAGGGAGCAGAGTGG - Intronic
1183334335 22:37237989-37238011 CTGAATGACAGGAAGCAGGGAGG + Intronic
1184392382 22:44211919-44211941 GGATATAACTGGAAGCAGTGTGG - Intronic
1184397869 22:44255472-44255494 GGGTATGAAAGGAAGAAGAGGGG - Intronic
949322778 3:2829535-2829557 AGATATGACAAGAAGAAGTGAGG + Intronic
950954340 3:17035518-17035540 AGACATGAGAGGCAGCAGAGGGG - Intronic
951152068 3:19302318-19302340 CTCTATGCCAGGAACCAGAGAGG + Intronic
952662819 3:35872004-35872026 CGTTCTAACAGGAAGCAGAGTGG + Intergenic
953969095 3:47333184-47333206 AGATACGACCGGGAGCAGAGGGG + Exonic
955856828 3:63281188-63281210 CGCTATGAAAGGAACCAGTGAGG - Intronic
956719760 3:72107471-72107493 AGTTGTGACAGGGAGCAGAGGGG - Intergenic
959896910 3:111616403-111616425 CCTTATGACAGGAAGCTGAAAGG + Intronic
961129399 3:124451886-124451908 TGAAATCACAGAAAGCAGAGAGG - Intronic
961748628 3:129082143-129082165 ACATGTGCCAGGAAGCAGAGGGG + Intergenic
962628875 3:137255909-137255931 CCATATGCCTGGAAGCACAGAGG + Intergenic
964414726 3:156435202-156435224 AGATATGGCAAGAAGTAGAGAGG + Intronic
967390285 3:188948232-188948254 CGAGATGAAGGGAGGCAGAGCGG - Intronic
969496152 4:7527423-7527445 GGCTGTGACGGGAAGCAGAGTGG + Intronic
969584344 4:8083448-8083470 CAATATGGTAGGAGGCAGAGTGG - Intronic
974937644 4:68427215-68427237 GAATAAGACGGGAAGCAGAGAGG + Intergenic
975630920 4:76401369-76401391 CATGATGACAGGAAGCAGAGTGG + Intronic
978693888 4:111551970-111551992 CGTTATGACAGGAAGCAGAGTGG + Intergenic
979568299 4:122182623-122182645 CCATTTGTCAGGAAGCAGAATGG - Intronic
980978542 4:139634031-139634053 CGAAATGACAGGAGGATGAGGGG - Intergenic
982009165 4:151090374-151090396 CCATAGGAAAGGAAGCAAAGAGG + Intergenic
986183514 5:5416300-5416322 GGACATGACAGTAAGTAGAGTGG + Intergenic
987154184 5:15071376-15071398 GAAAATGACAGGAAGGAGAGAGG + Intergenic
987448326 5:18049667-18049689 CACTATGATCGGAAGCAGAGTGG + Intergenic
988536091 5:32070515-32070537 CTATATGCCATGAAGCAGAAGGG - Intronic
990367954 5:55089135-55089157 GGATATGGCAGCAAGCTGAGAGG + Intergenic
990561789 5:56990866-56990888 CGATAGAAAAGGAAACAGAGAGG - Intergenic
990714310 5:58619600-58619622 CTCTATGACAGAAAGAAGAGAGG - Intronic
995075110 5:107973494-107973516 AGGTATGACAGTTAGCAGAGTGG - Intronic
998371256 5:141663183-141663205 GGATATGGCAGTAAGCAGGGTGG - Intronic
999044814 5:148455591-148455613 GGATATGAGAGTAAGCAGATGGG + Intronic
999307378 5:150528425-150528447 TGGCAGGACAGGAAGCAGAGTGG - Intronic
1000547755 5:162622845-162622867 CGTTTTGACAGGATGCTGAGTGG - Intergenic
1002626023 5:180530399-180530421 CTATATAACAGGAAGCAAAAAGG + Intronic
1004344653 6:14837396-14837418 GGCTATGAGAGGAAGGAGAGAGG + Intergenic
1004619178 6:17318503-17318525 GAAGATGACATGAAGCAGAGTGG - Intergenic
1004693218 6:18010756-18010778 CGATTTGACAGGATGCTGATTGG + Intergenic
1004955299 6:20722517-20722539 CATTATGACAGGAAGCAGAGTGG - Intronic
1005427250 6:25715788-25715810 ATATATGAGTGGAAGCAGAGAGG + Intergenic
1006445672 6:34078527-34078549 CCAGAAGGCAGGAAGCAGAGAGG - Intronic
1007095317 6:39209323-39209345 AGGTATGCCAGGAAGCAGACAGG + Intronic
1007451807 6:41945751-41945773 GGATAAAAGAGGAAGCAGAGAGG - Intronic
1007541025 6:42644681-42644703 CAATATTACAGTAACCAGAGGGG - Intronic
1007749746 6:44064613-44064635 AGAGAAGGCAGGAAGCAGAGGGG + Intergenic
1008195592 6:48516199-48516221 GAATAGCACAGGAAGCAGAGTGG - Intergenic
1009633520 6:66232619-66232641 CTTTAAGAGAGGAAGCAGAGAGG + Intergenic
1010612428 6:77970215-77970237 TGATTTGACAGGAAGGGGAGAGG + Intergenic
1013249301 6:108318202-108318224 CGTTATGATAGGAAGCAGAGTGG + Intronic
1015998018 6:139014443-139014465 GGATATGACACCAAGCGGAGTGG + Intergenic
1016966963 6:149727869-149727891 TGATATGACAGCAAGTTGAGAGG - Intronic
1018039514 6:159909659-159909681 GGAGAGGACAGGAAACAGAGGGG - Exonic
1019939264 7:4276415-4276437 CGAAAGGAAAGGAACCAGAGTGG + Intergenic
1020026736 7:4904903-4904925 GGGCATGACAGGGAGCAGAGGGG + Intergenic
1020962127 7:14818506-14818528 CAATAGGGCAGGAAGCAGAAGGG - Intronic
1021028620 7:15701613-15701635 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1022563683 7:31375317-31375339 GGAAAAGACTGGAAGCAGAGAGG - Intergenic
1023268007 7:38428968-38428990 TGAAAGGACAGGAAACAGAGTGG - Intronic
1023793345 7:43771030-43771052 TGATGGGACAGGAAGCAGTGGGG + Intronic
1023904281 7:44511203-44511225 TGTTATGACAGGAAGCAGAGGGG - Intergenic
1028938814 7:96495998-96496020 TGAAATGACAGCAAACAGAGAGG - Intronic
1030739763 7:113094697-113094719 CTATAGGACAGAAAGCAAAGGGG + Intergenic
1031473261 7:122192127-122192149 AGATATGAGAGGGACCAGAGTGG + Intergenic
1031569138 7:123336481-123336503 CGAGATGGCAGGAAGAAGTGTGG + Intergenic
1031968890 7:128049345-128049367 GGAGAGGACAGGAAGGAGAGGGG - Intronic
1032232467 7:130087156-130087178 GGGAAGGACAGGAAGCAGAGGGG - Intronic
1032259020 7:130319665-130319687 AGATATTACAGGAAGGTGAGGGG + Intronic
1032301935 7:130695719-130695741 AGAGATGACAGAAAGCAGACTGG + Intergenic
1034023036 7:147666425-147666447 TTATATGACTGGAAGCACAGTGG - Intronic
1034187605 7:149191084-149191106 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1034640995 7:152602394-152602416 GGTTATGACAGGAAGCCGAGTGG - Intergenic
1035934790 8:3825116-3825138 TGATTTGAAAGGAAGCACAGGGG + Intronic
1037981326 8:23256572-23256594 CCTTATCCCAGGAAGCAGAGAGG + Exonic
1038681279 8:29670680-29670702 TGATCTGACAGGAGGCAGAGCGG - Intergenic
1039114262 8:34074728-34074750 GAATTTGAAAGGAAGCAGAGAGG + Intergenic
1041625916 8:60026615-60026637 CTATATGAAAGAAAACAGAGAGG - Intergenic
1043517946 8:81013540-81013562 GGATATGGGAGGAAACAGAGAGG - Intronic
1043815436 8:84795111-84795133 AGATATCACAGGAAATAGAGGGG + Intronic
1043924076 8:86016936-86016958 CGTTATGACAGAAAGCAGAGTGG + Intronic
1045117133 8:98994819-98994841 TGAAATAACAGAAAGCAGAGTGG + Intergenic
1045929128 8:107602871-107602893 AGATATCAGAGGAAGCAGAATGG - Intergenic
1048636907 8:136306853-136306875 CGATATGTCATGAAACACAGGGG - Intergenic
1049099094 8:140566689-140566711 CCAGGTGGCAGGAAGCAGAGGGG + Intronic
1049123690 8:140766002-140766024 TTATATGAAAGGAAGCAGTGAGG - Intronic
1049545162 8:143227421-143227443 CGATATGACAGGAATGAGTGTGG + Intergenic
1050920074 9:11189123-11189145 CTAGATGGCAAGAAGCAGAGAGG - Intergenic
1051496246 9:17726673-17726695 CTATAAAATAGGAAGCAGAGAGG + Intronic
1052003705 9:23320526-23320548 CGAACTCACAGGAAGCTGAGAGG + Intergenic
1052325220 9:27210426-27210448 TGTTATGACAGGAAGCCAAGTGG + Intronic
1052865362 9:33461769-33461791 CAGAATTACAGGAAGCAGAGAGG + Exonic
1053116404 9:35507681-35507703 CATTATGACAGGAAGCACAGTGG + Intronic
1055399238 9:75905686-75905708 TGATCTGACAGGAAGTGGAGCGG - Intronic
1055731852 9:79286736-79286758 CCATCTGACAGCAACCAGAGGGG - Intergenic
1057262317 9:93591996-93592018 AGAGAAGGCAGGAAGCAGAGTGG - Intronic
1059321521 9:113474204-113474226 AGCTTTCACAGGAAGCAGAGAGG + Intronic
1059813597 9:117885332-117885354 CTATATTACAGGAAGCAAATGGG + Intergenic
1060396301 9:123319184-123319206 GGAGATGGCAGGAAGCAGGGAGG + Intergenic
1061988182 9:134142591-134142613 TGATTTTACAGGAAGGAGAGGGG - Intronic
1062646241 9:137549995-137550017 AGCTGTGACAGGCAGCAGAGAGG + Intronic
1203781687 EBV:104574-104596 CGATATCACATCAAGCAGAAAGG + Intergenic
1188500863 X:30824702-30824724 AGAAATTACAGGAAGCAGATGGG - Intergenic
1188823019 X:34797927-34797949 CGAAATGACAGGAGGGTGAGGGG - Intergenic
1190898318 X:54642716-54642738 TTATATGACAGAAAGCAGTGGGG - Intergenic
1195083454 X:101391763-101391785 CGTTATGACAGGAAGCAGAGTGG + Exonic
1198211763 X:134522817-134522839 CGTTATGACAGGAAGTAGAGTGG + Intergenic
1198867408 X:141138922-141138944 TATTATGACAGGGAGCAGAGTGG + Intergenic
1198867417 X:141138971-141138993 TGTTATGACAGGAAGCAGAGTGG + Intergenic
1199019404 X:142859185-142859207 AGATATGATATGAAACAGAGAGG + Intergenic
1201383549 Y:13413363-13413385 CCATGTGACAGGAAGCAGCAGGG + Intronic