ID: 911006334

View in Genome Browser
Species Human (GRCh38)
Location 1:93228554-93228576
Sequence CTGTCTACCTTCCCTTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911006334 Original CRISPR CTGTCTACCTTCCCTTATGA AGG Intronic
903638401 1:24837524-24837546 CTTTCTACCTTGCTTTTTGAGGG + Intronic
904570020 1:31456555-31456577 CTTCCTACTTTCCCTGATGAAGG + Intergenic
904908001 1:33912495-33912517 CTGTCTGCCTTCCCTGTTGTAGG + Intronic
905336411 1:37247684-37247706 CAATCTGCCTTCCCTTATAATGG - Intergenic
905354482 1:37371942-37371964 CTGTCTCCCTTCCCCCAGGATGG + Intergenic
906431097 1:45756428-45756450 CTTTCTACCCTCCCTGATGAGGG + Intergenic
906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG + Intergenic
907144523 1:52220199-52220221 CTTTCTACCCTCCCTGATGAAGG + Intronic
907273689 1:53305325-53305347 CTGTGTGCCATCCCTTATGTCGG - Intronic
908197707 1:61761503-61761525 GGGTCTTCCTTTCCTTATGAAGG - Intronic
908865210 1:68540762-68540784 CTGTCTTGCTTCCCATGTGATGG + Intergenic
909761874 1:79298720-79298742 CTGTCTTCCTTCCTTAAGGAAGG + Intergenic
911006334 1:93228554-93228576 CTGTCTACCTTCCCTTATGAAGG + Intronic
911129506 1:94374510-94374532 CTGTGTTCCTTCCTTTCTGAGGG + Intergenic
912822687 1:112880454-112880476 CTGACTTACTTTCCTTATGAAGG + Intergenic
917307330 1:173639979-173640001 CTTTCTACCCTCCCTGATGAAGG - Intronic
917978330 1:180254253-180254275 CTGCCTGCCTTGCCTTGTGAGGG - Intronic
920833281 1:209484527-209484549 CAGTCTATCTTCCCTTCTGAAGG + Intergenic
920985457 1:210884842-210884864 CTGTCTTCCATCCCTTCTGGAGG + Intronic
922614284 1:226952088-226952110 CTGCCTGCCTTCCCTAATGTTGG - Intronic
923965666 1:239135775-239135797 CTATCCACCTTCCCTTGTTAAGG + Intergenic
924138062 1:240991914-240991936 CTGTCTAACTGCCTCTATGAAGG + Intronic
924403767 1:243719721-243719743 CTTTCTCTCTTCCCTTCTGATGG - Intronic
924829172 1:247574255-247574277 CTGTCTCACTTTCCTTGTGAGGG - Exonic
1064756425 10:18575599-18575621 CTTTCTACTCTCCCTGATGAGGG - Intronic
1064770399 10:18717001-18717023 CTGTCTTCATTGCTTTATGAAGG - Intergenic
1068856790 10:61806003-61806025 CTGACTTGCTTCCATTATGAAGG + Intergenic
1069837101 10:71316452-71316474 GTGTCTACCCTACCTCATGAAGG + Intergenic
1071385116 10:85112087-85112109 CTGTCCACCTTCTCCTTTGAGGG + Intergenic
1073591665 10:104763566-104763588 TAGTCCATCTTCCCTTATGATGG + Intronic
1075864862 10:125709082-125709104 CTGTCTACCCTCTCTTCTTAGGG - Intergenic
1077703376 11:4461820-4461842 CTCTCTAACCTCCCTGATGAGGG - Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079779552 11:24583588-24583610 GTGTCTACTTTCCCTTATGAGGG - Intronic
1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG + Intronic
1085764543 11:79271546-79271568 CTCCTTACCTTCCCTCATGAGGG + Intronic
1085938319 11:81177701-81177723 CTGATTACCTTCCATTATGTAGG + Intergenic
1089128315 11:116192934-116192956 CTGTCTCCCTTCCCTCCTGAGGG - Intergenic
1090043679 11:123312738-123312760 CTGTGTACCATGCCTTATGTTGG - Intergenic
1091531556 12:1361516-1361538 AGTTCTAGCTTCCCTTATGAAGG - Intronic
1091696878 12:2633607-2633629 CTGCCTGCCCTCCCTTATGTAGG + Exonic
1091913232 12:4249022-4249044 GAGTCTACTTTCCCTTAGGAAGG + Intergenic
1093271462 12:17067249-17067271 TTGTCTACTGTCCCTTATGAAGG - Intergenic
1093482840 12:19623069-19623091 CACTCTCCCTTCCCTTAGGAAGG - Intronic
1093780170 12:23126509-23126531 GTGTCTTCATTTCCTTATGAGGG + Intergenic
1094226395 12:28050928-28050950 CTTTCCACCTTCCCTTCAGAGGG - Intergenic
1094695032 12:32809571-32809593 CTTTGTACCTTCCCCTAGGAAGG - Intronic
1095162446 12:38933937-38933959 CTTTCTACTTTCCCTGATGAGGG + Intergenic
1096216703 12:49801718-49801740 CTGTCCACCTTCCATTCTGGGGG - Intronic
1096805415 12:54138087-54138109 CTGTTTTCCTTCCCTGATGATGG + Intergenic
1100318151 12:93464750-93464772 CAGTCTTCCTTGTCTTATGAAGG + Intergenic
1101920548 12:108929114-108929136 AGGTCTTCCTTTCCTTATGAAGG + Intronic
1105423063 13:20270220-20270242 CTGTTTACTTTCCATAATGAAGG - Intergenic
1107159593 13:37210762-37210784 CTCTCTTCCTTCCCCTAGGATGG + Intergenic
1108640683 13:52380067-52380089 CTTCCTACCTTCCATTGTGAGGG + Intronic
1108721772 13:53139630-53139652 CTATCCTCCTTCCCTTCTGATGG + Intergenic
1109642187 13:65204683-65204705 GTCTCTACAGTCCCTTATGATGG - Intergenic
1109687746 13:65843636-65843658 CTGTCTCCCTTCCATGATCACGG - Intergenic
1114534028 14:23411964-23411986 CTGTCTGCCTCCCCTCAAGATGG + Intergenic
1115359384 14:32484399-32484421 CAGTCTACCCTCCCTTAGCAGGG - Intronic
1115656116 14:35445358-35445380 GGGTCTTCCTTTCCTTATGAAGG - Intergenic
1116965505 14:51010707-51010729 CTACCTGCCTTCCCTTCTGATGG - Intronic
1118133485 14:62994895-62994917 CTGGCTTCCTTCCCTTTCGATGG + Intronic
1120353472 14:83395405-83395427 CTCTCTTCCTTCCCATATCAGGG - Intergenic
1124125850 15:26937600-26937622 CTGTCTACCTTTCCTGCTTAGGG - Intronic
1124404168 15:29379415-29379437 CTGACTTCCTTGCCTTATGTAGG - Intronic
1125690233 15:41590203-41590225 CTTTCTACTCTCCCTGATGAGGG - Intergenic
1132581951 16:688833-688855 CTGACTCCCTTCCCTCATGTCGG - Intronic
1133956036 16:10444708-10444730 TTTTCTACCTTCCTTGATGAAGG + Intronic
1133960810 16:10491898-10491920 CTTTCTACTTTCCCTGATGAAGG - Intergenic
1137849109 16:51720894-51720916 GTGTCCACCTTCCCATATGGCGG - Intergenic
1139277791 16:65743961-65743983 CTGTCTTCCTTTTCTTATAAAGG - Intergenic
1140065980 16:71611408-71611430 CTTTCAGCCTTCACTTATGAGGG - Intergenic
1144942804 17:18952976-18952998 GTGTCCACCTTCCCTCAGGAAGG - Intronic
1146708562 17:35020695-35020717 CTGTCTACCTTCCCTCTTCTGGG + Intronic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1148779776 17:50114756-50114778 CTTTCTTCCTTCCCTTATGCTGG - Intronic
1150429957 17:65107105-65107127 CTGTCTACCTAGCCATATCATGG + Intergenic
1150961625 17:69919327-69919349 CAGTTTACCTTCCTTTTTGAAGG + Intergenic
1151226070 17:72649199-72649221 CTGTCAGCCTTCCCTTGCGAGGG - Exonic
1151688433 17:75664158-75664180 CTCTCTACCTTCCTTCATGGTGG + Intronic
1151922860 17:77170753-77170775 CTTTCTACTTTTCCTGATGAGGG + Intronic
1152992824 18:378336-378358 CTGTCTACTTTTATTTATGACGG - Intronic
1158991492 18:62873120-62873142 CTCTCTATCATCCCTTATGAAGG - Intronic
1160417215 18:78719828-78719850 GTGTCTTCATTCCGTTATGAAGG + Intergenic
1160713255 19:563224-563246 CTTTCTACCCTCCCTGATGAGGG + Intergenic
1161256213 19:3311325-3311347 CTCTCTCCCTTCCCGTTTGAAGG + Intergenic
1162267904 19:9590999-9591021 CTTTCTACTCTCCCTGATGAGGG + Intergenic
1162273058 19:9631937-9631959 CTTTCTACTTTTCCTTATGAGGG - Intronic
1163202287 19:15777837-15777859 CTGACTTCCTTCCCCTATGGAGG - Intergenic
1165825537 19:38703686-38703708 CTGTCTGCCTGCCCTCGTGAGGG - Intronic
1167113197 19:47473866-47473888 CTGTCTACCTCCCGCTATGGAGG - Intergenic
1167573320 19:50304608-50304630 CTGTTTACCTTCCCATGTGCTGG + Intronic
1168405183 19:56106974-56106996 CTGTCAACCTGCCCTCACGAAGG + Intronic
927779574 2:25928627-25928649 CTGGCTACCTTCCCTTCTGGAGG + Exonic
931144836 2:59506211-59506233 CAGGCCACCTTCCCTTATAAAGG - Intergenic
931556905 2:63516422-63516444 CTGACTACTTTGCCTCATGATGG + Intronic
931669133 2:64630933-64630955 CTCTCTACCATCCCTGATGCTGG - Intergenic
931812664 2:65869628-65869650 CTGACTTCTTTCCCTTATTAAGG - Intergenic
936716424 2:115192036-115192058 CTTTCTACTTTCCCTGATGAAGG + Intronic
936882206 2:117267155-117267177 TTGTCTACTTTTCCTTATGGTGG - Intergenic
937158285 2:119737132-119737154 CTGACCACCTTCCCCTGTGAAGG + Intergenic
937381333 2:121380197-121380219 ATATCTACCCTCCCTGATGATGG - Intronic
937984024 2:127630568-127630590 CTGTCTCCTTTCCCTTGGGAGGG - Intronic
938091105 2:128435400-128435422 GAGTCTGCCTTTCCTTATGAAGG + Intergenic
945483493 2:210368352-210368374 CTTCCTACTTTCCCTGATGAAGG + Intergenic
946948028 2:224842788-224842810 CTGTGTACCTTCCATTAAGGCGG + Intronic
1168824100 20:797515-797537 CTTTCTACTCTCCCTGATGAGGG - Intergenic
1172449100 20:35009219-35009241 CCGTCTTCCTTCCCCCATGACGG - Intronic
1174508224 20:51030838-51030860 CTGTCTTCCTTCCCGTCTGCAGG - Intergenic
1175284610 20:57829729-57829751 CCGGCTACCTTCCCTAATGTGGG + Intergenic
1175758992 20:61548391-61548413 CTGTTTACCTTCTCTTCTCAGGG - Intronic
1177600366 21:23302980-23303002 CTCTCTACCTTCTCATATAAGGG + Intergenic
1181433740 22:22898444-22898466 CTGCCTTCCTTCCCTTCTGAGGG - Intergenic
1181434681 22:22903813-22903835 CTGCCTTCCTTCCCTTCTGAGGG - Intergenic
1181629428 22:24142808-24142830 CTGCCTACCTTCTCTCATCAGGG + Intronic
1183893794 22:40951494-40951516 CTCTCTAGCTTCCCTGAGGAAGG - Intronic
1184064430 22:42109208-42109230 CTTTCTACTCTCCCTGATGAAGG + Intergenic
1185005509 22:48274298-48274320 CTGTCTATCTTTCCTAATAAAGG - Intergenic
949851071 3:8421053-8421075 CAGTCCACCTGCACTTATGAGGG + Intergenic
949852116 3:8429990-8430012 CTTTCTCCCTACCCTTAAGACGG - Intergenic
950343582 3:12271498-12271520 CTGGCTATCTTTCCTTATCATGG + Intergenic
950594399 3:13966068-13966090 CTTTCTACTCTCCCTGATGAAGG + Intronic
950782656 3:15405304-15405326 CAGTCTACTTTCCCTTCTGAAGG - Intronic
950846237 3:16018584-16018606 CTTTCTACTCTCCCTGATGAGGG + Intergenic
951609930 3:24480296-24480318 CAGTATCCCTTCCCTTAGGAGGG + Intronic
953671633 3:44967629-44967651 CGGTCTACTTTCCCTTTTCATGG + Intronic
954390300 3:50265017-50265039 CTGTTCCCCTTCCCTTCTGAGGG - Intergenic
955720161 3:61871808-61871830 CTGCTTGCCTTCCCTTTTGAAGG + Intronic
955735187 3:62031462-62031484 CTGTCTACCTCTCCATATCATGG - Intronic
957313684 3:78550766-78550788 CTTTCTTCTTTCCCTCATGATGG + Intergenic
959105009 3:102055807-102055829 CTCTCTAACTTTCCTTATGCTGG + Intergenic
960707283 3:120493352-120493374 CTTTATACCTTCCCTGGTGAGGG - Intergenic
964388492 3:156174440-156174462 CTAACTACCTACCCTTCTGATGG - Intronic
964574601 3:158151187-158151209 ATGTCTTCATTTCCTTATGAAGG - Intronic
968730031 4:2265205-2265227 CTGTCTCCTTTCCCTCACGACGG + Intergenic
970268444 4:14316045-14316067 CTGTCTTCCTTCCCCTCAGAGGG - Intergenic
971427814 4:26533355-26533377 CTGTCTTCCTTCCATGATGATGG + Intergenic
976398124 4:84579769-84579791 CTGTTTACCTTCTCTTTTGCTGG - Intergenic
977256278 4:94743771-94743793 CTGTTTATATTCTCTTATGAAGG + Intergenic
984287325 4:177748160-177748182 CTGACTTCCTTATCTTATGATGG - Intronic
984893767 4:184517104-184517126 CTGGTTACTTTCCCTTAGGAGGG + Intergenic
990660508 5:58009168-58009190 CTGTCTTCCTTCCCTCCTGGAGG - Intergenic
990675510 5:58180182-58180204 CTGTTTACCTTCCATTCTTAAGG + Intergenic
992736910 5:79730959-79730981 GTGTCTTCCTTCTCTTCTGATGG - Exonic
994497555 5:100533116-100533138 CTTTCTACCTTCACTTAAAATGG + Intergenic
994589958 5:101760197-101760219 CTGTTGCCCTTCCCATATGAAGG + Intergenic
994635462 5:102340360-102340382 CTTTCTACTTTCCCTGAAGACGG + Intergenic
995689056 5:114803120-114803142 GTGGCTCCCTTCCCTTCTGAGGG + Intergenic
998094926 5:139391600-139391622 CTGTCTGCCCTCCCTGATGGTGG - Exonic
1003209431 6:4047824-4047846 TTCTCTACCTCCTCTTATGAAGG - Intronic
1004924602 6:20404153-20404175 CTGTCTTCCTTCCCTTGTGCTGG + Intronic
1005575228 6:27183875-27183897 CTTTCTACCCTCCCTGATGAGGG - Intergenic
1005983621 6:30856330-30856352 CTGGCTACCTGCCCTGATGGTGG - Intergenic
1006049635 6:31331817-31331839 CTTTCTACTCTCCCTGATGAAGG + Intronic
1007075750 6:39065176-39065198 CTGTCTTCCTTCCCTTCTCTTGG + Intronic
1009846022 6:69135965-69135987 TTTTCTACCTTCCCTGGTGAAGG - Intronic
1012424015 6:99094682-99094704 GTGTCTTCATTCCCTTTTGAAGG - Intergenic
1013927456 6:115490265-115490287 CTCTTCACCTTCCCTCATGACGG + Intergenic
1014394768 6:120913034-120913056 CTCTCTACCTTCCCTTCTCAAGG + Intergenic
1017749702 6:157479901-157479923 CTGTCTACTTTCACTCATGGAGG - Intronic
1018279480 6:162170160-162170182 CTGTCTCCATACCCTTCTGAGGG + Intronic
1019603627 7:1897747-1897769 CTGTCTACCTTGCCCTGTGCTGG + Intronic
1021073469 7:16272638-16272660 CTTTTTCCCTTCCCTTATAAAGG - Intronic
1021197022 7:17685316-17685338 CTGTCTTCCTCTTCTTATGAAGG + Intergenic
1021490385 7:21213977-21213999 CTGTCTTCCTTCCTTTAAAAGGG + Intergenic
1021930191 7:25573023-25573045 ATCTCTACTTTCCCTAATGAAGG - Intergenic
1024548545 7:50541551-50541573 CTCTCTGCCTTTTCTTATGAGGG - Intronic
1025101479 7:56138938-56138960 CTGGCTTCCTTCCCATTTGAAGG + Intergenic
1033066964 7:138165190-138165212 AGGTCTTCCTTTCCTTATGAAGG + Intergenic
1033097640 7:138444701-138444723 CTTTCTACTCTCCCTGATGAGGG + Intergenic
1033225169 7:139555768-139555790 TTGTCTATCTTCCATTGTGAAGG + Intergenic
1034670692 7:152855922-152855944 CTGGCTACGTTTCTTTATGAAGG - Intergenic
1036104506 8:5825459-5825481 CTTTCTACTCTCCCTGATGAAGG + Intergenic
1040983585 8:53269776-53269798 TTGTCTACTTTCCCTGATGATGG + Intergenic
1042003525 8:64154678-64154700 GGGTCTTCCTTTCCTTATGAAGG - Intergenic
1055299564 9:74868957-74868979 CTGTCTCCCTTCCCTAATTCAGG - Intronic
1057583731 9:96310943-96310965 CTGTCTACTCTTCCTTATGAGGG + Intergenic
1057988191 9:99739488-99739510 CTGTATACCTTCCCTAAGAAAGG - Intergenic
1058247988 9:102654620-102654642 CTTTCTACCTTCCCTCAAGGTGG - Intergenic
1059764155 9:117367583-117367605 TTGTCTGCCTTCCCTTCAGACGG + Intronic
1061279816 9:129591141-129591163 CTTTCTACCTTCCCAGAAGATGG + Intergenic
1061829350 9:133280999-133281021 CTTTCTACCTTCCCTGATGAGGG + Intergenic
1062113146 9:134793317-134793339 CTGTCTTCTTGCCCTTAGGAAGG - Intronic
1202629687 M:6283-6305 CAGTCTACCCTCCCTTAGCAGGG + Intergenic
1186384386 X:9094203-9094225 CTTTCTACCTACTCTTATGGAGG - Intronic
1191641030 X:63429904-63429926 CTGTATACATTCCCTTACCATGG - Intergenic
1192152574 X:68721301-68721323 CAGTCTACCTTTCCATATAATGG - Intronic
1195925396 X:110019596-110019618 GTGTTTACCATCCCTGATGAAGG - Intronic
1198586259 X:138125329-138125351 CAGTTTGCCTTCCCTTAGGAGGG - Intergenic
1198735971 X:139785692-139785714 CTGAGTCCCTTCCCTTATGCGGG + Intronic
1199634688 X:149804169-149804191 CTGCCTTCCTTCCGTTCTGATGG - Intergenic
1199861257 X:151801863-151801885 CTGTCTCCCTTTCCTGCTGATGG - Intergenic