ID: 911012600

View in Genome Browser
Species Human (GRCh38)
Location 1:93297057-93297079
Sequence AGTAAGAGCGCAGTGATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911012600_911012608 28 Left 911012600 1:93297057-93297079 CCCAAAATCACTGCGCTCTTACT No data
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data
911012600_911012607 27 Left 911012600 1:93297057-93297079 CCCAAAATCACTGCGCTCTTACT No data
Right 911012607 1:93297107-93297129 CGCTATATAACCTACTGCTGGGG No data
911012600_911012606 26 Left 911012600 1:93297057-93297079 CCCAAAATCACTGCGCTCTTACT No data
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data
911012600_911012605 25 Left 911012600 1:93297057-93297079 CCCAAAATCACTGCGCTCTTACT No data
Right 911012605 1:93297105-93297127 TGCGCTATATAACCTACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911012600 Original CRISPR AGTAAGAGCGCAGTGATTTT GGG (reversed) Intergenic
No off target data available for this crispr