ID: 911012601

View in Genome Browser
Species Human (GRCh38)
Location 1:93297058-93297080
Sequence GAGTAAGAGCGCAGTGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911012601_911012607 26 Left 911012601 1:93297058-93297080 CCAAAATCACTGCGCTCTTACTC No data
Right 911012607 1:93297107-93297129 CGCTATATAACCTACTGCTGGGG No data
911012601_911012605 24 Left 911012601 1:93297058-93297080 CCAAAATCACTGCGCTCTTACTC No data
Right 911012605 1:93297105-93297127 TGCGCTATATAACCTACTGCTGG No data
911012601_911012606 25 Left 911012601 1:93297058-93297080 CCAAAATCACTGCGCTCTTACTC No data
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data
911012601_911012608 27 Left 911012601 1:93297058-93297080 CCAAAATCACTGCGCTCTTACTC No data
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911012601 Original CRISPR GAGTAAGAGCGCAGTGATTT TGG (reversed) Intergenic