ID: 911012602

View in Genome Browser
Species Human (GRCh38)
Location 1:93297080-93297102
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911012602_911012608 5 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data
911012602_911012605 2 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012605 1:93297105-93297127 TGCGCTATATAACCTACTGCTGG No data
911012602_911012606 3 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data
911012602_911012607 4 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012607 1:93297107-93297129 CGCTATATAACCTACTGCTGGGG No data
911012602_911012609 11 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012609 1:93297114-93297136 TAACCTACTGCTGGGGGATATGG No data
911012602_911012611 20 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012611 1:93297123-93297145 GCTGGGGGATATGGAAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911012602 Original CRISPR GAGAGAATCTGTGCATTTTG GGG (reversed) Intergenic
No off target data available for this crispr