ID: 911012604

View in Genome Browser
Species Human (GRCh38)
Location 1:93297082-93297104
Sequence GAGAGAGAATCTGTGCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1013
Summary {0: 12, 1: 49, 2: 113, 3: 210, 4: 629}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911012604_911012609 9 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC 0: 12
1: 49
2: 113
3: 210
4: 629
Right 911012609 1:93297114-93297136 TAACCTACTGCTGGGGGATATGG No data
911012604_911012611 18 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC 0: 12
1: 49
2: 113
3: 210
4: 629
Right 911012611 1:93297123-93297145 GCTGGGGGATATGGAAGCAGTGG No data
911012604_911012608 3 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC 0: 12
1: 49
2: 113
3: 210
4: 629
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data
911012604_911012605 0 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC 0: 12
1: 49
2: 113
3: 210
4: 629
Right 911012605 1:93297105-93297127 TGCGCTATATAACCTACTGCTGG No data
911012604_911012607 2 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC 0: 12
1: 49
2: 113
3: 210
4: 629
Right 911012607 1:93297107-93297129 CGCTATATAACCTACTGCTGGGG No data
911012604_911012606 1 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC 0: 12
1: 49
2: 113
3: 210
4: 629
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911012604 Original CRISPR GAGAGAGAATCTGTGCATTT TGG (reversed) Intergenic
901912269 1:12469161-12469183 CAGAGAGAATTTGTACATATGGG + Intronic
904170279 1:28587014-28587036 GGGACAGAAATTGTGCATTTGGG - Intergenic
905106022 1:35564074-35564096 GAAAGAGAATGTTAGCATTTTGG - Intronic
907035798 1:51215128-51215150 GAGACAGTATATGTGCATGTTGG - Intergenic
907795167 1:57708756-57708778 GAGAGAAAATCTGTGCTTAAGGG - Intronic
908072587 1:60478910-60478932 GAGACAGAGTCTCTCCATTTTGG + Intergenic
908347568 1:63250996-63251018 GAAATGGAATCTGTGCATATAGG + Intergenic
908363278 1:63390824-63390846 AAGAGAGAATCTGTGTGTTTGGG - Intronic
909083836 1:71147862-71147884 GAGAGAGAATCAGTGCAAGCCGG - Intergenic
909084619 1:71155997-71156019 CAGAGAGGATCTGTGCACTTGGG - Intergenic
909209817 1:72808778-72808800 GAGAGAGAAGCTGTGTACTTGGG - Intergenic
909384081 1:75035797-75035819 GAGAGAGACTCTGTATGTTTTGG + Intergenic
909696133 1:78469930-78469952 CAGAGAGGACCTGTGCATTCTGG + Intronic
909709300 1:78627134-78627156 GAGAGATAAGCTAGGCATTTGGG - Intronic
910224058 1:84918418-84918440 GAGAGAGAACCTGGTCAGTTAGG - Intergenic
910349428 1:86278335-86278357 GAGAATGAATCTGTGTACTTTGG - Intergenic
910547466 1:88433812-88433834 GAGAGAGACTCTGTATGTTTGGG + Intergenic
910560144 1:88581594-88581616 CACAGAGAATCCATGCATTTGGG + Intergenic
910627402 1:89322722-89322744 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
911011603 1:93287155-93287177 CAGGGAGAATCTGTGCTCTTGGG + Intergenic
911012604 1:93297082-93297104 GAGAGAGAATCTGTGCATTTTGG - Intergenic
911239524 1:95449719-95449741 GAGAGAGAATCTGCATGTTTGGG - Intergenic
911241477 1:95471746-95471768 GACAGACAATCTGTGCACTTGGG - Intergenic
911487054 1:98515574-98515596 GAGAGAGAATCTATACACTTGGG + Intergenic
911939003 1:104018693-104018715 GAGAGAGACTCTATTTATTTGGG - Intergenic
911942864 1:104069538-104069560 GAGATAGAATCTGTGCACTTTGG - Intergenic
911960839 1:104300890-104300912 GAGAGACAATCTGGGCATTTCGG + Intergenic
912015234 1:105026663-105026685 GAGAGAGAATCTGTTTTCTTGGG + Intergenic
912099778 1:106190869-106190891 GAGAGAGACTCTGTTTGTTTTGG + Intergenic
912116862 1:106418131-106418153 GAGAGAGAATCTGTGCACTTAGG + Intergenic
912502702 1:110132791-110132813 GAGACTGAATCAGAGCATTTTGG + Intergenic
912820860 1:112866690-112866712 GAGAGAGAATGTGGGTATATGGG - Intergenic
913136293 1:115892631-115892653 GAGAGAAAATAAATGCATTTTGG + Intergenic
913147194 1:116003649-116003671 AAGAGAGAATCTGTGTGCTTGGG - Intronic
914958419 1:152185218-152185240 AAGAGAGGATGTTTGCATTTGGG + Intergenic
915185821 1:154104511-154104533 GAGAGAGAATCTGTGCACCTGGG + Intronic
915186167 1:154106664-154106686 GAGAGAGACTCTGTTTGTTTGGG + Intronic
915650685 1:157308217-157308239 GAGAAAGCATCTCTGCATTAGGG - Intergenic
915693762 1:157717142-157717164 TAGAGAGAATTCGTGCAGTTGGG - Intergenic
915752658 1:158226736-158226758 GAGAGAGAATCTATGTGCTTAGG + Intergenic
917003234 1:170384780-170384802 GAGAGAGACTCTGTATGTTTGGG - Intergenic
917300682 1:173570857-173570879 GAGAGAGAATCTGTGCACTTGGG - Intronic
917306383 1:173628936-173628958 GAGAGAGACTCTGTTTATTGAGG + Intronic
917405046 1:174696703-174696725 GAGAAAGAATCCATGCACTTGGG - Intronic
917714163 1:177717303-177717325 GAGTGAGAATCTGTGTTGTTTGG - Intergenic
918323491 1:183387648-183387670 AAGACAGAAGCTGGGCATTTGGG - Intronic
918554060 1:185778213-185778235 GAGGGACAAACTGTGGATTTTGG + Intronic
918752690 1:188292514-188292536 GAGAGAAAAACTGTGCACTTGGG + Intergenic
918915880 1:190635548-190635570 CAGACAGAATCTGTGCACTTAGG - Intergenic
919169698 1:193938527-193938549 AAGAGAGAATCTGTGCACTTGGG + Intergenic
919180915 1:194080280-194080302 CAGAGGGATTCTGCGCATTTAGG - Intergenic
919262134 1:195209345-195209367 GAGAGAGAATGAGTGCAAGTAGG - Intergenic
919455765 1:197818246-197818268 AAGAGAGAATCTGTGCTTTGGGG + Intergenic
919515028 1:198511726-198511748 GAGAGAGAATTTGTGTGCTTGGG - Intergenic
919823981 1:201490796-201490818 AAGAGACTATCTGTGCATGTTGG + Intronic
920595053 1:207260323-207260345 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
921146941 1:212367339-212367361 CAGAGAGAATCTGTGAGCTTGGG + Intronic
921432191 1:215078492-215078514 GAGAGAGAATCAGTGCCAGTAGG + Intronic
921929508 1:220743581-220743603 AAGAGAGAGTCTGTGCTCTTGGG - Intergenic
922044184 1:221927854-221927876 GTGAGATAATCTGTGCACTTAGG + Intergenic
922689378 1:227675941-227675963 GAGAGATAAGCTGTGCATTCAGG + Intronic
923625552 1:235611143-235611165 GAGAGAGAATCTCTGCCCTGTGG - Intronic
924183987 1:241467426-241467448 GAGAGAGAAGTTGTGACTTTGGG + Intergenic
924197226 1:241620867-241620889 TAGAGAAACTCTGTGCATATTGG + Intronic
924516064 1:244767563-244767585 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
924821577 1:247496138-247496160 GAGAGAAAATGAATGCATTTAGG + Intergenic
1063855201 10:10242313-10242335 GAGAGAGATACTGTCCACTTGGG - Intergenic
1064446460 10:15398323-15398345 CACAGAGAATCTGTGTACTTTGG + Intergenic
1064521792 10:16210320-16210342 GATGGAGAATCTGTGCTCTTGGG - Intergenic
1065047724 10:21758990-21759012 GCGTGTGAATCTGTGCATTCAGG - Intronic
1065921711 10:30398934-30398956 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1066143113 10:32527239-32527261 GAGAAAGAATCTGTGCACTTTGG - Intronic
1066324382 10:34342072-34342094 GAGAGAGTATCTTTGGCTTTAGG - Intronic
1066418154 10:35240233-35240255 GAGAGAAATTCTCTGGATTTAGG - Intergenic
1067258198 10:44663522-44663544 GAGATTGAATCTGTGAACTTTGG - Intergenic
1068699681 10:60006727-60006749 GTGAGGGAATCTTGGCATTTTGG + Intergenic
1068706596 10:60083456-60083478 AACAGAGAATCTGTGAATTATGG - Intronic
1068919027 10:62463914-62463936 GAGACTCAAACTGTGCATTTTGG + Intronic
1069056153 10:63847091-63847113 GAGAGAGAATCTGTGCATTTGGG + Intergenic
1069147921 10:64918286-64918308 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
1069151587 10:64967718-64967740 GAATGGGAATCTGTGGATTTTGG + Intergenic
1069343312 10:67438716-67438738 GAGAGAGAATCTGTGCACAAGGG + Intronic
1069899450 10:71698864-71698886 GAGTGAGAACTTGGGCATTTTGG - Intronic
1070158721 10:73852540-73852562 ATTAGTGAATCTGTGCATTTTGG - Intronic
1070464128 10:76702853-76702875 GAGTGAGAACCTGTGTGTTTGGG + Intergenic
1070655113 10:78266143-78266165 GTGAGAGCATGTGTGCATGTGGG + Intergenic
1071801230 10:89063746-89063768 GAGATAGAACCTATGCTTTTAGG + Intergenic
1071896843 10:90076849-90076871 GTGAGAGAATCTGTGCATTTGGG - Intergenic
1071962544 10:90821305-90821327 CATAGAGAATCCGTGCACTTGGG + Intronic
1072058664 10:91787360-91787382 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1072396739 10:95050572-95050594 GAGAGAGACTTTGTTTATTTGGG + Intronic
1072688742 10:97555571-97555593 GGGATAGAAATTGTGCATTTGGG - Intronic
1072853764 10:98925047-98925069 GAGAGAGAACTTGAGCACTTTGG - Intronic
1073872308 10:107879630-107879652 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1073944471 10:108734209-108734231 GACAGAGAATTTGAGCTTTTTGG + Intergenic
1074038313 10:109762777-109762799 GAAAGATAATCTGTGCTCTTGGG - Intergenic
1075338900 10:121629874-121629896 AAGAGTGGATCTGTGCAGTTTGG - Intergenic
1076376703 10:129993121-129993143 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1077427324 11:2489217-2489239 GAGAGAGAATCTGAGAGCTTGGG + Intronic
1077835366 11:5922640-5922662 GAGAGAGAATCTGTTAACTTTGG + Intronic
1078028863 11:7728095-7728117 GAGAGATAAACAGTGCTTTTGGG + Intergenic
1078557933 11:12345800-12345822 GAGAGAGGGTCTCTCCATTTTGG + Intronic
1078690777 11:13578710-13578732 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1078958790 11:16237887-16237909 GAGAGAAAATATATGCTTTTTGG + Intronic
1078992518 11:16664362-16664384 GAGAAAGAATCTGTACACTTGGG + Intronic
1079272162 11:18999147-18999169 GAGAGAGACTCTGTATGTTTGGG - Intergenic
1079321022 11:19451410-19451432 GAGAGAGAATGTGTACCATTTGG - Intronic
1079530654 11:21448027-21448049 CAGAGAGAATCTGTGCGTTTGGG - Intronic
1079558774 11:21794769-21794791 GAGAGAGTTTCTGTGCTTTGGGG - Intergenic
1079841641 11:25408756-25408778 GAAAGGGAATATTTGCATTTTGG - Intergenic
1079879567 11:25908053-25908075 GAGAAATAATATGTTCATTTTGG + Intergenic
1080128463 11:28765886-28765908 GAGAGAGATTCTGTGCATTTGGG + Intergenic
1080315496 11:30943219-30943241 GAGAGAGCATGTGTTCGTTTTGG + Intronic
1080329233 11:31116012-31116034 GAGAGGGAATCTGGGCAGTGTGG + Intronic
1081212710 11:40355646-40355668 GAGAGAGAATCTGTGCTTGCGGG - Intronic
1082002640 11:47401734-47401756 GATTGAGCATCTGTGGATTTTGG + Intergenic
1083512892 11:63227960-63227982 CACAGAGAATCTGTGCACTTGGG - Intronic
1084459559 11:69288870-69288892 GAGAGAGATTCTTTGCATACAGG - Intergenic
1084763965 11:71295426-71295448 GAGGGAGAATCTGTGCACTCTGG - Intergenic
1085562657 11:77486607-77486629 GAGAGAGAATCTATGTGTTTGGG + Intergenic
1085901738 11:80708343-80708365 GAGAGAAAAAAAGTGCATTTAGG + Intergenic
1085981537 11:81732473-81732495 GAGAGAGACTCTGTATGTTTGGG - Intergenic
1086248305 11:84782399-84782421 GAAAGAGAATGTGTGTATGTAGG - Intronic
1086249842 11:84799352-84799374 AAGAGAGAATCTGTGCACTTGGG - Intronic
1086468072 11:87075874-87075896 GAGAGAGACCCTGTTTATTTAGG - Intronic
1087012993 11:93530795-93530817 GAGAAGGAATGTGTGCACTTGGG - Intronic
1087032141 11:93716307-93716329 GAGAGAGAATCTGTATGCTTGGG - Intronic
1087299186 11:96412940-96412962 GAGAGAGAATATGTACTCTTGGG + Intronic
1087312557 11:96561485-96561507 GAGTGAGAATCTGTGGTGTTTGG - Intergenic
1087370797 11:97280632-97280654 GAGAGAGAGTCTGTACGTTTGGG + Intergenic
1087492264 11:98844140-98844162 GAGAGAGAATCTATTTGTTTGGG - Intergenic
1087691149 11:101321567-101321589 GAGAGAGAATCTGTATTCTTGGG - Intergenic
1087721082 11:101665900-101665922 CACAGAGAGTCTGTGCACTTGGG - Intronic
1087887466 11:103497129-103497151 CAGAGAGAATCTGTGCACTTTGG + Intergenic
1088135926 11:106555138-106555160 TATAGAGAATCTATGCACTTTGG - Intergenic
1088181702 11:107120732-107120754 GTGAGAGAATCTGTGTGCTTGGG + Intergenic
1088944586 11:114496337-114496359 GAGGGAAAATCTGTGCACTTGGG - Intergenic
1088985078 11:114898782-114898804 GAGAGAAAATCTGAGAACTTGGG + Intergenic
1089183538 11:116599150-116599172 GAGAGAGAATAGGAGCACTTTGG - Intergenic
1089209970 11:116793050-116793072 CAGAGAAGATCTGAGCATTTGGG - Intergenic
1089234421 11:117010931-117010953 GAGACAGGATCTGTCCATGTTGG - Intronic
1089838030 11:121388999-121389021 GAGACAGAATCTTTTCCTTTAGG + Intergenic
1090676779 11:129006571-129006593 GAGAGAGACTTTGTTTATTTGGG - Intronic
1090902207 11:131043105-131043127 AAGAGAGACTCAATGCATTTAGG + Intergenic
1091275969 11:134350450-134350472 GAGAGAGGATCTGTGCATTTGGG - Intronic
1092375141 12:7949232-7949254 GAGAGAGAATTTTTACAGTTTGG + Intergenic
1092497509 12:9011792-9011814 GAGAGAGAGTCTGTGCTTTGGGG + Intergenic
1093122898 12:15294581-15294603 CAGAGGGAATGTGTGCACTTAGG + Intronic
1093123518 12:15300936-15300958 GAGAGAGAATGAGTGCAAATAGG + Intronic
1093123919 12:15306296-15306318 GATAGAGACTCTGTGTGTTTGGG - Intronic
1093403454 12:18776584-18776606 GAAAGAGAATCTGTGCTTTTGGG + Intergenic
1093581738 12:20791219-20791241 CAGAGAGAATCTGTGCACTGTGG - Intergenic
1093619887 12:21276713-21276735 GAGAAGGAATCTGAGCACTTGGG + Intronic
1093858976 12:24140025-24140047 AAGAAATAATCTGTTCATTTAGG - Intergenic
1093991237 12:25591851-25591873 GAGAGAGACTCTATTTATTTGGG + Intronic
1094280515 12:28732272-28732294 GAGAGAGAAACTGGGCTGTTGGG + Intergenic
1095163208 12:38941063-38941085 GAGAGAGAATCTGTACACTTTGG + Intergenic
1095181829 12:39154830-39154852 CAAAGAGAATCTGTGCACTTGGG - Intergenic
1095573505 12:43709299-43709321 AAGAGAGAATCTGTTTGTTTGGG - Intergenic
1095860136 12:46907777-46907799 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1096129694 12:49148080-49148102 GAGAGAGAATGTGTGAAATGTGG + Intergenic
1096343843 12:50828195-50828217 GAGACAGACTCTGTGTGTTTGGG - Intergenic
1096444125 12:51673331-51673353 GATTGAGCATCTGTGGATTTTGG + Intronic
1097150781 12:56978459-56978481 GAGAGAGATTCTGTATGTTTGGG - Intergenic
1097508509 12:60506908-60506930 AAGAGAAAGTCTGTGCACTTGGG + Intergenic
1097899392 12:64857924-64857946 GAGAAAGAGTCTGTGCACTTGGG - Intronic
1098395196 12:70010188-70010210 GAGAGACAATCTGTGCACTTGGG + Intergenic
1098503838 12:71226539-71226561 GAGAAAGAATCTGTGCACTTGGG + Intronic
1099101017 12:78440119-78440141 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
1099156450 12:79182347-79182369 AAGAGAGAATAAGAGCATTTAGG - Intronic
1099548557 12:84014307-84014329 GAGAGAGAATCTGTGCACATGGG - Intergenic
1099562340 12:84193598-84193620 GGGAGAAAATCTGTGCACTTTGG - Intergenic
1099826010 12:87779193-87779215 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
1099826233 12:87780576-87780598 GAAAGAGAATCTGTGCATTTTGG - Intergenic
1099882078 12:88479528-88479550 GAGAGAGAATCTAAGCGCTTGGG + Intergenic
1100061117 12:90576452-90576474 GAGAGAGAATCTGAGCACTTCGG - Intergenic
1100305237 12:93344330-93344352 GATGGAGAATCTGTGCCTATGGG - Intergenic
1100904803 12:99285731-99285753 GAGAGAGAATCTGTGTGCTTGGG + Intronic
1100909297 12:99339353-99339375 GAGAGAGAATTTGTGTGTTTGGG - Intronic
1100996735 12:100308921-100308943 GAGACATAATCTGTGCACTTGGG - Intronic
1101252106 12:102946581-102946603 GACAGAGAATCTGTGTGCTTCGG - Intronic
1101393689 12:104324934-104324956 AAAAGAGAATCTCTGAATTTGGG + Intronic
1101411255 12:104470351-104470373 GAGAGAGAATGTGTGCAAGCAGG + Intronic
1101539137 12:105648810-105648832 GTGAGAGAATAAGTGCACTTTGG + Intergenic
1103242627 12:119427217-119427239 CAGAGAAAATCACTGCATTTTGG + Intronic
1104097562 12:125571679-125571701 AAGAGAGAATATGCACATTTGGG - Intronic
1104738361 12:131153989-131154011 GAGAGAGAGTCACTTCATTTAGG - Intergenic
1105938134 13:25120739-25120761 GAGAGAGAATCTTTGTGCTTGGG + Intergenic
1106550631 13:30767930-30767952 AAGAGATAATCTGTGCAACTGGG + Intergenic
1106864577 13:33949234-33949256 GAGAGAGAATGAGTGCAAGTGGG - Intronic
1106919422 13:34547764-34547786 TAGAAAGAACATGTGCATTTAGG - Intergenic
1106963948 13:35037674-35037696 GAGAGAGACTCTGTGTGCTTGGG - Intronic
1107142493 13:37016673-37016695 GATAGAGAAACTCTGGATTTGGG + Intronic
1107582142 13:41802192-41802214 GAGAAAGAATCTGTGTGCTTGGG + Intronic
1108425336 13:50293434-50293456 GAGAGAGAAGAACTGCATTTAGG - Intronic
1108631577 13:52288969-52288991 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
1108655118 13:52523626-52523648 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
1108771200 13:53702215-53702237 GAGAGAGAATGAGTGCAAGTAGG + Intergenic
1108889903 13:55244555-55244577 AGCAGAGAATCTGTGCCTTTAGG + Intergenic
1108997136 13:56748249-56748271 GAGAAATAATCTATGCACTTGGG - Intergenic
1109211370 13:59538987-59539009 GAGAGAGAGTCTATGCACTTGGG - Intergenic
1109336785 13:61004298-61004320 GAGACAGAATCTGTGTGCTTGGG - Intergenic
1109352050 13:61195393-61195415 CGGAGAGAACCTGTGCACTTGGG + Intergenic
1109367282 13:61372122-61372144 GGGAAAGAATCTTAGCATTTTGG + Intergenic
1109854601 13:68110772-68110794 CAGAGAGAATCTATGCATTTGGG + Intergenic
1109900485 13:68762936-68762958 AAGAGAGAATCTGTGAAACTGGG + Intergenic
1109923724 13:69106174-69106196 GAGAGAGAACCTGTGGGCTTGGG + Intergenic
1110023836 13:70510303-70510325 GAGAGAGGGTTGGTGCATTTGGG + Intergenic
1110750355 13:79107604-79107626 GAGTGAGAATCTGTGGTGTTTGG - Intergenic
1110865765 13:80394009-80394031 GACAGTGAATCTTTTCATTTTGG - Intergenic
1111085924 13:83374688-83374710 GAGAGAGAATTTGTGTGCTTGGG - Intergenic
1111404883 13:87790813-87790835 GAGTGAGAATATGTGCTGTTTGG + Intergenic
1111583456 13:90253767-90253789 GAGAGAGAACCTGTGTGCTTGGG - Intergenic
1111642792 13:90992243-90992265 AATTAAGAATCTGTGCATTTAGG - Intergenic
1111825703 13:93264320-93264342 ACTAGAGCATCTGTGCATTTTGG - Intronic
1112743208 13:102497772-102497794 CAGAGAGAATCTGTGTGCTTGGG + Intergenic
1112940313 13:104854119-104854141 GAGAGAGAATTTGTGCACTTGGG + Intergenic
1112944507 13:104910773-104910795 AAGAGAGAATCTGTGCACTTGGG - Intergenic
1112960092 13:105113333-105113355 GAGAGAGAATCTATGTGTTCTGG + Intergenic
1113213021 13:108004073-108004095 AAGAGAGAATCTGTACACTTGGG - Intergenic
1113244433 13:108378278-108378300 GAGAGAGAATCTATGTAGTCGGG - Intergenic
1113558490 13:111257752-111257774 GAGAGAAAACCTGTGCACTTCGG + Intronic
1113876801 13:113599760-113599782 GAGAGAGAATCCTTGCACTTAGG + Intronic
1113876842 13:113600004-113600026 GAGAGAGAATCCTTGTATGTAGG + Intronic
1113876850 13:113600060-113600082 GAGAGAGAATCCTTGCACGTAGG + Intronic
1113876860 13:113600116-113600138 GAGAGAGAATCCTTGTATGTAGG + Intronic
1113876869 13:113600172-113600194 GAGAGAGAATCCTTGCACGTAGG + Intronic
1113876959 13:113600693-113600715 GAGAGAGAATCCTTGCATGTAGG + Intronic
1113876976 13:113600783-113600805 GAGAGAGAATCCTTGCACGTAGG + Intronic
1114014904 14:18419098-18419120 TTGAGAGCAGCTGTGCATTTTGG - Intergenic
1114072543 14:19126332-19126354 GAGAGAGACTCTGTGTTCTTGGG - Intergenic
1114089714 14:19273643-19273665 GAGAGAGACTCTGTGTTCTTGGG + Intergenic
1114136486 14:19857742-19857764 GAAAGAGAATCTGTGCTGATAGG + Intergenic
1114319722 14:21537067-21537089 GAGAGAGAGTCTGTGTCTCTGGG - Exonic
1114767127 14:25385977-25385999 GAGAAAGAACCTTGGCATTTGGG + Intergenic
1114783852 14:25570978-25571000 GACAGAGAATCTGTGCACTTTGG - Intergenic
1115133825 14:30085787-30085809 CATGGAGAATCTGTGCACTTAGG + Intronic
1115282278 14:31677648-31677670 GAGAGAGATTCTGTTTGTTTGGG - Intronic
1115314135 14:32008655-32008677 GAGAGAGAGACTGGGCATATTGG - Intronic
1115660881 14:35493582-35493604 AAGAGAGAATTTGTGTACTTGGG + Intergenic
1115821110 14:37212874-37212896 GAGAGAGATTCTGTGTGTTTGGG + Intronic
1116114871 14:40635364-40635386 GAGAAAGAACCTGTGCATTTTGG + Intergenic
1116392723 14:44413018-44413040 TAGAGATAAACTGTGCACTTAGG + Intergenic
1116669538 14:47822639-47822661 GATAGAGAATTTGTGTGTTTGGG - Intergenic
1116725054 14:48553201-48553223 GAGAGAGACTCTGTATGTTTTGG - Intergenic
1116888941 14:50248976-50248998 GAGACAGAACCTATGCACTTGGG + Intronic
1117110260 14:52446237-52446259 AAGAGAGAATCTATGTGTTTGGG + Intronic
1117161336 14:52993595-52993617 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
1117258745 14:54007123-54007145 GAGAGAAAACCAGTGCATCTGGG - Intergenic
1117384374 14:55195834-55195856 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1117504551 14:56389133-56389155 GAGAGAAAATCTGTGCACTTGGG - Intergenic
1117607112 14:57440984-57441006 CATAGAGAATCTGTGCACTTAGG - Intergenic
1117795549 14:59389393-59389415 GAGAGAGAATCTGTGCACTGAGG - Intergenic
1117843144 14:59881531-59881553 GAGAGAGAATCTTTGCATTTAGG - Intergenic
1117870650 14:60197427-60197449 GAGAGAGAATCTGTGCATTTGGG + Intergenic
1118241285 14:64060954-64060976 GAGAAAGAATCCGTGCACGTGGG - Intronic
1118543428 14:66857834-66857856 GAGAGAGAATCTGTGCATTTGGG + Intronic
1118962284 14:70545316-70545338 CACAGAGAATCTGCGCACTTGGG + Intergenic
1119809493 14:77504711-77504733 AAGAGAAAATCTGTGACTTTAGG - Intergenic
1120100000 14:80434449-80434471 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1120107862 14:80516769-80516791 GAGAGAGAATCTGTGTGTTTTGG - Intronic
1120426065 14:84350269-84350291 GAGAGAGAATCTGTGCTTGTGGG + Intergenic
1120467844 14:84884515-84884537 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1120975961 14:90248491-90248513 TAGAGAGAATCATTCCATTTGGG + Intergenic
1121375824 14:93410128-93410150 GAGAGAGAATCTGGACACTTGGG + Intronic
1121994888 14:98593960-98593982 GAGTCAGGCTCTGTGCATTTGGG + Intergenic
1202830378 14_GL000009v2_random:21799-21821 GAAATATAAACTGTGCATTTTGG + Intergenic
1123502462 15:20902440-20902462 TAGACAGAATCTGTACACTTGGG + Intergenic
1123559712 15:21476107-21476129 TAGACAGAATCTGTACACTTGGG + Intergenic
1123595946 15:21913406-21913428 TAGACAGAATCTGTACACTTGGG + Intergenic
1123605527 15:22023919-22023941 GAGTGAGAATATGTGCTGTTTGG + Intergenic
1124392440 15:29271735-29271757 GGGACAGAAATTGTGCATTTGGG + Intronic
1125277120 15:38004714-38004736 CAGAGAGAATCTGTGCACTTTGG - Intergenic
1126053459 15:44708059-44708081 GAGAGAGAATGTGTGCTTCTGGG - Intronic
1126246868 15:46517782-46517804 TAGAGAGAATCTGTGTGATTTGG + Intergenic
1126434636 15:48623920-48623942 GAGAGAGAATGTGTGTGTTGGGG - Intronic
1126534034 15:49741583-49741605 GAGAGAAAATCTGTGTTCTTGGG + Intergenic
1126660835 15:51031495-51031517 GAGAGAGAATATGTGTGCTTTGG - Intergenic
1126716553 15:51524576-51524598 GAGAGAGTTTCTGTGCACTGGGG + Intronic
1127971653 15:63966758-63966780 GAGAAAGAACCTGTGCACTTGGG - Intronic
1129061993 15:72867553-72867575 GAGAGAGAAGCTGTGTAGTTGGG + Intergenic
1129561585 15:76576719-76576741 GACAGAGAGTCTATGCACTTGGG + Intronic
1129826177 15:78636523-78636545 GAGAGAGTATCTGAGTATCTGGG - Intronic
1130086492 15:80781674-80781696 GAGACAGCATCTGTGACTTTGGG + Intronic
1130511670 15:84594793-84594815 CTGAGAGAATCTGTGCACTTGGG + Intergenic
1130897042 15:88179336-88179358 GAAAGAGAATCAGAGGATTTAGG + Intronic
1131315241 15:91329787-91329809 GACAGAGAATCTGTGTACTTTGG - Intergenic
1131959299 15:97772486-97772508 GAGAGAGATTCTGTTTGTTTGGG - Intergenic
1202968054 15_KI270727v1_random:203269-203291 TAGACAGAATCTGTACACTTGGG + Intergenic
1132920203 16:2385386-2385408 GACACAGAAGCTTTGCATTTGGG - Intergenic
1133655322 16:7856651-7856673 GAGAGAGAATCATTGCATGTTGG - Intergenic
1133684999 16:8158083-8158105 GAGAGAGAAAGGATGCATTTGGG + Intergenic
1135255489 16:20938502-20938524 GAAAGAGAATCTTTGCAAGTAGG - Intronic
1135853457 16:25985340-25985362 GAGAGGCAATTTGGGCATTTAGG + Intronic
1138806935 16:60100931-60100953 GAGAGAGAATCTATGCATTTGGG - Intergenic
1138845066 16:60555005-60555027 CGGGGAGAGTCTGTGCATTTAGG - Intergenic
1139167315 16:64582457-64582479 GAGAACGAACCTGTGCTTTTCGG - Intergenic
1139977411 16:70824819-70824841 CAGATAGAATTTGTGCATATGGG + Intronic
1139979484 16:70843275-70843297 GAGTGAGAATATGTGCTGTTTGG + Intronic
1140004119 16:71058351-71058373 GAGTGAGAATATGTGCTGTTTGG - Intronic
1140946388 16:79771902-79771924 AGTACAGAATCTGTGCATTTGGG - Intergenic
1143195058 17:5069844-5069866 GAGAGAGAATCTGTGGCTGTTGG + Intergenic
1145117347 17:20224189-20224211 GAGAGAGACTCTGTGTGTTTAGG - Intronic
1145776607 17:27533335-27533357 GCTTGAGAATCTGTGGATTTTGG - Intronic
1145976623 17:28987627-28987649 GAGACAGAATGTGTCCATTCTGG - Intronic
1146216735 17:30982445-30982467 CACAGAGAATCTGTGCACTCAGG - Intronic
1146615271 17:34351288-34351310 GAGAGATAATCTGTTTGTTTGGG + Intergenic
1146728657 17:35175553-35175575 GAGAGAGAATGAGTGAATTTGGG + Intronic
1146857836 17:36269425-36269447 GAGAAAGTATTTGTGCATTTTGG - Intronic
1147061136 17:37879410-37879432 GAGAGAGAATCTTGCCATGTTGG - Intergenic
1147076630 17:37993961-37993983 GAGAAAGTATTTGTGCATTTTGG - Intronic
1147077173 17:37999098-37999120 GAGAAAGTATTTGTGCATTTTGG + Intronic
1147088156 17:38073507-38073529 GAGAAAGTATTTGTGCATTTTGG - Intergenic
1147109054 17:38247009-38247031 GAGAAAGTATTTGTGCATTTTGG + Intergenic
1147312660 17:39604504-39604526 GAGCGCGGATCTGTGCACTTTGG - Intronic
1147463119 17:40588686-40588708 GAGAGACAATCACTGCAGTTTGG - Intergenic
1148420397 17:47541086-47541108 GAGAAAGTATTTGTGCATTTTGG - Intronic
1149231174 17:54536375-54536397 GAAACAGAATTTGTGCACTTAGG + Intergenic
1150237155 17:63602282-63602304 GAGAGAGAAACTGTGGACTTTGG + Intronic
1150541387 17:66103799-66103821 AAGAGAGAATCTGTGTATTTGGG + Intronic
1150550240 17:66203425-66203447 GAGGGAGAATCTGTGTGCTTGGG + Intergenic
1153088508 18:1317625-1317647 GAGAGAGAATCTGTGAGATAGGG + Intergenic
1153797584 18:8638862-8638884 GAGAGAGATTCTGTGGCCTTAGG - Exonic
1153997683 18:10455480-10455502 GAAAGAGAAACTGATCATTTGGG + Intronic
1154230458 18:12551953-12551975 CAGAGAGAATCTGTGTGCTTGGG + Intronic
1154386704 18:13898674-13898696 GAGAGAGACTCTGTATGTTTGGG + Intronic
1154460752 18:14582748-14582770 GAAAGAGAATCTGTGCTGATAGG + Intergenic
1155304837 18:24468842-24468864 GAAAGGAAATCTGTGTATTTTGG + Exonic
1155767343 18:29652344-29652366 CATGGAGAATCTGTGCATTTGGG + Intergenic
1155798517 18:30071207-30071229 GAGAGAGAATCTGTTTCTTTGGG + Intergenic
1156021676 18:32606545-32606567 GAGAGAGAATCTATGTGCTTGGG - Intergenic
1156094153 18:33509586-33509608 CAGAGAGAAACTGTGAACTTGGG + Intergenic
1156589156 18:38466570-38466592 GAGAAAAAAAATGTGCATTTGGG + Intergenic
1156668513 18:39438158-39438180 AAGAAATAATCTTTGCATTTTGG + Intergenic
1157022745 18:43806104-43806126 GAGAGAGAATCTGGGTACTTGGG - Intergenic
1157065151 18:44341322-44341344 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
1157267734 18:46242958-46242980 GAGAGAGCATTTGTGCATATTGG + Intronic
1157918098 18:51689382-51689404 GAGACAGAATCTCTGCTTTCAGG + Intergenic
1158468382 18:57712315-57712337 GAGAGAAAATCTGTACGCTTGGG + Intronic
1158949175 18:62475842-62475864 GAGAGAGAATCTGCACATTTTGG - Intergenic
1159080721 18:63732231-63732253 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
1159415905 18:68149066-68149088 GAGAGAGAATCTTTGTTCTTGGG + Intergenic
1159490665 18:69129541-69129563 GAGAGAGAATCTGTGCACTCAGG - Intergenic
1159565067 18:70038412-70038434 GAGAGAGACTCTGTTTGTTTGGG + Intronic
1160138508 18:76296587-76296609 GAAAGAGAATCTATGTGTTTGGG - Intergenic
1161999518 19:7734496-7734518 GAGATAGAATTAGTTCATTTGGG + Intergenic
1162639234 19:11994860-11994882 GGGAGAGAAACTGAACATTTAGG - Intergenic
1163133824 19:15294728-15294750 GATAGCGATTCTGTTCATTTTGG - Intronic
1163933052 19:20416896-20416918 CAGAGAGTAGCTGTGCACTTTGG - Intergenic
1166623308 19:44325043-44325065 GTCAGAGATTCTATGCATTTTGG + Intergenic
1166757720 19:45203795-45203817 GAGAGAGAATCTGTGCATTTGGG - Intronic
1167424029 19:49420523-49420545 GAGAAAGACTCAGTTCATTTAGG + Intergenic
1167582305 19:50352478-50352500 CAGAGAGAAGCTGTGTGTTTGGG - Intronic
1167832197 19:52033475-52033497 GAGAGAGAGTCTGTGGATTGGGG - Exonic
925484843 2:4316551-4316573 AAGAGAGAATCTGTACACTTGGG - Intergenic
925506442 2:4569915-4569937 GAGAGAGAATCTGAGAACTAGGG - Intergenic
925588466 2:5486917-5486939 GAGAGAGAATCTGTAAGCTTGGG + Intergenic
926096461 2:10083991-10084013 GACAGATAATATTTGCATTTGGG + Intronic
926473648 2:13293848-13293870 AAGAGAGAATCTGTGTGCTTTGG - Intergenic
926518745 2:13883388-13883410 GAGAGAGAATCTGTGCACAGTGG + Intergenic
926948729 2:18217858-18217880 GAGAGAGAATCAGGGAAATTAGG - Intronic
927570411 2:24154029-24154051 GAGAGAGAGTTTGTACATTTGGG - Intronic
928295974 2:30084467-30084489 GAGGCAGGATCTGTGCACTTGGG + Intergenic
928483950 2:31710967-31710989 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
928495747 2:31829748-31829770 CACAGAGAATCTGTGCATTTTGG - Intergenic
928715655 2:34056721-34056743 GAGACAGAATCTGTGCCCTTGGG - Intergenic
928834855 2:35531089-35531111 CACAGAGAATCTGTGTGTTTGGG - Intergenic
928846270 2:35676880-35676902 GAGGGGGAATCTGTGCACTTGGG - Intergenic
929388537 2:41441681-41441703 GAGAGAGACTCTGTATGTTTGGG - Intergenic
929388781 2:41443217-41443239 GAGAGAGTATCTGGGCTTTGGGG - Intergenic
929572664 2:43032381-43032403 GATAGGGAAGCTGTGCATTGCGG + Intergenic
929688975 2:44059065-44059087 GAGAGAGAATGAGTGCAAGTAGG + Intergenic
929768212 2:44868556-44868578 GGGAGAGTATCTCTTCATTTGGG + Intergenic
929994037 2:46814035-46814057 CTGTGAAAATCTGTGCATTTAGG - Intergenic
930230821 2:48842066-48842088 GAGAAAGAATCTGCACACTTTGG - Intergenic
930407799 2:50983253-50983275 GAAAGATACTCTTTGCATTTAGG + Intronic
930439791 2:51391244-51391266 GAGACAGAATCTGGGCACTTGGG - Intergenic
930521201 2:52469872-52469894 GAGAGAGAATGAGTGCAAATGGG - Intergenic
930727227 2:54694206-54694228 GAGAGAGAATCTGTGCACTTGGG + Intergenic
930971404 2:57398824-57398846 CAGAGAGAGACTGTGCACTTGGG - Intergenic
931012292 2:57930391-57930413 GAAAGAGAATCTATGTGTTTGGG - Intronic
931171285 2:59806309-59806331 GAGAGATAATTTCTTCATTTGGG - Intergenic
931407016 2:61988970-61988992 TAGAGAGAATCTGTGTGTTTGGG - Intronic
931736395 2:65198711-65198733 GAGGGAGACTCTGTGCCCTTGGG + Intergenic
931796574 2:65716008-65716030 GAGAGAGAATGAGTGCAAGTAGG - Intergenic
932101139 2:68900357-68900379 CAGAGAGAATCTGTATGTTTGGG + Intergenic
932146346 2:69321238-69321260 GAGAAAGTATCTGTGGAGTTTGG + Exonic
932921281 2:75917462-75917484 CACAGAGAAACTGCGCATTTGGG - Intergenic
933382941 2:81572995-81573017 AAGAGAGAACCTGTGAAATTTGG - Intergenic
933601094 2:84330920-84330942 GAGAGAGAAACTGTTCATTTGGG + Intergenic
934537185 2:95144551-95144573 GAGACAGAAGCTTTGCATTTGGG + Intronic
934870511 2:97860964-97860986 GAGAGAGAGTCTGTGCACTTGGG + Intronic
934922874 2:98359887-98359909 GACAGAGAATCTGGGGGTTTGGG + Intronic
935158341 2:100505021-100505043 GTGAGGGAAGTTGTGCATTTGGG + Intergenic
935240667 2:101175356-101175378 GAGGAGGAATCTGTGAATTTTGG - Intronic
935750834 2:106232543-106232565 GAGAGAGAATCTGTGCACATTGG + Intergenic
935835678 2:107050655-107050677 GAGAGAAAATCTCTGCACTTGGG - Intergenic
935960558 2:108421819-108421841 GTGAGAGACTGTGTCCATTTTGG + Intergenic
935989251 2:108704758-108704780 AAGAGAGAATCTGTGTGATTTGG + Intergenic
936641548 2:114317380-114317402 GAAAGACAATCTGTGCCCTTTGG - Intergenic
938486787 2:131719817-131719839 GAGAGAGACTCTGTGGGCTTGGG - Intergenic
939165348 2:138635652-138635674 GACAGAGAATCTTTTCATTTTGG - Intergenic
939756882 2:146124948-146124970 GAAAGAGGATGTGGGCATTTTGG + Intergenic
939913013 2:148006150-148006172 GAGATAGAATCTGTGTGCTTGGG + Intronic
940349563 2:152666766-152666788 GATACTGATTCTGTGCATTTGGG + Intronic
940802881 2:158153103-158153125 GTGAGAGAATCTGGGCATCTGGG + Intergenic
941047648 2:160694764-160694786 GAGAGAGAGTCTGTGCATGTCGG - Intergenic
941357379 2:164510924-164510946 GAGAAAGAATCTGTGTACTTGGG + Intronic
941833005 2:169983136-169983158 GAGAGAGAAACTGTGCAAGGTGG + Intronic
942391899 2:175503387-175503409 GAGAGAGAAACTGTGCACTTTGG - Intergenic
942814206 2:180033306-180033328 GAGCAAGAATCTGTATATTTTGG - Intergenic
942845249 2:180416650-180416672 CACTGAGAATCTGTGCATCTTGG - Intergenic
942908689 2:181214903-181214925 GAGAGAGCACTTATGCATTTTGG + Intergenic
942975604 2:182014386-182014408 GAGAGAGATTCTGTTTGTTTGGG - Intronic
943427998 2:187759976-187759998 GAGAGAGAGTCTGTGTGATTGGG - Intergenic
943676804 2:190723615-190723637 GAGAGAGATTCTGTTGATTTTGG - Intergenic
943963135 2:194293834-194293856 GATAGAGAATTTTAGCATTTAGG + Intergenic
944065540 2:195615939-195615961 GTGAGACAATCTCTGCCTTTAGG - Intronic
944096058 2:195968956-195968978 GAGAGAGAATCTGTACACGTCGG - Intronic
944133385 2:196370853-196370875 GAGAGAGAATCTGTGCGCTTAGG - Intronic
944519595 2:200551373-200551395 GAGTGAGAATATTTGCCTTTTGG - Intronic
944550153 2:200838306-200838328 GAGAGATAATCTGTGAACTTGGG + Intergenic
944760236 2:202807287-202807309 GAGAGAGAATCTGTACTTGTGGG + Intronic
944990652 2:205230963-205230985 CAGACAGAATCTGTGCACCTTGG - Intronic
945334318 2:208573466-208573488 AAGAGAGAATCTGTGTGCTTGGG + Intronic
945803852 2:214465956-214465978 GAGAAAGAATCTGTGTGCTTGGG - Intronic
946285048 2:218696636-218696658 GAGAGAGGAACTGGGCATTTTGG + Intronic
946622565 2:221574255-221574277 GTGCGAGACTCTGGGCATTTCGG + Intergenic
946697209 2:222371874-222371896 CATAGAGAATCTGTGCACTGTGG + Intergenic
947131036 2:226924832-226924854 GACAGAGAATCTGTGTACTTGGG - Intronic
947839775 2:233200213-233200235 CAGAGAGCGTCTGTGCCTTTGGG - Intronic
947892957 2:233642856-233642878 GAGAGAGACTCTGTATTTTTGGG - Intronic
1169623817 20:7540175-7540197 GAGAGAGAATCTGTGTGCCTGGG + Intergenic
1169628422 20:7598276-7598298 CAGACAGACTCTGTTCATTTGGG + Intergenic
1169628742 20:7601061-7601083 GAGAAAGACTCTGTTTATTTGGG + Intergenic
1170062646 20:12275829-12275851 GAGAGAAAATCTGTGTGTTTGGG + Intergenic
1170086841 20:12543820-12543842 GAGAGAGACTCTGTATGTTTGGG - Intergenic
1170401263 20:15985874-15985896 GGGACAGAAATTGTGCATTTGGG - Intronic
1170668258 20:18405861-18405883 GAAAGAGAATGTGTGCACTTTGG + Intronic
1171058560 20:21932854-21932876 GAGTGAGAATATGTGCTGTTTGG - Intergenic
1173099035 20:40066154-40066176 GAGAGAGACCCTGTTCATTTGGG + Intergenic
1174502368 20:50995111-50995133 GAGAGAGAGTCTTTGCTGTTTGG + Intergenic
1174513814 20:51075944-51075966 GAGGGAGTAGCTATGCATTTGGG + Intergenic
1174690927 20:52503788-52503810 GAGAGAGCATCTGTGCACTTGGG + Intergenic
1175632275 20:60551232-60551254 GAGACAGAATCTGTGTGCTTGGG - Intergenic
1176609565 21:8866637-8866659 GAAATATAAACTGTGCATTTTGG + Intergenic
1176737276 21:10562039-10562061 GAGAGAGACTCTGTTTGTTTGGG + Intronic
1176774648 21:13120632-13120654 TTGAGAGCAGCTGTGCATTTTGG - Intergenic
1176917677 21:14645317-14645339 GAGAGAGACTCTGTATGTTTGGG + Intronic
1176940066 21:14912662-14912684 GAGAGAGAATCTGTGCACGTTGG - Intergenic
1177137207 21:17318224-17318246 TAGAAAGAATTTGTGCACTTGGG + Intergenic
1177212854 21:18091631-18091653 GAGAAACAAGCTGGGCATTTGGG + Intronic
1177214861 21:18115147-18115169 GAGAGTGACTCAGTGAATTTAGG + Intronic
1177222337 21:18210316-18210338 GAGAGAGAATCTGTGCACATCGG - Intronic
1177276092 21:18914221-18914243 GAAAGAGAATCTGAGCACTTAGG - Intergenic
1177401158 21:20606522-20606544 GAGAGAGATTCTGTGTGTTTGGG + Intergenic
1177494703 21:21873533-21873555 GAAAGAGAATCTGTGTGCTTGGG - Intergenic
1177539730 21:22477084-22477106 GAGAGAGAATCTGTGTGTTTTGG + Intergenic
1177771187 21:25518540-25518562 GAGAAAGAATCTGTGTGCTTGGG + Intergenic
1177969904 21:27777034-27777056 CACAGAGAATCTGTGCACTTGGG + Intergenic
1178725739 21:35050053-35050075 CAGAGAGAATTTCTGTATTTGGG + Intronic
1180439402 22:15349871-15349893 TTGAGAGCAGCTGTGCATTTTGG - Intergenic
1180490990 22:15848704-15848726 GAGAGAGACTCTGTGTTCTTGGG - Intergenic
1180522268 22:16220353-16220375 TTGAGAGCAGCTGTGCATTTTGG - Intergenic
1180563280 22:16639590-16639612 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
1183531848 22:38360554-38360576 GAGAGAGACTCTGTTTGTTTGGG - Intronic
1184862565 22:47182181-47182203 GAGACAGAGACTGTGCATTTGGG + Intergenic
949126386 3:450047-450069 GAAAGTGAATCTGTGTATATGGG - Intergenic
949623102 3:5838040-5838062 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
949779706 3:7672202-7672224 GAGACAGAATGTTTGCAATTGGG - Intronic
950190538 3:10973483-10973505 AGGACAGAAGCTGTGCATTTTGG - Intergenic
950462347 3:13132902-13132924 GAGAGGTGATCTGTGCATTCGGG - Intergenic
950695771 3:14700081-14700103 CACAGAGAGTCTATGCATTTGGG - Intronic
950801203 3:15552999-15553021 TGGAGAGAATCTGTGCATTTAGG - Intergenic
951255044 3:20439025-20439047 GAGAGAGAATCTGTTCATTTGGG + Intergenic
951260024 3:20496245-20496267 GAAATAGAATCTGTGTACTTTGG - Intergenic
951392861 3:22129176-22129198 GAGAGAGACTCTGTTTGTTTGGG - Intronic
951393080 3:22130636-22130658 AAGAGAGAATCTGTGCTCTTGGG - Intronic
951398609 3:22202724-22202746 GACAGAGAATCTGTGAGCTTGGG + Intronic
951437101 3:22677213-22677235 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
951495171 3:23317413-23317435 GAGAGACAATCTGTGCACTTGGG - Intronic
951847769 3:27102991-27103013 GAGACAGAATCTTTAAATTTGGG + Intergenic
953114354 3:39977218-39977240 GAGAGAGGAAGTGTGCATTAAGG + Intronic
953362518 3:42310304-42310326 GAGAGAGAACCTGTGCCCTTTGG - Intergenic
953468300 3:43144842-43144864 GAGAGTGAATTTTTTCATTTTGG - Intergenic
953682471 3:45050254-45050276 GAGTGAAAATCTGGTCATTTTGG + Intergenic
954491484 3:50910734-50910756 GAGAGACAATCTGTGTACTTGGG - Intronic
954779910 3:53051318-53051340 GAGAGAGAACCTGTTCAGATGGG - Intronic
954911959 3:54118011-54118033 GAGAGAGAATGTGTGCAAGCAGG - Intergenic
955098294 3:55821917-55821939 GAGAGAGAATGTGTACATTCAGG + Intronic
955274497 3:57534190-57534212 GAGAGAGAATCTGTGCACTTGGG - Intronic
956022842 3:64950542-64950564 GGAACAGAATCTATGCATTTGGG - Intergenic
956222763 3:66922260-66922282 GAGAGAGAATCAGTGCACTTTGG + Intergenic
956393152 3:68796048-68796070 GAGAGAGACTCCGTTTATTTGGG - Intronic
956549379 3:70441336-70441358 GAGAGAGAATCTGTACATGTAGG + Intergenic
957509988 3:81175268-81175290 GAGAGAGAATGTGAGGATTGTGG - Intergenic
957907521 3:86577655-86577677 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
957976232 3:87448214-87448236 GAGAGATAATCTGAGTACTTGGG - Intergenic
957977083 3:87460553-87460575 GAGAGAGAATCTGTGTGCTTAGG + Intergenic
958099280 3:88988514-88988536 CAGAGAAAATCTGTGCACTCAGG + Intergenic
958532897 3:95357181-95357203 GGGACAGAAATTGTGCATTTGGG + Intergenic
958632184 3:96699199-96699221 GAGAGAGACACTCTACATTTGGG - Intergenic
958657122 3:97017275-97017297 GAGTGAGAATCTGTGTGTCTGGG + Intronic
958670526 3:97198001-97198023 GAGAGAGAATCTGTGTGTTTGGG - Intronic
958765992 3:98368360-98368382 GAGAGACAATCTGTGTGCTTGGG - Intergenic
959118386 3:102205413-102205435 GAGAGAGACTCTGTTCGTTTGGG - Intronic
959126064 3:102291350-102291372 GAGAGAGAATCTGTGCACTTAGG - Intronic
959189961 3:103098209-103098231 GAGAGAGAATCTGTGCATTTGGG - Intergenic
959259213 3:104053249-104053271 GAGAGAGAACATGTACATATGGG + Intergenic
959474236 3:106790151-106790173 TGCAGAGAATCTGTGCAATTGGG + Intergenic
959640087 3:108622822-108622844 GAGAGAGACTCTGTTTGTTTGGG - Intronic
959640242 3:108623941-108623963 GAGAGAGAATCTGCGCTTGGGGG - Intronic
959752079 3:109849885-109849907 GAGAGAGACACTGTCCACTTGGG + Intergenic
959798017 3:110456500-110456522 GAGAGAGACTCTGTAAGTTTGGG - Intergenic
959868581 3:111300377-111300399 TAGATAGAATTTGTGCACTTAGG - Intronic
959970777 3:112407216-112407238 GAGACAGAAATTGTGCATTTGGG - Intergenic
960404024 3:117238037-117238059 GAGAAAGAATCTGTGTGCTTGGG + Intergenic
960471953 3:118076400-118076422 GAGAGAGAATCTGTGTGCTTAGG - Intergenic
960784889 3:121362129-121362151 GAGAGAGACTCTGTATGTTTGGG - Intronic
960801979 3:121549017-121549039 AGGACAGAAACTGTGCATTTGGG + Intergenic
960869896 3:122238226-122238248 AAGAGAAAATCTGTGCATTTTGG + Intronic
962078830 3:132115218-132115240 GAAAGAGAATCTGTGTGTTTGGG - Intronic
962767469 3:138579052-138579074 GAGAGAGAATCTGTGCACTTAGG + Intronic
962810409 3:138954867-138954889 GAGAGAAACTGTGTGCATATGGG - Intergenic
963154016 3:142077018-142077040 AAGAGAGAATCTATGCACCTGGG + Intronic
963309971 3:143699494-143699516 TAAAGAGAATCTGTGCTTCTGGG + Intronic
963466682 3:145690431-145690453 GGTAGAGAATTTGTGAATTTGGG - Intergenic
963528857 3:146448010-146448032 GAGAGAAAATCTGTGTGGTTGGG - Intronic
963701277 3:148629961-148629983 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
964021672 3:152021051-152021073 CAGAGAGAATCTGTGCACTTGGG + Intergenic
964059475 3:152504688-152504710 GAGAGAGAGACTGTGTATTTGGG - Intergenic
964140891 3:153397480-153397502 GCGAGAAAATCTGTGCACTTAGG - Intergenic
964151556 3:153531728-153531750 GAGAGAGAATATGTGCACTTAGG + Intergenic
964169661 3:153754661-153754683 GAGAGAGAATGTGTGCAAGCAGG - Intergenic
964259041 3:154812416-154812438 GGAAGAGAATCTGTGCACTTGGG - Intergenic
964583014 3:158260891-158260913 GAGACAGAATCTGTGCACTTGGG - Intronic
964686661 3:159403462-159403484 GAGAAAGAATTTGTGCAATAGGG + Intronic
964961045 3:162427319-162427341 GAGAGAGAATCTGCGTGCTTAGG + Intergenic
964992180 3:162827971-162827993 AAGAGAGAATCTGTGCCCTTGGG + Intergenic
965027098 3:163316193-163316215 GAGAAAGAATCTGTGTGTTTGGG - Intergenic
965034580 3:163422525-163422547 GAGAGATAATCTGTGTACTGGGG + Intergenic
965253051 3:166368016-166368038 GAGAGAGAATTTGTGCACTTGGG + Intergenic
965256979 3:166425726-166425748 GAAAGAGAATCTATGCACTTGGG + Intergenic
965322384 3:167265918-167265940 GAGAGAGAATCTGTGCTCTCTGG - Intronic
965358596 3:167709406-167709428 GACAAAGAATATGTGCACTTGGG + Intronic
965379137 3:167966750-167966772 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
965415306 3:168385186-168385208 CAGAGAGAGTCTGTGCTCTTGGG - Intergenic
965472567 3:169113465-169113487 GAGAGAGAATATATGCTCTTTGG + Intronic
965551116 3:169966456-169966478 GAGTCAGAGTCTGTGCATTTAGG - Intergenic
966141824 3:176766274-176766296 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
966151226 3:176869309-176869331 GAGAGAGACTCTGTTGGTTTGGG + Intergenic
966454112 3:180095082-180095104 GAGAGAGAATCTGTACACAGGGG - Intergenic
966541481 3:181095743-181095765 GTGATATAAACTGTGCATTTTGG + Intergenic
966625341 3:182009654-182009676 GAGAAGGAATCTTAGCATTTTGG + Intergenic
967331977 3:188299003-188299025 GAGAGAGAGTGTGTGTATATGGG - Intronic
967608828 3:191481029-191481051 GAGAAAGAATCTGTGCACTTGGG + Intergenic
967677354 3:192316433-192316455 GAGACAGAACCTGTGTGTTTGGG + Intronic
967725596 3:192859538-192859560 GAGAGAAAAAGTGTGCATGTAGG - Intronic
968646698 4:1744652-1744674 GAGGGAGAATCTGAGCACCTGGG + Intronic
970098080 4:12487472-12487494 AAGAGAGAAACTGTGCATTTGGG - Intergenic
970442351 4:16092766-16092788 GAGAGAGAATCTGCACATGGGGG + Intergenic
970716416 4:18930954-18930976 CAGAGAAATACTGTGCATTTTGG + Intergenic
970795213 4:19904299-19904321 GAAAGAGAAGCTGAGCATCTTGG - Intergenic
970963227 4:21897934-21897956 GAGGGAGAATCTGTGTGTTTGGG + Intronic
970972744 4:22003738-22003760 GAGTGATAATGTGTCCATTTTGG + Intergenic
971564604 4:28121350-28121372 GAGACAGAATTTCTCCATTTTGG - Intergenic
971719006 4:30220293-30220315 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
972125405 4:35758956-35758978 GAAAGAAAATCTGTGCACTTTGG - Intergenic
972278575 4:37582091-37582113 GAGAGAGCATCTGTGTGTTTGGG - Intronic
972585597 4:40434806-40434828 GTCAAGGAATCTGTGCATTTGGG - Intronic
972696803 4:41454477-41454499 GAGAGAGAGAATGTGCATCTGGG + Intronic
972797007 4:42431057-42431079 GAAAGAAAATCTCTGCCTTTGGG - Intronic
972812056 4:42600954-42600976 GAGAAAGAATTTGTACCTTTAGG + Intronic
972911005 4:43816928-43816950 GAGTGAGAACATGTGCTTTTTGG + Intergenic
973227560 4:47802916-47802938 GAGAGAGACTCTGTTTGTTTGGG + Intronic
973327544 4:48878609-48878631 GAGAGAAAATCTGTGTGCTTGGG - Intergenic
973852654 4:54976734-54976756 GAGGGAGAATCTGTGCACTTTGG + Intergenic
974224364 4:59019252-59019274 CAGAGAGAATCTGTGTGCTTGGG - Intergenic
974290613 4:59925438-59925460 CAGAGAGAATCTATGCCTTTGGG + Intergenic
974415087 4:61595984-61596006 GAGAGAGTATTTGTGCACTTTGG - Intronic
974630224 4:64479484-64479506 GAGAGAGACTTTGTGTGTTTGGG - Intergenic
974718045 4:65696769-65696791 GAGAGTGAGACTGTGCATTCGGG - Intergenic
974868061 4:67604197-67604219 GAGAGAGAATCTGTGTGCTTAGG - Intronic
974987782 4:69051210-69051232 GGGACAGAAATTGTGCATTTGGG + Intronic
975040127 4:69736021-69736043 TGGTGAGAATCTGTGCACTTGGG + Intronic
975314347 4:72933924-72933946 GAGAGAGAATCTGTGTATTTAGG - Intergenic
975413799 4:74085089-74085111 GGGAGAGAAACATTGCATTTTGG + Intergenic
976007698 4:80449863-80449885 GAGAAAGAAGTTGTACATTTTGG - Intronic
976728616 4:88240719-88240741 GAGAGAGAATCTGTGCACTTGGG - Intergenic
976908186 4:90266641-90266663 GAGAGAGAATCTGTGCTTCTGGG + Intronic
976981949 4:91243074-91243096 GAGAGAGAATCTGTGTACTTTGG + Intronic
976990508 4:91359063-91359085 GGGACAGAAATTGTGCATTTGGG - Intronic
977307327 4:95341828-95341850 GAGAGAGAATCTGTGTCCTTGGG + Intronic
977521735 4:98093720-98093742 GAGACAGAATCAGTACATTTTGG + Intronic
977766434 4:100804111-100804133 TAAAGAAAATCTGTGCTTTTTGG - Intronic
977911271 4:102539820-102539842 CAGATATAATGTGTGCATTTGGG + Intronic
978008775 4:103652402-103652424 GAGAGAGAATCTTTGCCCTTGGG - Intronic
978733680 4:112061301-112061323 GAGAGAGAATCTGTGCATTTGGG + Intergenic
979142819 4:117200500-117200522 GAGAAAGAATCTATGAACTTGGG + Intergenic
979176178 4:117666879-117666901 GAGTGAGAATATGTGGTTTTTGG + Intergenic
979396619 4:120197184-120197206 GAGAGAGAATCTGTGCACTTTGG + Intergenic
979945720 4:126829510-126829532 CAGAGAGAATCTGTGTGCTTGGG + Intergenic
980172533 4:129306642-129306664 AAGAGAGAATCTGTGCACTTTGG - Intergenic
980442422 4:132866697-132866719 CACAGAGAATCTGTGCACTTGGG + Intergenic
980596822 4:134965893-134965915 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
980622102 4:135320820-135320842 GAGAGAGAATCTCTTTCTTTGGG - Intergenic
980646575 4:135651306-135651328 GAGAAAGAATCCATGCATCTGGG + Intergenic
980682798 4:136186529-136186551 GAGAAAGAATCTCTGTACTTGGG + Intergenic
980712634 4:136590646-136590668 GTGGGAGAATCTGTGCATTTAGG + Intergenic
980752906 4:137115727-137115749 GAGGGAGAATCTGTGTTCTTGGG + Intergenic
980800124 4:137736046-137736068 GAGAGACAATCTGTGTGCTTGGG - Intergenic
981140116 4:141258652-141258674 GAGAGAGAATCTCTGCACTTAGG + Intergenic
981297991 4:143155605-143155627 GAGAGAGACTCCATTCATTTGGG - Intergenic
981427096 4:144616165-144616187 GAGAGAGAATGAGTGCAAGTAGG - Intergenic
981520088 4:145652155-145652177 GACACAGAAGCTTTGCATTTCGG - Intronic
982339718 4:154284564-154284586 GAGAGAGAATCTGTGCACTTGGG + Intronic
982567908 4:157009680-157009702 AAGTGAGAATCTGTACAGTTTGG - Intergenic
982615418 4:157634419-157634441 GAGAGAGACTCTATGTATTTGGG + Intergenic
982683493 4:158459967-158459989 GAGAGAGAATCTGTGCACTTTGG - Intronic
982698992 4:158637932-158637954 GCGAGTGAATCTGTTTATTTTGG - Intronic
982719636 4:158846956-158846978 GAAAGGGAATCTGTGCACTTGGG + Intronic
982798121 4:159669297-159669319 GAGAGAGAATCTATGTTTTTGGG - Intergenic
982801209 4:159709771-159709793 GAGTGAGAATATGTGGAGTTTGG + Intergenic
982828409 4:160028299-160028321 GGGAGAGAGTCTGTGCACTTGGG - Intergenic
983166071 4:164478387-164478409 GAGAGAGAATTTGTGTGCTTGGG - Intergenic
983666125 4:170186246-170186268 GACAGAGCATTTGTGAATTTTGG - Intergenic
984317589 4:178146530-178146552 AAGAGAAATTCTGTGTATTTTGG - Intergenic
984371392 4:178871168-178871190 TAGAGAAAATCTGTTCAGTTGGG - Intergenic
984842081 4:184078070-184078092 GAGATAGTATCTTTTCATTTGGG - Intergenic
984915478 4:184719320-184719342 CACAGAGAATCTGTGCTCTTGGG + Intronic
986046529 5:4043721-4043743 GAGAGACAGTCTGTGTGTTTGGG + Intergenic
986580264 5:9258479-9258501 GAGAGAGAGCCAGTGCATTGAGG - Intronic
986631310 5:9776271-9776293 GAGAGAGAATCCATGCACTTGGG - Intergenic
986756210 5:10839056-10839078 CATGGAGAATCTGTGCATTTAGG + Intergenic
986756439 5:10840521-10840543 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
987176026 5:15310424-15310446 GACAGAGATTCTGATCATTTAGG + Intergenic
987496470 5:18652155-18652177 GAGAGAGAGTCTGTTTGTTTGGG - Intergenic
987564177 5:19563893-19563915 AAGAGAGAATCTGTGCACTTTGG + Intronic
987615996 5:20275852-20275874 GAGAGAGAATATTTGCTTTTGGG + Intronic
987886178 5:23815879-23815901 GGGAGAGAATCTGTGTGCTTGGG + Intergenic
988064578 5:26218325-26218347 GAGAGAGAATCTGTGTGCTGGGG + Intergenic
988169859 5:27639499-27639521 GAGAGAGAATCTGAGCTACTTGG - Intergenic
988265434 5:28942691-28942713 GAGAGAAAATCTGTGTCCTTGGG - Intergenic
988376172 5:30438924-30438946 GGGAGATAATCTGTGTGTTTTGG + Intergenic
988931588 5:36040511-36040533 GAGACAGAATCTGTGTGCTTAGG + Intronic
989434274 5:41392361-41392383 GAGAGAGACTCTGTATATTTGGG + Intronic
990531291 5:56675902-56675924 GAGAGAGAAACTGTGCAGTGTGG - Intergenic
991185605 5:63803217-63803239 AAGGGAGAAACTGTTCATTTTGG - Intergenic
991237573 5:64417474-64417496 GAGAGAGAATCTGTGCACTTCGG + Intergenic
991429229 5:66526622-66526644 TAGACAAATTCTGTGCATTTTGG + Intergenic
992454121 5:76901066-76901088 GAGAGAGACTCTGTATGTTTGGG - Intronic
992657106 5:78921884-78921906 GAGACAGAATCTGTGTTCTTGGG + Intronic
993026566 5:82653805-82653827 CAAAGAGAATCTATGCACTTAGG - Intergenic
993171140 5:84420207-84420229 GAGAGATAATCTGTGCACTTGGG - Intergenic
993205668 5:84875447-84875469 GAGAGAGTATCTGTGCATTTAGG + Intergenic
993207162 5:84896029-84896051 AAGAGAGAATCTTTGCACTTTGG - Intergenic
993256975 5:85604446-85604468 GAGAGAGAATCTGTGTCCTTGGG + Intergenic
993932321 5:93954982-93955004 GAGAGAGAATCTGTGCATTTGGG - Intronic
994226042 5:97253146-97253168 GACAGAGAATCAGTGCACTTTGG + Intergenic
994233782 5:97338708-97338730 GAGAGAAAATCTGTGCCTTTGGG + Intergenic
994881196 5:105498577-105498599 GGGAGACAGTCTGTGCACTTTGG - Intergenic
995019721 5:107352887-107352909 GAGAGAGAATCTATGTGTTTGGG - Intergenic
995141825 5:108743957-108743979 GGCAGGGAATCTGTACATTTTGG + Intergenic
995265178 5:110151814-110151836 GAGAGAGAATCTGTGTACTTTGG + Intergenic
995268747 5:110195754-110195776 GAGAGAGAATCTGTGCACTCAGG - Intergenic
995770501 5:115664528-115664550 GAGAGAGGATCTGTGGGCTTGGG + Intergenic
996128741 5:119755244-119755266 GGGACAGAAACTGTGCATTTGGG + Intergenic
996191910 5:120554933-120554955 GAGAGAGACACTCTCCATTTGGG + Intronic
996210030 5:120797775-120797797 CAGAGAGAATCTGTGCCATTGGG + Intergenic
996490491 5:124088848-124088870 GAGAGAAAATCTGTTCATAAGGG + Intergenic
996659862 5:125988979-125989001 GAAAGAGAATCTGTGTGTTTCGG - Intergenic
996944906 5:129055383-129055405 GAGAGAGAATCTGTGCATTTAGG + Intergenic
996956288 5:129187078-129187100 GAGAGAGAATCTGTGTGCCTTGG + Intergenic
996961617 5:129256375-129256397 GAGAGAGAATCTGTGTTTCTGGG - Intergenic
997104505 5:131003899-131003921 AAGAGAGAATCTGTGTGCTTGGG + Intergenic
997109132 5:131055187-131055209 GAGAAAGAATCTGTGAATTCAGG + Intergenic
997486320 5:134233967-134233989 AAGAGAGAATGAGTGTATTTAGG - Intergenic
997599612 5:135130328-135130350 CAGACAGACTCTGTGCCTTTTGG + Intronic
998138647 5:139687886-139687908 GAGCCAGAATCTGTGCCTGTTGG - Intergenic
998633916 5:143931456-143931478 GTGAGAGAATCTGTGCACTTTGG + Intergenic
998872798 5:146569287-146569309 GAGAGAGAATGTGAGCACATGGG - Intergenic
999667306 5:153926727-153926749 GAGAGAGAATCCATGCACTTGGG + Intergenic
999849604 5:155523925-155523947 GAGAGAGAACCTGTGTGCTTGGG - Intergenic
1000051870 5:157570328-157570350 CAGAGAGGACCTGAGCATTTAGG - Intronic
1000058887 5:157635000-157635022 GAGAGAGAATCAATTAATTTTGG + Intronic
1000241279 5:159410752-159410774 GGGAAAAAATGTGTGCATTTTGG - Intergenic
1000284035 5:159811039-159811061 GAGAGAGAATATGTGGTGTTTGG + Intergenic
1000433405 5:161179285-161179307 GAGAGAGAATCTATGCTGTTGGG + Intergenic
1000605099 5:163319151-163319173 GGGACAGAAATTGTGCATTTGGG - Intergenic
1000754538 5:165141165-165141187 GAGTGAGAATCTGTCCATACTGG + Intergenic
1000824778 5:166031583-166031605 GAGAAAGAATCAGTGAATCTGGG - Intergenic
1001845249 5:174916420-174916442 CAGAGAGAATCTACGCACTTGGG + Intergenic
1002009880 5:176270644-176270666 GAGAGAGAATCTGTGTGCTTGGG + Intronic
1002216846 5:177641664-177641686 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
1003437853 6:6110809-6110831 GAGAGAGAATTTGTTTCTTTGGG - Intergenic
1003450962 6:6230835-6230857 GAGAGACAATCACTGCAATTTGG + Intronic
1005279889 6:24262156-24262178 GAGAGAGAATCTGTGTGCTTAGG + Intronic
1005716279 6:28551999-28552021 GAGAGACATGCTGTGGATTTAGG + Intergenic
1006018803 6:31104346-31104368 GAAAGAGAGTCTTTGCATTTTGG - Intergenic
1007001776 6:38320105-38320127 GAGAGAGAATCCGTGCATTTGGG - Intronic
1007022205 6:38532108-38532130 GAGAAGGAATCTGTGCAATTAGG + Intronic
1007426183 6:41747665-41747687 GAGGCATAATGTGTGCATTTAGG + Intronic
1007722568 6:43893892-43893914 GAGAGAGAAGCTGAGCCTATGGG - Intergenic
1008192261 6:48474813-48474835 GAGAAAGAATCTGTACACTCCGG + Intergenic
1008289360 6:49694567-49694589 GAGAGAGACACTGTCCACTTGGG - Intronic
1008540839 6:52545426-52545448 GAGAGATTATCTGTGCTTCTTGG - Intronic
1008707666 6:54182343-54182365 CACAGAGAGTCTGTGCACTTGGG - Intronic
1008822653 6:55651920-55651942 AAGAGAGAATCTGTGCACTTTGG - Intergenic
1009039466 6:58159127-58159149 GAGACAAAATCTGTGCATTTGGG - Intergenic
1009215358 6:60913967-60913989 GAGACAAAATCTGTGCATTTGGG - Intergenic
1009353041 6:62706897-62706919 GAGAGAGACTCTCTATATTTGGG - Intergenic
1009373635 6:62939399-62939421 GAAAGAGAATCTGTACACCTAGG - Intergenic
1009937850 6:70254712-70254734 TTGAGAGAGACTGTGCATTTTGG - Intronic
1010238287 6:73593132-73593154 GAGAGAGAATCAGTGTAGTGTGG + Intergenic
1010343124 6:74780785-74780807 GAAAGAGAATCTGTGTGCTTGGG + Intergenic
1010409426 6:75544286-75544308 GATAGAGAATATATGCGTTTTGG + Intergenic
1010856057 6:80841505-80841527 GAGAAAAAATATGTACATTTCGG + Intergenic
1011244002 6:85302453-85302475 GAGTGAGAATATGTGCTATTTGG + Intergenic
1011837324 6:91449563-91449585 GATAGAGAATCTGCGGACTTTGG - Intergenic
1012028512 6:94028944-94028966 AAGAGAGAATCTGTGCACTTGGG + Intergenic
1012050033 6:94329350-94329372 GAGAGAGACTCTGTATGTTTGGG + Intergenic
1012057118 6:94427177-94427199 CAGAGAGAATCTGTGTGCTTGGG - Intergenic
1012600151 6:101086621-101086643 CAGAGAGGAGCTGTGAATTTAGG + Intergenic
1012715198 6:102660362-102660384 GAGAGAGAATCTGTTCACCTCGG + Intergenic
1012736170 6:102947748-102947770 GAGAGAAAATCTATGGATTCTGG + Intergenic
1012785384 6:103618482-103618504 GAGAGAGAATATGTGGTGTTTGG + Intergenic
1012892001 6:104907552-104907574 AAGAGAGAATCCGTGCGTTTGGG + Intergenic
1012945585 6:105462170-105462192 TAGAGAGAATAGGTCCATTTAGG + Intergenic
1013309475 6:108879781-108879803 GAGCCAGAATCTCTGGATTTAGG + Intronic
1014234511 6:118939567-118939589 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1014378647 6:120711132-120711154 AAGAGAGAATCTGTGCACTTGGG + Intergenic
1015052931 6:128863682-128863704 GAGAGAGAATCTGCGTTCTTTGG - Intergenic
1015392781 6:132701823-132701845 GAGAGAAAATTTGTGCCCTTGGG + Intronic
1015460590 6:133487061-133487083 GAGAGAGAATCTGTGCACTTGGG + Intronic
1016194516 6:141317527-141317549 GAGAGAGAATCTGTGCCCTTGGG + Intergenic
1016541372 6:145169943-145169965 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1017675650 6:156811116-156811138 GAGAGAGAATCTGTAACTTCTGG + Intronic
1017924853 6:158901852-158901874 GAGAGATGATCTGTGCACTTTGG - Intronic
1018696309 6:166394185-166394207 CAGAGAGAATCTGTGTGCTTGGG + Intergenic
1019066298 6:169302181-169302203 GAGAGACAATCTGTGTGCTTGGG + Intergenic
1021214746 7:17901634-17901656 GAGAGAAAATCTGTGCACTTAGG - Intronic
1021712712 7:23431828-23431850 GAGAGAGAATGTGTGTGTGTGGG - Intronic
1021794795 7:24243315-24243337 TAGAAAGAACCTGGGCATTTGGG + Intergenic
1021922975 7:25505688-25505710 GAGAAAGAATCTGTGCACTTGGG + Intergenic
1022080332 7:27013378-27013400 GAGAGAGACTCTGTATGTTTGGG + Intergenic
1022785267 7:33631877-33631899 GAGAGGGAGGCTGTGCTTTTTGG + Intergenic
1024170175 7:46777292-46777314 GAGAGAGAATATGTCCACTTGGG + Intergenic
1024369229 7:48560348-48560370 GAGAGGGAATCTGTGCACTTGGG - Intronic
1024662535 7:51511838-51511860 TAGAAAGAATCTGTGAAATTGGG - Intergenic
1024705963 7:51959810-51959832 GAGGCAGAATCTGTGCACTTTGG - Intergenic
1024715536 7:52075657-52075679 GAGTGAGAATATGTGCGATTTGG + Intergenic
1025061530 7:55812823-55812845 GAGAGAGAATCTGTGTGTTTTGG + Intronic
1025499525 7:61267851-61267873 GAGAGAGAATATGTGGTGTTTGG - Intergenic
1026476749 7:70743042-70743064 GACATAAAATCTGTGCATTTAGG + Intronic
1026839700 7:73663158-73663180 AAGACAGAATCAGTTCATTTTGG - Intergenic
1027221411 7:76216610-76216632 GAGAGAGAAGAGGTTCATTTTGG + Intronic
1027605002 7:80288779-80288801 GAGAGAAATTCTGTGTACTTTGG + Intergenic
1027811664 7:82909379-82909401 GGGAGAGAATGTGTGGATGTGGG - Intronic
1028161043 7:87484569-87484591 GAGAGAGAATTTGTTTGTTTGGG + Intergenic
1028181379 7:87729401-87729423 GAAAGAAAATCTGTGCATTCAGG + Intronic
1028207666 7:88034844-88034866 GAGAGAGAAACTGTGCACTTAGG - Intronic
1028247992 7:88505735-88505757 GAGAGAAAATCTGTGTATTTGGG - Intergenic
1028266705 7:88734330-88734352 GAATCAGAATCTGTGCACTTAGG - Intergenic
1028353524 7:89879039-89879061 GAGAGAGAATCTGTGTGCTTGGG - Intergenic
1028868185 7:95737117-95737139 GAGAGAAAATTTGTGCCCTTGGG - Intergenic
1028929414 7:96396970-96396992 GAGAGAGACTTTGTTCATTTGGG - Intergenic
1029035170 7:97512457-97512479 GAGAGAGCTTCTTTGCATTCTGG - Intergenic
1029042615 7:97593420-97593442 GAGAAAGAATCTGTGCACTTTGG - Intergenic
1030476757 7:110043845-110043867 GAGGTAGAATCTGTGATTTTGGG - Intergenic
1030966186 7:115995751-115995773 GAGAGAGTATCTGTGCTCTTGGG + Intronic
1031215321 7:118883069-118883091 GAGAGAGAATTTGTGCGCTTTGG + Intergenic
1031259968 7:119506448-119506470 GAAAGACAATCTGTGCATTCAGG + Intergenic
1031306144 7:120130295-120130317 GAGAGAAAATCTGTGCACTTGGG + Intergenic
1031353587 7:120763910-120763932 CAGAGAGAATCTGTGTATTTAGG - Intergenic
1031429133 7:121644672-121644694 GAGAAAGAGTTTGTACATTTTGG - Intergenic
1031565832 7:123296148-123296170 GAGAGAGAATCTGTATGCTTGGG + Intergenic
1031657731 7:124379427-124379449 GAGAGATAATCTGTGCACTTTGG + Intergenic
1031721805 7:125186620-125186642 GAGAGAGAATCTCTGTGCTTGGG + Intergenic
1031862190 7:126993649-126993671 GAAAGAGAATCTGTACACTTGGG + Intronic
1032630924 7:133650873-133650895 TAGAGAGAAGCTGTTCATTTAGG + Intronic
1032942345 7:136809758-136809780 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1033542478 7:142369630-142369652 GAGAGACAGTCTGTGCATTTGGG - Intergenic
1033691455 7:143741089-143741111 GAGAGAAATTCTGTACATTTGGG + Intergenic
1033833515 7:145282132-145282154 GAGAGATACTCTGTTCGTTTTGG - Intergenic
1033867904 7:145714716-145714738 GAGAGACAATCTGTGCTCTTGGG - Intergenic
1033967947 7:147001067-147001089 GAGAGAGACACTGTTCACTTGGG - Intronic
1034078050 7:148251354-148251376 GACAAAGAAGCTTTGCATTTGGG - Intronic
1034581929 7:152050950-152050972 GAAAGAGAATCTCTGTGTTTGGG - Intronic
1034823417 7:154237747-154237769 TAGTGAGTATCTGAGCATTTAGG - Intronic
1035138972 7:156738150-156738172 GAGAGAGAATCTGTGTACTTGGG + Intronic
1036589481 8:10155444-10155466 GAGAGAGAATGTGTGCGTATTGG - Intronic
1036687667 8:10922786-10922808 GAGAGAGTATGTGTGCATGTGGG + Intronic
1036814937 8:11895040-11895062 AAGAGAGAATCTGTGTGCTTGGG - Intergenic
1036936089 8:13003973-13003995 CAGAGAGAATCTGTGCTTAGGGG + Intronic
1037157512 8:15722484-15722506 AAGAGAGAAACTGAGCCTTTTGG - Intronic
1038887741 8:31683768-31683790 GTGAGGGAAGCTGTGCATGTGGG + Intronic
1040018666 8:42720997-42721019 GATGGAGGAGCTGTGCATTTGGG + Intronic
1040072164 8:43197184-43197206 GAAAATAAATCTGTGCATTTAGG - Intronic
1040485610 8:47868843-47868865 GACACAGAAGCTGTGCACTTGGG + Intronic
1040721108 8:50324295-50324317 GAGACAGAATCTGTGCATCTTGG - Intronic
1040743242 8:50605568-50605590 AAGAGAGAATCTGTGCACTTGGG - Intronic
1040745525 8:50636591-50636613 AGGAGAGAATCTGTGCTCTTTGG - Intronic
1041117080 8:54550115-54550137 GAGGGAGACACTTTGCATTTTGG - Intergenic
1041121140 8:54587446-54587468 GAGAGAGAGCATGTCCATTTTGG + Intergenic
1041140605 8:54814847-54814869 GGGAGAGAGTGTGTGCATGTTGG - Intergenic
1041580021 8:59447698-59447720 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1041582966 8:59483870-59483892 GAGAAAGAATCTGTGCACTTCGG - Intergenic
1041606820 8:59792010-59792032 GAGAGAGAATCTGTCTGCTTGGG + Intergenic
1041869149 8:62614343-62614365 GAGAGAGACTCTGTATGTTTTGG - Intronic
1041883450 8:62779536-62779558 GAGAGAGAATATGTGGGATTGGG - Intronic
1042032445 8:64491151-64491173 GAGAGAGAATCTGTCCACTTTGG + Intergenic
1042034725 8:64519595-64519617 AAGAGAGAAACTCTGCACTTAGG - Intergenic
1042082669 8:65071959-65071981 GAGAGATAATCTATGCTCTTGGG - Intergenic
1042162515 8:65911795-65911817 GAGAGAAAATCTGTGTGCTTGGG + Intergenic
1042297820 8:67241882-67241904 GAGAGAAAATCTGTGTACTTGGG + Intronic
1042428068 8:68672436-68672458 AAGAGAGAATCTGTGGGCTTAGG + Intronic
1042818970 8:72909453-72909475 GAGGGAGAATCTGTAGAGTTCGG + Intronic
1043041966 8:75275197-75275219 AAGAGAGAATCTGTGCACCTGGG + Intergenic
1043600218 8:81928593-81928615 GGGAGAGAATCTGTGTACTCTGG + Intergenic
1044124159 8:88437317-88437339 AAGAGAGAATCTGTGCACTTAGG + Intergenic
1044329377 8:90898756-90898778 GAGAGTGACTCAGTGCAGTTGGG - Intronic
1044457044 8:92401121-92401143 GAGAGCTGATCTGTCCATTTTGG + Intergenic
1044635555 8:94320230-94320252 GAGAGAGAATCTGTGTGCTCAGG - Intergenic
1045584820 8:103522060-103522082 GAGGAAGAAACTGTCCATTTAGG - Intronic
1045621112 8:103979753-103979775 CATGGAGAGTCTGTGCATTTGGG + Intronic
1046268077 8:111858159-111858181 GACAGAGAATCTGTTTGTTTAGG - Intergenic
1046463486 8:114571809-114571831 AAGAGAGAATCTGTGCTTTTGGG - Intergenic
1046811548 8:118538583-118538605 GAGAGAGAATCTGTGCCCTTTGG - Intronic
1047138489 8:122107902-122107924 GAGTGAGAATCTGTGCACCTGGG - Intergenic
1047342935 8:124000201-124000223 GAAAGAAAATCTGAGCACTTGGG - Intronic
1047352544 8:124089336-124089358 GAGAGAGGATCTGTGCACTTAGG - Intronic
1047901212 8:129423863-129423885 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
1050248055 9:3712980-3713002 GAGAGAGAATCTGTGCACTTTGG + Intergenic
1050248289 9:3714410-3714432 GATAGAGACTCTGTATATTTGGG + Intergenic
1050355644 9:4780566-4780588 TGCAGAGAATCTGTGCATTTGGG + Intergenic
1050865025 9:10487952-10487974 GAGAGAGACTGTGTTCATTTGGG - Intronic
1050974067 9:11914208-11914230 GAGAGAGAATGTGTGCAAGCAGG + Intergenic
1051047079 9:12888213-12888235 CACAGAGAGTCTGTGCACTTGGG + Intergenic
1051070544 9:13160992-13161014 GATTGAGCATCTGTGGATTTTGG + Intronic
1051465184 9:17368653-17368675 GAGAGAGACTCTGTTTGTTTGGG + Intronic
1051469710 9:17423833-17423855 GAGAGAGAATCTGTGTGCTTGGG - Intronic
1051842461 9:21414012-21414034 CATGGAGAATCTGTGCACTTGGG - Intronic
1052048933 9:23824019-23824041 GGGACAGAATCCGTGCATTTCGG + Intronic
1052093877 9:24361708-24361730 GAGAGAGAATTTGTGCTCTTGGG + Intergenic
1052141640 9:24992252-24992274 GAAAGAGAAACAGGGCATTTGGG - Intergenic
1052205024 9:25828542-25828564 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1052420356 9:28235177-28235199 GAGAGAGAATCTCTACATTTGGG + Intronic
1052450606 9:28625309-28625331 GAGAGAGAATCTGTGCACTTGGG - Intronic
1052842672 9:33306435-33306457 AAGAGAGAAAATGTGGATTTGGG + Intronic
1054702149 9:68423615-68423637 GAGAGAGATTTTGTGCTCTTGGG - Intronic
1054982458 9:71222732-71222754 GAAAGAGAATCTGTGTGCTTGGG + Intronic
1055111851 9:72567554-72567576 GAGAGAGAATAAGTGCAAGTAGG + Intronic
1055227260 9:74014540-74014562 GAGAGAGAATCTATGTACTTGGG + Intergenic
1055243657 9:74216350-74216372 GAGAGAGATTCTGTTTGTTTGGG - Intergenic
1055580088 9:77699107-77699129 CATGGAGAATCTGTGCACTTGGG - Intergenic
1055633037 9:78243853-78243875 TAGAGATAAACTGTTCATTTTGG + Intronic
1055747296 9:79463483-79463505 GAAAGAGAATGTGAGCATTGTGG - Intergenic
1055826909 9:80338484-80338506 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1055910957 9:81350624-81350646 GAGAGAGAATCTGTGCACTTTGG + Intergenic
1056211130 9:84366729-84366751 GAGAGAGATTCTGTTTGTTTGGG - Intergenic
1056230699 9:84539753-84539775 GAGAGAGAATCTGTGCAACTTGG - Intergenic
1056516663 9:87358774-87358796 CAGAGAGAATCTGTGTGCTTGGG + Intergenic
1057289190 9:93789639-93789661 CATGGAGAATCTGTGCACTTAGG - Intergenic
1057346699 9:94258125-94258147 GAGAGAGAATCTATGTTCTTGGG + Intergenic
1057968035 9:99523559-99523581 GAGTGAGAATCTGGGAATCTGGG - Intergenic
1058220885 9:102300473-102300495 GAGAGAGAAATGGTGCATCTGGG + Intergenic
1058232555 9:102447231-102447253 GAGAGAGAATCAGTGCTTTGGGG + Intergenic
1058522923 9:105829467-105829489 GAGACAGAATCTGTGAACTTGGG - Intergenic
1058777965 9:108303723-108303745 GTGAGAGAATCTCTGGATATGGG - Intergenic
1060328581 9:122643278-122643300 GAGAGAGAATATGTGCACTGTGG + Intergenic
1061915464 9:133750857-133750879 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
1186325774 X:8475343-8475365 GAGAGAGAAGCCTGGCATTTTGG - Intergenic
1186602265 X:11050328-11050350 GAAAGAGAATCTGTGCACTTGGG - Intergenic
1187575131 X:20546020-20546042 GAGAGAGAATCTGTCTGCTTGGG - Intergenic
1187579427 X:20592531-20592553 GAGAGAGAATCTGTGCATGCTGG - Intergenic
1187594952 X:20760681-20760703 GAGAGAGAATCTGTGTACTTGGG - Intergenic
1188042634 X:25387614-25387636 GTGGGAGAGTCTGTGCATGTGGG - Intergenic
1188078635 X:25808592-25808614 TGCAGAGAATCTGTGCATTTGGG - Intergenic
1188112796 X:26212057-26212079 GAGAGAGAATCTGTGCACTGTGG - Intergenic
1188118657 X:26277803-26277825 CATAGGGAATCTGTGCAGTTAGG - Intergenic
1188162004 X:26815437-26815459 GATAGAGAATCTTTGTGTTTGGG - Intergenic
1188192076 X:27183199-27183221 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
1188421004 X:29991198-29991220 GAGACAGACTCTGTTGATTTGGG - Intergenic
1188716552 X:33465490-33465512 GAGAGAGAATCTGTGTGCTTAGG - Intergenic
1188924510 X:36023301-36023323 GAGAGAGACTCTGTTCATTTGGG - Intergenic
1188972409 X:36633586-36633608 GAGAAAGAATCTATGAATTGGGG - Intergenic
1188992351 X:36837573-36837595 GAGAGAGAATCTGTACACTTGGG - Intergenic
1189013570 X:37071726-37071748 TACAGAGAATCTGTGCATTTAGG - Intergenic
1189854241 X:45208163-45208185 GAGAGAGAATCTGTGTCCTTGGG - Intergenic
1189854525 X:45210236-45210258 GAGAGAGAATCTGTGTGCTTAGG - Intergenic
1189869911 X:45370884-45370906 GAGAGAGAATCTGTGAAGGTGGG + Intergenic
1189875800 X:45434533-45434555 GAGAAAGAATCTGTGTACTTGGG - Intergenic
1189884953 X:45533099-45533121 AAGAGAGAGCCTGTGCACTTGGG + Intergenic
1190046071 X:47112477-47112499 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1190046383 X:47114276-47114298 GAGAGAGAAACTGTGTGTTTGGG + Intergenic
1190124785 X:47694402-47694424 GAGATATAATTTGTGCATTATGG - Intergenic
1190522896 X:51298410-51298432 GAGAGAGAATCTGTGCATGTGGG + Intergenic
1190530501 X:51369456-51369478 GAGAGAGACTCTGTATGTTTGGG + Intergenic
1190602761 X:52109159-52109181 CAGAGAGAATCTCTGTACTTAGG - Intergenic
1190639369 X:52467723-52467745 GAGAAAGAAGCTGTGCAGCTGGG - Intergenic
1190804682 X:53824210-53824232 GAGAGATAATCTGTGTACTTTGG + Intergenic
1190898925 X:54650295-54650317 AAGAGAGAATCTGAGCACTTGGG + Intergenic
1191083512 X:56538684-56538706 GAGAGAGATTCTGTTTGTTTGGG + Intergenic
1191179052 X:57540091-57540113 GAGAGAGAATCCATGCACTTGGG + Intergenic
1191197053 X:57736002-57736024 AAGAGAGAGTCTGTGCATTTTGG + Intergenic
1191198715 X:57753117-57753139 GAGAGAGACTCTATCCATTTGGG + Intergenic
1191646727 X:63489184-63489206 GAGAGAGACTCTATTTATTTGGG + Intergenic
1192285269 X:69728427-69728449 GAAAGAGTAGGTGTGCATTTTGG + Intronic
1192417740 X:70998790-70998812 GAGAGAGACTCTGTTTGTTTGGG - Intergenic
1192793298 X:74405710-74405732 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1192826837 X:74705553-74705575 GAGAAAGAATCTGTGTGCTTGGG - Intergenic
1192841075 X:74856834-74856856 GAGAGAGAATCTCTGTGCTTAGG + Intronic
1192872574 X:75198847-75198869 AAGAGAGAATCTCTGCACTTGGG + Intergenic
1192875352 X:75223670-75223692 GAGAGATAATCTGTGCATTTGGG - Intergenic
1192890811 X:75389027-75389049 GAGACAGACTCTGTGAACTTGGG + Intronic
1193004937 X:76605988-76606010 GAAAGAGAATCTGTGCATTCTGG + Intergenic
1193052296 X:77114639-77114661 GAGAGAGACTCTATTCATTTGGG - Intergenic
1193052510 X:77116092-77116114 GGGAGAGAATCTGTGTACTTGGG - Intergenic
1193172925 X:78357741-78357763 GAGAGAGACTCTGTATATTTGGG - Intergenic
1193191231 X:78573321-78573343 GAGAGAGAATCTGTGCATTTGGG - Intergenic
1193232121 X:79059402-79059424 GAGAAATAATCTGTTGATTTGGG - Intergenic
1193335577 X:80285010-80285032 GAGAGAGAATCTGTCTGCTTGGG + Intergenic
1193366834 X:80644380-80644402 GAGAGAGAATCTATGCACTTGGG - Intergenic
1193455426 X:81725511-81725533 GAGAGAGACTCTTTACTTTTGGG + Intergenic
1193580364 X:83257080-83257102 GAGAGTGAATGTGTGCACTTTGG + Intergenic
1193675976 X:84453391-84453413 GAGAAAAAGTCTGTGCACTTAGG + Intronic
1193697154 X:84723385-84723407 GAAAGAGATTCTGTATATTTGGG - Intergenic
1193738357 X:85186659-85186681 GAAAGAAAATCTGTGTACTTAGG - Intergenic
1193912140 X:87318282-87318304 GAGAGAGAATCTGTGGCTTGGGG - Intergenic
1194016144 X:88624280-88624302 CAAAGAGAATCTGTGCACGTGGG + Intergenic
1194065382 X:89254065-89254087 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
1194095641 X:89635999-89636021 GAGAAAGAATCTGTGCACTTGGG + Intergenic
1194110117 X:89823776-89823798 GAGAGACAATCTGTGCTCTAGGG + Intergenic
1194220032 X:91178259-91178281 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1194288656 X:92040507-92040529 AGGAGAGAATCTTTGCACTTGGG - Intronic
1194291169 X:92073124-92073146 GAGAAAGAATATGTGCATTTTGG - Intronic
1194329302 X:92560996-92561018 AAGAGAGACTCTGTTTATTTGGG + Intronic
1194387674 X:93277544-93277566 GAGAGAAAATCTGTGTGCTTGGG + Intergenic
1194398086 X:93411427-93411449 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1194466544 X:94240760-94240782 GAGTGAGAATCTGTGTGCTTGGG - Intergenic
1194479468 X:94401938-94401960 GAGAAAGAATCTGTGCACTTTGG - Intergenic
1194626222 X:96229495-96229517 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1194693046 X:97010269-97010291 GAGACAGATTCTATGCACTTTGG - Intronic
1194788601 X:98118190-98118212 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1194882681 X:99273434-99273456 GAGAGAAAAACTGCGCACTTAGG + Intergenic
1194920897 X:99762098-99762120 TAGAGAGACACTGTACATTTGGG + Intergenic
1194937746 X:99971149-99971171 GAGAGAGATTCTGTGTTCTTGGG - Intergenic
1194990829 X:100544607-100544629 GAGAGAGACTCAGTTCGTTTGGG + Intergenic
1195115631 X:101695678-101695700 GAGAGAGAATCTGTGCACTTGGG + Intergenic
1195172147 X:102280510-102280532 GAGAGAGACTCTGTATGTTTGGG - Intergenic
1195186713 X:102406583-102406605 GAGAGAGACTCTGTATGTTTGGG + Intronic
1195199238 X:102532108-102532130 AAGAGGGAATCTGTGCACTTTGG + Intergenic
1195559312 X:106265611-106265633 GAGAGAGACTCTGTATATTTGGG - Intergenic
1195595571 X:106684141-106684163 GAGAGAGATTCTGTTTGTTTGGG + Intergenic
1195601220 X:106751252-106751274 GAGAGAAAATCTGTGTGTTTAGG + Intronic
1195872250 X:109498642-109498664 GAGAGATAATCTGTGCACTTGGG - Intergenic
1195971389 X:110477627-110477649 GAGAGAGATTTTGTTCATTTGGG - Intergenic
1196153114 X:112396261-112396283 TAGAGAGAATCTGTGCATTTGGG - Intergenic
1196264516 X:113626494-113626516 AAGACAGAATCTGTGTACTTAGG - Intergenic
1196485712 X:116204188-116204210 AAGAGAGAATCTATGCGCTTTGG - Intergenic
1196619476 X:117806308-117806330 GAGAGAGAATCTGCGCACTTGGG + Intergenic
1196984429 X:121253146-121253168 GAGAGAGACTCTGTATCTTTGGG - Intergenic
1197030599 X:121809217-121809239 AAGAGAGAATCTGTGTGCTTGGG - Intergenic
1197072819 X:122321330-122321352 GAGAGAGAATTTATGCATTTTGG + Intergenic
1197117646 X:122852023-122852045 GAGAGAGAATCGATACACTTGGG + Intergenic
1197177956 X:123504755-123504777 GAGAAAGAATCTGTGCCCTTGGG + Intergenic
1197348374 X:125351309-125351331 GAGAGAGACTCTGTATGTTTGGG + Intergenic
1197399865 X:125977331-125977353 GAGAGAGAATCTGTGTGCTTGGG + Intergenic
1197457896 X:126700954-126700976 GAGAGAGAATCTCTGCACTTTGG + Intergenic
1197481631 X:126994204-126994226 GAGAGAGAATCTGTGTGCTTTGG + Intergenic
1197487859 X:127075486-127075508 GAGAAAGAATCTGTGTGCTTGGG - Intergenic
1197492112 X:127129803-127129825 GAGAGAGACTCTGTTTGTTTTGG + Intergenic
1197561815 X:128033734-128033756 GAGAGAGAAGCTCTGCACTTGGG + Intergenic
1197665357 X:129217317-129217339 GAGAGAGAGTGTGTGTCTTTTGG - Intergenic
1197876425 X:131114015-131114037 GAGAGAGATTCTGTTTGTTTGGG - Intergenic
1197953030 X:131918376-131918398 GAAAGAGAATCTGTGCACTTGGG + Intergenic
1198274129 X:135085550-135085572 GAGAGAGAATCTGTGCACTTGGG - Intergenic
1198430941 X:136565542-136565564 GAGAGAGAATCTGTGCACTTGGG - Intergenic
1198558561 X:137823508-137823530 GAGAGTGAATCAGTGACTTTTGG + Intergenic
1198559266 X:137830989-137831011 GAGACAGAATCTGTGCACTTTGG + Intergenic
1198578399 X:138036351-138036373 GAGAGAGTATTTGTGCACTTGGG + Intergenic
1198611873 X:138410945-138410967 GAGAGAGAATCTGTGCATTTAGG + Intergenic
1198663304 X:138995144-138995166 GAGAGAGAATCTGTGCACTTGGG + Intronic
1198713624 X:139532685-139532707 GAGAGAGAATATTTTCATCTGGG + Intronic
1198761553 X:140038320-140038342 GAAAGAGAATCTGTGTCCTTTGG + Intergenic
1198770690 X:140126928-140126950 GAGAGAGAATCTGTGCACTTGGG - Intergenic
1198828935 X:140728399-140728421 CAGAGTGATTTTGTGCATTTGGG - Intergenic
1199005605 X:142693036-142693058 CAGAGAGAATTTGTGCTCTTCGG + Intergenic
1199018671 X:142848933-142848955 AAGAAAGAGTCTGTGCATGTGGG - Intergenic
1199156081 X:144550725-144550747 GAGCCACAAGCTGTGCATTTTGG - Intergenic
1199191930 X:144980950-144980972 GAGAGAGACTCTGTATGTTTGGG + Intergenic
1199197376 X:145047461-145047483 AAGAGAGAATCTGTGCACTTGGG + Intergenic
1199247791 X:145626295-145626317 GGGAGAGACTCTGTACATTTGGG + Intergenic
1199303835 X:146244374-146244396 AAGAGAGAATCTGTGCATTTGGG + Intergenic
1199306469 X:146272711-146272733 GAGAGAGAATTTGTGTACTTAGG - Intergenic
1199455308 X:148021222-148021244 GAAAGAGAATCTGTGCACTTGGG - Intronic
1199795587 X:151192221-151192243 GAGAGAGACTCTATTTATTTGGG + Intergenic
1199826210 X:151503176-151503198 GAAAGATAATATGTTCATTTGGG + Intergenic
1200177198 X:154125508-154125530 GAGAGAGAAGCTGTACACTTGGG + Intergenic
1200364368 X:155645648-155645670 GAGAGAGAATCTGTGCATTTGGG - Intronic
1200370097 X:155715892-155715914 GTGAGAGAATCTTTGCACTTTGG - Intergenic
1200448640 Y:3297367-3297389 GAGAAAGAATCTGTGCACTTGGG + Intergenic
1200462776 Y:3478517-3478539 GAGAGACAATCTGTGCTCTAGGG + Intergenic
1200556543 Y:4642020-4642042 GAGAGAGAATCTGTGCACTTTGG - Intergenic
1200606177 Y:5265072-5265094 AGGAGAGAATCTTTGCACTTGGG - Intronic
1200608677 Y:5297699-5297721 GAGAAAGAATATGTGCATTTTGG - Intronic
1200638001 Y:5680185-5680207 AAGAGAGACTCTGTTTATTTGGG + Intronic
1200719551 Y:6588149-6588171 GAGAGAGACTCTGTTTGTTTGGG + Intergenic
1201346914 Y:12994642-12994664 GGGACAGAAATTGTGCATTTGGG - Intergenic
1201405242 Y:13643233-13643255 GAGACAGAATCTGTATGTTTAGG + Intergenic
1201488595 Y:14517627-14517649 GGGAGAGTATCATTGCATTTTGG - Intergenic
1201969849 Y:19780025-19780047 GAGTGAGTCTCTGTGCATGTGGG - Intergenic
1201979504 Y:19891808-19891830 AAGGGAGAATCTGTACACTTTGG + Intergenic