ID: 911012606 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:93297106-93297128 |
Sequence | GCGCTATATAACCTACTGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
911012601_911012606 | 25 | Left | 911012601 | 1:93297058-93297080 | CCAAAATCACTGCGCTCTTACTC | No data | ||
Right | 911012606 | 1:93297106-93297128 | GCGCTATATAACCTACTGCTGGG | No data | ||||
911012604_911012606 | 1 | Left | 911012604 | 1:93297082-93297104 | CCAAAATGCACAGATTCTCTCTC | No data | ||
Right | 911012606 | 1:93297106-93297128 | GCGCTATATAACCTACTGCTGGG | No data | ||||
911012602_911012606 | 3 | Left | 911012602 | 1:93297080-93297102 | CCCCAAAATGCACAGATTCTCTC | No data | ||
Right | 911012606 | 1:93297106-93297128 | GCGCTATATAACCTACTGCTGGG | No data | ||||
911012600_911012606 | 26 | Left | 911012600 | 1:93297057-93297079 | CCCAAAATCACTGCGCTCTTACT | No data | ||
Right | 911012606 | 1:93297106-93297128 | GCGCTATATAACCTACTGCTGGG | No data | ||||
911012603_911012606 | 2 | Left | 911012603 | 1:93297081-93297103 | CCCAAAATGCACAGATTCTCTCT | No data | ||
Right | 911012606 | 1:93297106-93297128 | GCGCTATATAACCTACTGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
911012606 | Original CRISPR | GCGCTATATAACCTACTGCT GGG | Intergenic | ||