ID: 911012606

View in Genome Browser
Species Human (GRCh38)
Location 1:93297106-93297128
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911012601_911012606 25 Left 911012601 1:93297058-93297080 CCAAAATCACTGCGCTCTTACTC No data
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data
911012604_911012606 1 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC No data
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data
911012602_911012606 3 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data
911012600_911012606 26 Left 911012600 1:93297057-93297079 CCCAAAATCACTGCGCTCTTACT No data
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data
911012603_911012606 2 Left 911012603 1:93297081-93297103 CCCAAAATGCACAGATTCTCTCT No data
Right 911012606 1:93297106-93297128 GCGCTATATAACCTACTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type