ID: 911012608

View in Genome Browser
Species Human (GRCh38)
Location 1:93297108-93297130
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911012601_911012608 27 Left 911012601 1:93297058-93297080 CCAAAATCACTGCGCTCTTACTC No data
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data
911012602_911012608 5 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data
911012600_911012608 28 Left 911012600 1:93297057-93297079 CCCAAAATCACTGCGCTCTTACT No data
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data
911012604_911012608 3 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC 0: 12
1: 49
2: 113
3: 210
4: 629
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data
911012603_911012608 4 Left 911012603 1:93297081-93297103 CCCAAAATGCACAGATTCTCTCT No data
Right 911012608 1:93297108-93297130 GCTATATAACCTACTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr