ID: 911012609

View in Genome Browser
Species Human (GRCh38)
Location 1:93297114-93297136
Sequence TAACCTACTGCTGGGGGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911012603_911012609 10 Left 911012603 1:93297081-93297103 CCCAAAATGCACAGATTCTCTCT No data
Right 911012609 1:93297114-93297136 TAACCTACTGCTGGGGGATATGG No data
911012602_911012609 11 Left 911012602 1:93297080-93297102 CCCCAAAATGCACAGATTCTCTC No data
Right 911012609 1:93297114-93297136 TAACCTACTGCTGGGGGATATGG No data
911012604_911012609 9 Left 911012604 1:93297082-93297104 CCAAAATGCACAGATTCTCTCTC 0: 12
1: 49
2: 113
3: 210
4: 629
Right 911012609 1:93297114-93297136 TAACCTACTGCTGGGGGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911012609 Original CRISPR TAACCTACTGCTGGGGGATA TGG Intergenic
No off target data available for this crispr