ID: 911014516

View in Genome Browser
Species Human (GRCh38)
Location 1:93317947-93317969
Sequence TCCTGCTGTTCCTCAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911014515_911014516 19 Left 911014515 1:93317905-93317927 CCTTCTTTTTGACAGTCTATTAC No data
Right 911014516 1:93317947-93317969 TCCTGCTGTTCCTCAAATGCTGG No data
911014513_911014516 24 Left 911014513 1:93317900-93317922 CCTACCCTTCTTTTTGACAGTCT No data
Right 911014516 1:93317947-93317969 TCCTGCTGTTCCTCAAATGCTGG No data
911014514_911014516 20 Left 911014514 1:93317904-93317926 CCCTTCTTTTTGACAGTCTATTA No data
Right 911014516 1:93317947-93317969 TCCTGCTGTTCCTCAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911014516 Original CRISPR TCCTGCTGTTCCTCAAATGC TGG Intergenic
No off target data available for this crispr