ID: 911017274

View in Genome Browser
Species Human (GRCh38)
Location 1:93346323-93346345
Sequence TTCGTGTCTCCTCAGAGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911017274_911017280 6 Left 911017274 1:93346323-93346345 CCGCCCCTCTGAGGAGACACGAA 0: 1
1: 1
2: 1
3: 9
4: 87
Right 911017280 1:93346352-93346374 TCCCCAGCCGCTCAAATTTCCGG 0: 1
1: 0
2: 0
3: 42
4: 945

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911017274 Original CRISPR TTCGTGTCTCCTCAGAGGGG CGG (reversed) Exonic
900166916 1:1247547-1247569 TTCGTGTCTGGCAAGAGGGGAGG - Intergenic
902164903 1:14562112-14562134 GTCGTGTGTCCTCAAAGGGGTGG - Intergenic
904303991 1:29575254-29575276 TTCCTGACTCCTGAGAGGGTGGG - Intergenic
905549017 1:38821336-38821358 TTCTTGTCTCCGCAGAGGGGAGG - Intergenic
908001850 1:59688113-59688135 ATCTTGTCTCCTCAGAGAGGGGG - Intronic
908136943 1:61142992-61143014 TTCGTGTCTCCTCAGAGAGGAGG + Intronic
908312693 1:62901335-62901357 TCCGTGTTTCCTCTGAAGGGAGG - Intergenic
908754210 1:67453111-67453133 TTAGTCTCTACTCAAAGGGGAGG - Intergenic
911017274 1:93346323-93346345 TTCGTGTCTCCTCAGAGGGGCGG - Exonic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
1067793701 10:49306051-49306073 TCCGTGTCTCCACAGAGCAGAGG - Intronic
1068953742 10:62804238-62804260 TTTGTGTTTCCTAGGAGGGGAGG - Intergenic
1072658803 10:97349456-97349478 TTCGTGTCTCTTCCAAGGAGGGG - Intergenic
1073639219 10:105232595-105232617 TTCTTGTTTCCTGAGATGGGAGG + Intronic
1077058615 11:608018-608040 TTCGTGTGATCTCAGAGGGCAGG - Exonic
1088994483 11:114984758-114984780 CTCCTGTCCCCTCAGAGGTGGGG - Intergenic
1090181961 11:124707603-124707625 TTTGTGTCTCCTCATACTGGGGG + Intergenic
1093431809 12:19093286-19093308 TTTGTTTCTCCTCAGCAGGGAGG - Intergenic
1097106996 12:56631845-56631867 TTCCTTACTCCACAGAGGGGTGG + Intronic
1097174384 12:57134343-57134365 TTCAGGGCTCCTCAGAGAGGAGG - Intronic
1101858424 12:108463192-108463214 TTGGTGTCTTCGCAGAGGGAAGG - Intergenic
1103191716 12:119007146-119007168 TTCGTGTCTTCAGAGAGGGCTGG - Intronic
1104702894 12:130920636-130920658 TTCTTCTCTCTTCAGAGTGGAGG + Intergenic
1105505776 13:21008342-21008364 GTGGGGTCTCCTCAGTGGGGAGG + Intronic
1105590640 13:21790091-21790113 CTCATGTTTCCCCAGAGGGGAGG + Intergenic
1107809837 13:44189619-44189641 TTCTAGGCTCCTCAGATGGGTGG + Intergenic
1110913903 13:80998226-80998248 TTTCTGTCTCCTGACAGGGGTGG - Intergenic
1113947668 13:114053264-114053286 TTCAAGTCTCCTCTGTGGGGCGG - Intronic
1120163233 14:81167900-81167922 GTCGTCTCTCTTCAGAGGGATGG - Intergenic
1121664015 14:95658295-95658317 TTGGGGTCTCCTGAGAGAGGTGG + Intergenic
1123194986 14:106607386-106607408 TCCTTGTGTTCTCAGAGGGGAGG - Intergenic
1123406332 15:20021284-20021306 TTCTTTTCTCATGAGAGGGGCGG - Intergenic
1123515662 15:21027932-21027954 TTCTTTTCTCATGAGAGGGGAGG - Intergenic
1124610491 15:31204637-31204659 TTCTCGTCCACTCAGAGGGGTGG - Intergenic
1126570247 15:50142911-50142933 TTCGTTTCTTCTCAAAAGGGAGG - Intronic
1128526295 15:68414643-68414665 TCCATCTCCCCTCAGAGGGGAGG + Intronic
1129382948 15:75179065-75179087 TCCATGTCCCCTCAGAGGGAGGG - Intergenic
1135894945 16:26391345-26391367 TTTGTGTCTTCCCAGATGGGTGG - Intergenic
1138292377 16:55858763-55858785 TTCATCTGTCCTCAGAGGAGTGG - Intronic
1144854005 17:18258283-18258305 GGCGTGTGACCTCAGAGGGGCGG + Intronic
1154104996 18:11515136-11515158 TTCATGAATCCTCAGAGGGATGG - Intergenic
1157296248 18:46447400-46447422 TTCCTCTCTCTTCAGAGGGAAGG - Intronic
1162077118 19:8195395-8195417 TTGGTGTCTGCTCAGAAGGGAGG - Intronic
1166054878 19:40282470-40282492 TTGGTCCCTCCTCAGAGTGGAGG - Intronic
1166246443 19:41530456-41530478 TTCATATCTCCTCACAGAGGAGG + Intergenic
1168583670 19:57576032-57576054 TTGGTATCTCCTCTGAGGTGGGG - Intronic
927615322 2:24588090-24588112 ATCCTGTCTCCAAAGAGGGGAGG - Intronic
928450474 2:31373949-31373971 TTCTTGTCTCCACAGAAGTGTGG - Exonic
929449869 2:42029757-42029779 CTCCTGTCTCCTCAGGTGGGAGG - Intergenic
930889022 2:56361572-56361594 TTCAAGTCTCCTCAGATGAGAGG - Intronic
941705138 2:168650258-168650280 TTGGTGTCTCATGAGAGGAGGGG + Intronic
942238808 2:173939989-173940011 GTCCTGTCTGCTCAGAGAGGCGG - Intronic
1173462620 20:43255680-43255702 TTTGTGTCTTTTCAGAGGGTCGG + Intergenic
1175416593 20:58805272-58805294 TTTATGTCTCATCAGAGGAGAGG - Intergenic
1175834143 20:61982674-61982696 TTGGTGTCTCCTCTCAGGTGGGG - Intronic
1181068834 22:20320190-20320212 TTGGAGTCTCCGCAGAGGAGCGG - Intergenic
1184158130 22:42682313-42682335 TTTGTGTCTCCTCTGGGGGAAGG + Intergenic
950511163 3:13428361-13428383 TTCCTGTCTTGTCAGAGGGAGGG + Intergenic
954602228 3:51878612-51878634 TCCAGGTCTCCTCAGAGAGGTGG - Intergenic
956716746 3:72086165-72086187 TTCCTGTTTCCAGAGAGGGGAGG - Intergenic
958180811 3:90058217-90058239 TTTGTGTCTCTTCAGTGTGGTGG + Intergenic
962486772 3:135851257-135851279 CACTTGTCTCCTCAGTGGGGAGG + Intergenic
972442411 4:39107552-39107574 TTCCTGTCTCCTCATAGGTGTGG + Exonic
976462886 4:85333403-85333425 TGCTTGTCTTCTCAGTGGGGAGG + Intergenic
978324175 4:107532831-107532853 TTTTTTTCTTCTCAGAGGGGAGG - Intergenic
979034268 4:115692953-115692975 TTTGTATTTCCTCAGAGGTGGGG + Intergenic
979964505 4:127061722-127061744 TTAATGTTTCCTCAGAGAGGTGG - Intergenic
985661727 5:1160628-1160650 TGCTTGTGTCCTCGGAGGGGTGG - Intergenic
987812509 5:22856459-22856481 TTCCTGTATCCTCAAAGGGGAGG + Intergenic
992070128 5:73140682-73140704 TTCTAGTCTCCTCAGAGAGTTGG + Intergenic
995212737 5:109559134-109559156 TTCTTGACTCCTCAGAGTGAGGG + Intergenic
996553228 5:124751561-124751583 TTAGTGTCTACTCAGAGATGTGG + Intergenic
996579544 5:125015847-125015869 TTCCTTTCTCCTCAGATAGGAGG + Intergenic
999201564 5:149820418-149820440 TTCCTGTCTCCTCAGGGTGGAGG + Exonic
1001534439 5:172488743-172488765 TTCGAGGGTCCTCAGTGGGGAGG + Intergenic
1003457058 6:6292881-6292903 TTCCAGTCTCTTCAGAGGAGAGG - Intronic
1006334482 6:33413394-33413416 GTCCTGTCTCTGCAGAGGGGAGG + Exonic
1006555022 6:34858581-34858603 TTCTTTTGGCCTCAGAGGGGAGG + Exonic
1010109795 6:72213139-72213161 TTCATGTCTCTTCAGAAGGGTGG + Intronic
1018732802 6:166665476-166665498 TGGGGGTCTTCTCAGAGGGGAGG - Intronic
1019308933 7:349533-349555 TTCGTGTGTCCTTAAAGGCGGGG + Intergenic
1024943900 7:54790104-54790126 TCCGTGTTTCCTCAAAGGAGAGG - Intergenic
1026047123 7:66913770-66913792 TTCTTGTTTACTCTGAGGGGTGG + Intergenic
1026528497 7:71176456-71176478 TTCGTGTCTCCATGGCGGGGAGG + Intronic
1032127577 7:129205966-129205988 TTTGTATCTGCTCAAAGGGGCGG + Intronic
1032381037 7:131481132-131481154 TTCCTGTCTTGTCTGAGGGGAGG + Intronic
1036565504 8:9934646-9934668 TTTGTGTTTCCACAGCGGGGAGG + Intergenic
1047147063 8:122214236-122214258 TTCTTGTGTCCTCACAGGGCAGG - Intergenic
1048973417 8:139657779-139657801 TTCCTGTCTCCTCACAGAGGAGG + Intronic
1051357585 9:16253860-16253882 TTTTTGTCTCTTCAGAGAGGTGG - Intronic
1051508947 9:17856505-17856527 TTTGTTTCTCCTTAGAGGGCAGG - Intergenic
1052395322 9:27931338-27931360 CAGGTGTCTCCTCAGAGCGGGGG + Intergenic
1055761659 9:79615231-79615253 TTCCTGTCTCTTCAGAGGCATGG + Intronic
1055941010 9:81649755-81649777 AACCTGTCTCCCCAGAGGGGAGG - Intronic
1059623353 9:116033880-116033902 TCCGTGTTTCCCCAAAGGGGAGG - Intergenic
1185921563 X:4098709-4098731 TTAGTGTCTCCTAAGGGGAGAGG + Intergenic
1190254419 X:48751935-48751957 TTCTTGTCTCCTTAGAATGGAGG - Intergenic
1199182912 X:144879232-144879254 TTCATATCTCCTCAGTGGGTGGG + Intergenic
1202195753 Y:22297266-22297288 TTCGTGTCTCCCCAGCGGGCAGG - Intergenic