ID: 911019711

View in Genome Browser
Species Human (GRCh38)
Location 1:93374515-93374537
Sequence GGCAAGTGCTCATGCTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911019711_911019713 -2 Left 911019711 1:93374515-93374537 CCAGTACAGCATGAGCACTTGCC No data
Right 911019713 1:93374536-93374558 CCCAAGAATTGCAGCCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911019711 Original CRISPR GGCAAGTGCTCATGCTGTAC TGG (reversed) Intergenic
No off target data available for this crispr