ID: 911031003

View in Genome Browser
Species Human (GRCh38)
Location 1:93488344-93488366
Sequence GGAGACTGCTTGGGTATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911031003_911031007 -4 Left 911031003 1:93488344-93488366 CCCAGTATACCCAAGCAGTCTCC 0: 1
1: 0
2: 1
3: 16
4: 135
Right 911031007 1:93488363-93488385 CTCCCATCCAAATACTAACCAGG 0: 7
1: 134
2: 139
3: 104
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911031003 Original CRISPR GGAGACTGCTTGGGTATACT GGG (reversed) Intronic
901343532 1:8517720-8517742 GGATACTGCTTTGTTACACTGGG - Intronic
903673167 1:25048233-25048255 GGAGACTGCGTGTGTATGGTGGG - Intergenic
904830135 1:33300995-33301017 GGAGCCTTCTTGGATATACTAGG + Intergenic
905304858 1:37010582-37010604 GGAGACTGCTGGGGTAATCCTGG - Intronic
905971038 1:42142576-42142598 GGAGACTTCTTGGGCATTCAGGG + Intergenic
908685822 1:66718400-66718422 GTACACTGCATGGGTATAGTGGG + Intronic
908903632 1:68983876-68983898 GGAGACTGGTTGGGTTTTCAAGG - Intergenic
911031003 1:93488344-93488366 GGAGACTGCTTGGGTATACTGGG - Intronic
912689004 1:111789694-111789716 GTAGACAGCTTGTGAATACTTGG + Intronic
916669882 1:167006044-167006066 AGAGACTGCCTGGGAATACTGGG + Intronic
916966464 1:169949415-169949437 AGAGACTGCTTAGGTTTCCTTGG - Intronic
917340262 1:173969329-173969351 GGAGACTACCTGGGAATATTGGG - Intronic
920242356 1:204562424-204562446 GGAGACCGCCTGGGAATACCTGG - Intergenic
922831882 1:228558297-228558319 GGAGACCGCCTGGGAATACCGGG - Intergenic
922832362 1:228610279-228610301 GGAGACCGCCTGGGAATACCGGG - Intergenic
922832922 1:228612520-228612542 GGAGACCGCCTGGGAATACCGGG - Intergenic
922833483 1:228614761-228614783 GGAGACCGCCTGGGAATACCGGG - Intergenic
922834043 1:228617002-228617024 GGAGACCGCCTGGGAATACCGGG - Intergenic
922834600 1:228619243-228619265 GGAGACCGCCTGGGAATACCGGG - Intergenic
922835152 1:228621458-228621480 GGAGACCGCCTGGGAATACCGGG - Intergenic
922835711 1:228623678-228623700 GGAGACCGCCTGGGAATACCGGG - Intergenic
922836269 1:228625920-228625942 GGAGACCGCCTGGGAATACCGGG - Intergenic
922836827 1:228628159-228628181 GGAGACCGCCTGGGAATACCGGG - Intergenic
922837386 1:228630401-228630423 GGAGACCGCCTGGGAATACCGGG - Intergenic
922837947 1:228632642-228632664 GGAGACCGCCTGGGAATACCGGG - Intergenic
922838505 1:228634882-228634904 GGAGACCGCCTGGGAATACCGGG - Intergenic
922839063 1:228637107-228637129 GGAGACCGCCTGGGAATACCGGG - Intergenic
922839623 1:228639348-228639370 GGAGACCGCCTGGGAATACCGGG - Intergenic
922840183 1:228641579-228641601 GGAGACCGCCTGGGAATACCGGG - Intergenic
922840743 1:228643820-228643842 GGAGACCGCCTGGGAATACCGGG - Intergenic
922841307 1:228646051-228646073 GGAGACCGCCTGGGAATACCGGG - Intergenic
922949898 1:229549989-229550011 GGAGACTGCCTGGGAATACAAGG + Intronic
1064436042 10:15312112-15312134 GGAGGCAGCTTTGGTATAATAGG - Intronic
1064882347 10:20070057-20070079 GGAGAATGGTAGGGTATATTTGG + Intronic
1065334302 10:24640251-24640273 GGAGACTGCCTGGGAATATCAGG + Intronic
1068025215 10:51634326-51634348 GGTGATTGATTGGGTATAATTGG + Intronic
1068209856 10:53907408-53907430 GGAGACTGGAGGGGAATACTAGG - Intronic
1070285074 10:75077037-75077059 GGACACTGCTTTGGAGTACTAGG + Intergenic
1071479314 10:86052533-86052555 GGAGACTGCCTGGGAATACCAGG + Intronic
1073166573 10:101459306-101459328 GGTGACTACTTAGGTATACATGG + Intronic
1075106741 10:119544057-119544079 GGAGAGTGCTTGGAAATGCTCGG - Intergenic
1078116666 11:8459675-8459697 GGAGACTGCTAGGCTCTGCTTGG - Intronic
1079991274 11:27249269-27249291 GGAGACTGCTTTGGGTTTCTAGG - Intergenic
1085858696 11:80206640-80206662 GGCCATTGATTGGGTATACTGGG - Intergenic
1088374044 11:109120889-109120911 GGAGACTGCCTGGGAATATCAGG - Intergenic
1094630369 12:32168210-32168232 GTAAACTGCTTGTGTAAACTGGG + Intronic
1094818111 12:34205784-34205806 GGAGACTGACTGGGAATACCGGG + Intergenic
1095033987 12:37333874-37333896 GGAATCTGCTTGTGTATATTTGG - Intergenic
1095034466 12:37342976-37342998 GGAATCTGCTTGTGTATATTTGG - Intergenic
1095034748 12:37348051-37348073 GGAATCTGCTTGGGGATATTTGG - Intergenic
1095035723 12:37367575-37367597 GGAATCTGCTTGTGGATACTTGG - Intergenic
1095037117 12:37397058-37397080 GGAATCTGCTTGTGTATATTTGG + Intergenic
1095098811 12:38161477-38161499 GGAGACCGCCTGGGAATACCGGG - Intergenic
1096980260 12:55724520-55724542 GTAGACTGCTTGGGCAGGCTTGG - Exonic
1097019036 12:56007366-56007388 GGAGACTGCTGGGGGAAAATGGG - Intergenic
1099245437 12:80188214-80188236 GGGGATTACTTGGCTATACTGGG + Intergenic
1102232882 12:111275695-111275717 GGAGACAGCCTGGGTGTACCCGG + Intronic
1103447704 12:121004917-121004939 GGAGTCTGCTTGGCTATTCCAGG + Intronic
1106549564 13:30759522-30759544 GGAGACACCTTGGGTCTCCTTGG - Intronic
1107960289 13:45551496-45551518 GAAGACTGCCTGGGAATACTGGG - Intronic
1112501159 13:99944414-99944436 GCAGACTGTGTGGGTATCCTAGG + Intergenic
1112517660 13:100068985-100069007 GGAGACTGATTGAATAAACTAGG + Intergenic
1114810027 14:25887846-25887868 GGAGACTGTTTTTGTATAATAGG - Intergenic
1117490269 14:56240254-56240276 GGAGGCTGTTAGGGTATCCTGGG + Intronic
1120282013 14:82451308-82451330 GTAGACAGCGTGGATATACTGGG - Intergenic
1202833208 14_GL000009v2_random:58528-58550 GGAGTCTGCTTGGGTCAACAGGG - Intergenic
1126390942 15:48151472-48151494 GGAGATTCCTTTGGTAGACTTGG - Exonic
1127282024 15:57501012-57501034 GGAGAATGCGTGTGTATGCTTGG + Intronic
1127503223 15:59574114-59574136 GGATACTGCCTGGGAATACTGGG - Intergenic
1129996948 15:80015119-80015141 GGATATTGGTTGGGTGTACTTGG + Intergenic
1134613080 16:15626490-15626512 GGAGAATGCCTGGGAATACTAGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1137520903 16:49194748-49194770 GCAGACGTCTGGGGTATACTCGG + Intergenic
1137926780 16:52547513-52547535 GCAGACGGCTTGGGGATGCTGGG - Intronic
1138005925 16:53337538-53337560 GAAGACTGCCTGGAAATACTGGG + Intergenic
1143421022 17:6792379-6792401 GGAGACTGATTTGTTATACAGGG - Intronic
1146892684 17:36516354-36516376 TTAGACTGCTTGGGTATAAATGG - Intronic
1149948471 17:60958107-60958129 GGAGACTGCTAGGCTCCACTAGG - Intronic
1150170406 17:62987715-62987737 GGAGAGTGCTGGGGTACAGTAGG - Intergenic
1155274199 18:24170516-24170538 GGAGACCGCCTGGGAATACCAGG - Intronic
1156435361 18:37121909-37121931 GGAGACTATTTGGGTATCCTTGG - Intronic
1162639483 19:11996883-11996905 GGAGAATGCCTGGGAATACTGGG + Intergenic
1163763830 19:19151442-19151464 GGAGACTGCTGGACTATGCTGGG + Intronic
1164939853 19:32243975-32243997 GGAGACTGTCTGGGAATACTGGG - Intergenic
1202639459 1_KI270706v1_random:69168-69190 GGAGTCTGCTTGGGTCAACAGGG + Intergenic
925691362 2:6526743-6526765 GGAGACTTCATGGACATACTGGG + Intergenic
926264313 2:11300781-11300803 GGAGACTTCTTGGGTCTTTTGGG - Intronic
939201295 2:139038467-139038489 GGAGAATGCCTTGGTAGACTTGG - Intergenic
941044269 2:160654756-160654778 GGAGCCTGCCTGGGAATACTGGG - Intergenic
942462320 2:176176951-176176973 GGAGAAAGATTGGGTATATTGGG + Intergenic
942479270 2:176365746-176365768 GGAGACTGCTGGGCTCTGCTTGG - Intergenic
945572174 2:211482025-211482047 GGAGACTGCCTGTCTCTACTTGG - Intronic
1168787875 20:555669-555691 GGGGACAGCCTGTGTATACTGGG - Intergenic
1170815566 20:19711018-19711040 TGAGACTGCATGTGCATACTGGG - Intronic
1170973485 20:21138967-21138989 GGAGACTTCCTGGGAATACCAGG - Intronic
1171588318 20:26558152-26558174 GGAGACTGCAAGTGGATACTTGG + Intergenic
1171589153 20:26570048-26570070 GGAGACTGCAAGTGGATACTTGG + Intergenic
1171717656 20:28507969-28507991 GGAGACTGCAAGTGGATACTTGG + Intergenic
1171886119 20:30653534-30653556 GGAGCCTGCTTGGGTCAACAGGG + Intergenic
1172470966 20:35195390-35195412 GGAGACCACCTGGGAATACTGGG + Intergenic
1175773043 20:61635665-61635687 GGAAGCTGCTTGGGAATTCTGGG + Intronic
1176647787 21:9366777-9366799 GGAGTCTGCTTGGGTCAACAGGG + Intergenic
1178025311 21:28459533-28459555 AGATCCTGCCTGGGTATACTGGG - Intergenic
1180362483 22:11912696-11912718 GGAGTCTGCTTGGGTCAACAGGG - Intergenic
1184475653 22:44719956-44719978 GGGGACAGCCTGGGTATACCTGG - Intronic
949852236 3:8430899-8430921 GGAGACTGCCTGGGTGATCTGGG + Intergenic
950609195 3:14114403-14114425 AGAGACTGCATGAGTAAACTGGG - Intronic
952037018 3:29214962-29214984 GGATAGTGCTTGGGTATTCGAGG + Intergenic
952454005 3:33456017-33456039 GGAGACTGGTTTGGTTTAATAGG + Intergenic
953393748 3:42549961-42549983 GGAGACAGCTGGGGCATATTCGG - Intronic
959215524 3:103446683-103446705 GGAGCCTGCTTGGAGATGCTGGG + Intergenic
960267789 3:115640647-115640669 GGAGACTTGTTGGGTATTCTTGG - Intronic
964772242 3:160236519-160236541 GGAGACTGCTGGGGATGACTGGG - Intronic
966432171 3:179843793-179843815 AGATAGTGCTTGGGGATACTGGG + Intronic
966606089 3:181822883-181822905 GGAGACCGCCTGGGAATACCGGG - Intergenic
967829110 3:193903693-193903715 GGACACAGCTTGCTTATACTGGG + Intergenic
1202739096 3_GL000221v1_random:38210-38232 GGAGTCTGCTTGGGTCAACAGGG - Intergenic
971159990 4:24123841-24123863 TGAAACTGCTTGGGTATGGTGGG - Intergenic
973369714 4:49235531-49235553 GGAGCCTGCTTGGGTCAACAGGG + Intergenic
973391317 4:49559885-49559907 GGAGCCTGCTTGGGTCAACAGGG - Intergenic
1202766818 4_GL000008v2_random:155037-155059 GGAGTCTGCTTGGGTCAACAGGG + Intergenic
990248420 5:53888026-53888048 GGAGACTTTTTGGACATACTTGG - Intronic
990434752 5:55777554-55777576 GGAGACTGCCTAGGAATACTAGG + Intronic
996754495 5:126921682-126921704 AGAGAATTCTTGGGTAGACTGGG - Intronic
998263839 5:140652020-140652042 GGAGACTTCTTGGGGTTTCTGGG + Intronic
1002878510 6:1232292-1232314 GGAGGCTGCTTGGATACATTAGG + Intergenic
1002899935 6:1402073-1402095 GGAGTCTGCTCGAGTGTACTGGG - Intergenic
1003250831 6:4428048-4428070 GGAGACCGCCTGGGAATACCGGG + Intergenic
1005049801 6:21674203-21674225 GGAGACTGGTTGGGATTACCCGG + Intergenic
1008753154 6:54761338-54761360 GTAGACTGCTTTGGTTTAGTAGG - Intergenic
1015534814 6:134257110-134257132 GGAGACTGTTTGGGAATACCAGG + Intronic
1017563661 6:155661049-155661071 GGAGACTGCTTGGATAGTGTGGG - Intergenic
1031823637 7:126534984-126535006 GGAGACAGCTTGGAAGTACTGGG + Intronic
1033326852 7:140386792-140386814 GGACACTGCCTGGGAATACCGGG - Intronic
1034436176 7:151063687-151063709 GCAGACTGCTTGGGAGGACTGGG + Intronic
1034639709 7:152592984-152593006 GGAGACTGCCTGGGAATACTGGG - Intergenic
1038277889 8:26136965-26136987 GAAGACTGCCTGGGAATACTGGG + Intergenic
1040101749 8:43512265-43512287 GGAGCCTGCTTGGATAAACAGGG - Intergenic
1042421686 8:68598068-68598090 GGTGACTGCTTGGACATATTTGG + Intronic
1050528881 9:6570040-6570062 GGTGACTGCTTTGGAATATTTGG + Intronic
1051198771 9:14593952-14593974 GGAGACAGCTTGGGGAAACAGGG + Intergenic
1053352312 9:37421887-37421909 GGAGACTGCCTGGAAATACCAGG - Intergenic
1053482755 9:38428197-38428219 GGAGAATGCTTGGGTAGATGTGG - Intergenic
1055207515 9:73750983-73751005 GGAGACCACCTGGGAATACTAGG - Intergenic
1058538325 9:105986346-105986368 AGAGACTGCATGGGTAGAATAGG + Intergenic
1059786934 9:117596554-117596576 TGAGACTGCCTGGGTATCCATGG + Intergenic
1061503681 9:131018593-131018615 TGACACTGCTTGGGAGTACTTGG + Intronic
1061959593 9:133981307-133981329 GGACACTGCACGGGTATAGTGGG - Intronic
1203707825 Un_KI270742v1:68654-68676 GGAGTCTGCTTGGGTCAACAGGG - Intergenic
1187200541 X:17129973-17129995 GGAGGCTGCATGCGTAGACTTGG + Intronic
1188339619 X:28982863-28982885 GGAGAGTGCCTGGGAATACCGGG - Intronic
1196601986 X:117612256-117612278 GCAGACTAACTGGGTATACTGGG - Intergenic
1198982200 X:142411138-142411160 GGAGACTGCCTGGTAATACTGGG + Intergenic