ID: 911031056

View in Genome Browser
Species Human (GRCh38)
Location 1:93488707-93488729
Sequence ATCAAACATATGTAGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911031056 Original CRISPR ATCAAACATATGTAGGCCCA GGG Intronic
900543919 1:3218022-3218044 ATCCAACATCTGCAGGCCCTGGG + Intronic
903253187 1:22072022-22072044 ATCAAACCTAAGAAGGGCCATGG - Intronic
908127418 1:61044771-61044793 ACCAAAAGTATTTAGGCCCAAGG - Intronic
910081585 1:83348247-83348269 AAATAACATATGAAGGCCCAGGG + Intergenic
911031056 1:93488707-93488729 ATCAAACATATGTAGGCCCAGGG + Intronic
912034023 1:105287890-105287912 ATTAAACATGTGTAAGCCTAAGG - Intergenic
916363705 1:163999627-163999649 GTCAAATATATCTATGCCCATGG - Intergenic
916513042 1:165490230-165490252 GTGAAACAAATGTGGGCCCAAGG - Intergenic
919300529 1:195757617-195757639 ATCAACCAGAAGTAGCCCCAAGG - Intergenic
921270895 1:213468889-213468911 GTCAAGCATATGAAGGCCCAGGG - Intergenic
922293220 1:224226279-224226301 ATCAAACATATAGAGGCCAAAGG + Intergenic
1063864943 10:10353689-10353711 ATCAAACAGCTGTAGAACCAGGG + Intergenic
1070091707 10:73292726-73292748 ATAAAACATATGTATGACAAAGG - Intronic
1070488502 10:76953680-76953702 ATCAAAAATAATTAGGACCAGGG + Intronic
1070544733 10:77443191-77443213 GGAAAACATATGTAGGCCCCTGG - Intronic
1073086974 10:100897806-100897828 ATTATACATGTGTAGGGCCAGGG - Intergenic
1074880656 10:117655246-117655268 ATCACACCTATGGAGTCCCATGG - Intergenic
1076899180 10:133328729-133328751 AGCAAACAGATGAAGGGCCATGG - Intronic
1079535322 11:21507396-21507418 ATCCTACAGATGTAGCCCCATGG + Intronic
1087166846 11:95013255-95013277 ATCAAACAAATGTAGACCAAAGG + Intergenic
1090564147 11:127968356-127968378 ATCAAGTATCTGTAGGACCATGG - Intergenic
1094319003 12:29164537-29164559 ATCCAACATCTGAAGGCCCTTGG + Intronic
1098880152 12:75909063-75909085 AGCAAACATATATAGGCAGAGGG + Intergenic
1100470235 12:94885481-94885503 ATCAAACATATCTAGGTACATGG - Intergenic
1103130810 12:118466928-118466950 AACAACCATCTGTAAGCCCAAGG - Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1114605384 14:23991721-23991743 AAAAAAGATATGGAGGCCCATGG - Intronic
1114610869 14:24039352-24039374 AAAAAAGATATGGAGGCCCATGG - Intergenic
1115441001 14:33435663-33435685 ATCTAATTTATGTAGTCCCAGGG - Intronic
1118051827 14:62037734-62037756 TTGAAACATATCTAGTCCCAAGG + Intronic
1119569373 14:75656761-75656783 ATGAAACTTAAGAAGGCCCATGG - Intronic
1130303569 15:82698625-82698647 ATCAAATATATCCAGCCCCAAGG + Intronic
1130543210 15:84836767-84836789 TTCAAATATATGTATGCTCATGG - Intronic
1130746535 15:86659850-86659872 ATCAAAGTTATATGGGCCCATGG + Intronic
1137295506 16:47088913-47088935 ATCTGACAAATGTAGGTCCACGG + Intronic
1145050049 17:19652833-19652855 ACACAATATATGTAGGCCCATGG + Intronic
1146309103 17:31753495-31753517 ATGAAACATATATAAGCCCCTGG + Intergenic
1147591607 17:41687453-41687475 AACAAAAATATGCATGCCCATGG - Intergenic
1149603740 17:57910459-57910481 ATCAAAAATATATATGCCTAGGG + Intronic
1152890627 17:82879744-82879766 ATCAGACCAATGTTGGCCCAGGG - Intronic
1157150990 18:45217737-45217759 ACCAACCATATGTAAGCACAGGG - Intronic
1164829899 19:31312330-31312352 CTTAAACATATATAGCCCCATGG - Intronic
927836463 2:26402760-26402782 ATCAACCCTATGAAGGCCCAGGG - Intronic
932929281 2:76014517-76014539 TTCAAACATATGTAGGATCATGG - Intergenic
936002042 2:108842693-108842715 ATCAAACATATTTAGGAACTGGG + Intronic
937103958 2:119293409-119293431 ACCAAACATATGCACGCCCCAGG - Intergenic
941347846 2:164391879-164391901 ATCAAATATAAGTATTCCCAGGG + Intergenic
941568837 2:167143326-167143348 ATGAAGCATCTGTGGGCCCACGG - Intronic
944337846 2:198558494-198558516 AGCAAACATATATAGGAACAAGG + Intronic
946234322 2:218313623-218313645 ATTAAAAATTTGAAGGCCCAGGG - Intronic
946831850 2:223735596-223735618 ACCAAACATGTGGAGGCCCCAGG + Intergenic
947468833 2:230381522-230381544 ATCAAATATATCTGGACCCATGG - Intronic
1168775577 20:444666-444688 ATCTTACATATGTATGCGCAAGG + Intronic
1171305924 20:24105562-24105584 GTCAAAAATATGTGGTCCCATGG - Intergenic
1176701079 21:10050679-10050701 ATCAAAGATATGTATGCACAAGG + Intergenic
1177512924 21:22113426-22113448 ATCAAACATATGGAGTCCCAAGG - Intergenic
1177578663 21:22991729-22991751 AGCAGACATATATAGGACCAGGG + Intergenic
1180070464 21:45433516-45433538 ATCCAACAGATGCCGGCCCAGGG + Intronic
1180890924 22:19288320-19288342 ATCATACATATGTATGCATAGGG + Intronic
1182693607 22:32180874-32180896 ATGAAACATACTTAGGGCCATGG - Intergenic
1185332660 22:50258642-50258664 ACCAAACAGATCCAGGCCCAGGG + Intronic
960151724 3:114255868-114255890 ATAAAACAAATGTAGGGCTAAGG - Intergenic
967008312 3:185406572-185406594 ATTAGACATATGTAGGCTAAGGG + Intronic
969886680 4:10221339-10221361 GTCATACAGATGTAGGTCCAAGG - Intergenic
970846813 4:20549609-20549631 TTCTAATAGATGTAGGCCCATGG + Intronic
975651768 4:76600219-76600241 ATCTAATAGATGCAGGCCCAAGG - Intronic
980373231 4:131907005-131907027 ATCAAAGATATGTATGCACAAGG + Intergenic
982855729 4:160380076-160380098 ATCAAAGATTTGTAGGCTTAAGG + Intergenic
982954340 4:161743394-161743416 CTAAAACATATGTAGACCAATGG - Intronic
982997126 4:162363607-162363629 ATCATCAATATGTTGGCCCATGG - Intergenic
986740884 5:10704129-10704151 CTGAAACCTATGTAGCCCCAAGG - Intronic
987083903 5:14450943-14450965 ACCAAACATATGTAAGAGCAAGG + Intronic
989997489 5:50853253-50853275 ATCAGACAGCTGTATGCCCAAGG - Intergenic
992283246 5:75204013-75204035 ATTAAACAAATGTAAGCGCAAGG - Intronic
994538929 5:101069729-101069751 TTCAAAAAGATGTAGGGCCAAGG - Intergenic
999328671 5:150658630-150658652 ATCAAACGTATGTAGGTGAAAGG + Intronic
1002982775 6:2158264-2158286 ATAAAACATATGTACGCATAAGG + Intronic
1003162634 6:3649447-3649469 ATCAGTCATAAGTAGGTCCAAGG - Intergenic
1011489897 6:87880524-87880546 ATAAAAAATATGTAAGTCCAGGG - Intergenic
1011520382 6:88197731-88197753 ATCAAACATGTGCAGGCCACTGG + Intergenic
1022596220 7:31715695-31715717 AACAAAACTCTGTAGGCCCAAGG - Intergenic
1027299073 7:76810487-76810509 AAATAACATATGAAGGCCCAGGG + Intergenic
1030260116 7:107555162-107555184 ATCAAACATCTGTAGGGAAAAGG - Intronic
1030989565 7:116283873-116283895 AACAAAAATATGTAGGCCAGTGG + Intergenic
1033644066 7:143287723-143287745 ATCATCCATATGTAGCCCCGGGG + Exonic
1033841932 7:145386025-145386047 AGCAAGCATTTGGAGGCCCAAGG - Intergenic
1035346115 7:158199763-158199785 ATCCAACAAATGCTGGCCCAGGG + Intronic
1035994108 8:4526395-4526417 ATCTTACTTATGTATGCCCAAGG + Intronic
1038975753 8:32693840-32693862 AACAAACATATGTAGGAACAAGG - Intronic
1041465966 8:58157907-58157929 ACCAAGCATCTCTAGGCCCAAGG + Intronic
1042960185 8:74295026-74295048 TTCAAACTTATGTAGGTCCAGGG - Intronic
1044168556 8:89020250-89020272 ATCACAGATATGTAGGGTCAGGG - Intergenic
1049283264 8:141761289-141761311 ATCAATCATCTGTGGGTCCAAGG + Intergenic
1053638223 9:40037178-40037200 ATCAAAGATATGTATGCACAAGG + Intergenic
1053767862 9:41428042-41428064 ATCAAAGATATGTATGCACAAGG - Intergenic
1054319014 9:63633781-63633803 ATCAAAGATATGTATGCACAAGG + Intergenic
1054546527 9:66339546-66339568 ATCAAAGATATGTATGCACAAGG - Intergenic
1055216101 9:73864342-73864364 ATCAAAAAGATGAAGTCCCAGGG - Intergenic
1057870879 9:98716265-98716287 ATGAAACATACTTAGGGCCATGG - Intergenic
1062130676 9:134891468-134891490 ATTTAACAAATCTAGGCCCAGGG + Intergenic
1062646107 9:137549161-137549183 GTCAAACATCTGTAGCCACATGG - Intronic
1202786093 9_KI270719v1_random:20736-20758 ATCAAAGATATGTATGCACAAGG + Intergenic
1185747131 X:2582817-2582839 ATCAGACATTTGCAGTCCCACGG + Intergenic
1187017482 X:15344465-15344487 AGTAAACAAATGTAGCCCCATGG - Intergenic
1192033711 X:67542970-67542992 TTAAAACATAGGGAGGCCCAGGG + Intergenic
1195112515 X:101661469-101661491 CTCAACCAAATGTATGCCCAGGG + Intergenic
1198402948 X:136285281-136285303 AGCAAACAAATATAGGACCATGG - Intergenic
1199516405 X:148681274-148681296 ATAAAACATAAGCAGCCCCAAGG - Intronic
1201447889 Y:14078427-14078449 ATCAAACAAATGTAAGTCAAAGG - Intergenic