ID: 911037493

View in Genome Browser
Species Human (GRCh38)
Location 1:93566205-93566227
Sequence TGAGAGACCTTGGGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911037493_911037500 9 Left 911037493 1:93566205-93566227 CCAGTTTTCCCCAAGGTCTCTCA 0: 1
1: 0
2: 0
3: 23
4: 292
Right 911037500 1:93566237-93566259 CTTGGGTTGTGCCATCTGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 137
911037493_911037497 -9 Left 911037493 1:93566205-93566227 CCAGTTTTCCCCAAGGTCTCTCA 0: 1
1: 0
2: 0
3: 23
4: 292
Right 911037497 1:93566219-93566241 GGTCTCTCAGCGCCTTTGCTTGG 0: 1
1: 0
2: 0
3: 9
4: 144
911037493_911037498 -8 Left 911037493 1:93566205-93566227 CCAGTTTTCCCCAAGGTCTCTCA 0: 1
1: 0
2: 0
3: 23
4: 292
Right 911037498 1:93566220-93566242 GTCTCTCAGCGCCTTTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911037493 Original CRISPR TGAGAGACCTTGGGGAAAAC TGG (reversed) Intronic
900110632 1:1004048-1004070 GGGGAGACTGTGGGGAAAACCGG + Intergenic
901133669 1:6979152-6979174 TGAAAGACATTGGGGAGAGCTGG + Intronic
902704340 1:18194121-18194143 TGAGAGACGCTGGAGCAAACAGG + Intronic
903666042 1:25008347-25008369 TGAGTGACCTTGGGTAAGCCTGG - Intergenic
904922447 1:34019658-34019680 TTAGAGACATTGGGGAGAGCAGG - Intronic
904944302 1:34188027-34188049 TGCGAGATTCTGGGGAAAACGGG + Intronic
907723628 1:56998182-56998204 TGAGACAGCTTTGGGAAAAGGGG + Intronic
907747064 1:57223900-57223922 TGTGATATCATGGGGAAAACTGG + Intronic
908887943 1:68811433-68811455 TGAGCATCCTTGGGGAAAGCTGG + Intergenic
909118334 1:71568395-71568417 GGAGAGAACTTGGGAAAAGCAGG + Intronic
910192640 1:84610293-84610315 TGAAAGCCCTTTGGGAAAACTGG + Intergenic
910218201 1:84863648-84863670 TGAGAGTCCTGGGGGGAAACTGG - Intronic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
911576858 1:99588242-99588264 TAAGAGCCCTTTGGGAAAACTGG - Intergenic
912196120 1:107399178-107399200 TGAGAAACATTGGGTAAAATAGG - Intronic
913530190 1:119728515-119728537 GCAGAGACCTGGGGGAAGACAGG - Intronic
915087510 1:153398317-153398339 TGAGAGACTCTGGGGATAAGAGG + Intergenic
916260717 1:162839563-162839585 TGTGAGACCTTGGGAACATCAGG + Intronic
916738080 1:167625952-167625974 TTAGATACCTTGAGGACAACGGG - Intergenic
918057214 1:181032322-181032344 TGAGAGACATTTGGGAATATTGG + Intergenic
919562900 1:199144940-199144962 AGAGACAACTGGGGGAAAACAGG + Intergenic
919725539 1:200880360-200880382 TGAGAGAGCTGGGGAAAGACGGG + Intergenic
921713407 1:218395201-218395223 TGAAAGACCCTGGGCAATACTGG + Intronic
921870410 1:220133374-220133396 TGTTAGACCCTGGGGAAATCTGG - Intronic
921919671 1:220653169-220653191 TGAGCTCCCTCGGGGAAAACGGG - Exonic
922612068 1:226938174-226938196 TGGGAGAGCTTGGAGGAAACAGG + Intronic
922829421 1:228544038-228544060 AGAGACACCTTGGGGACCACAGG - Intergenic
923188641 1:231598316-231598338 GGACAGACCTTGGAGAAAAGGGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1064632239 10:17328400-17328422 GCAGAGAACTTGGGGAAAATAGG - Intronic
1064958422 10:20937371-20937393 TGAGAGATGTAGGAGAAAACAGG + Intronic
1065119951 10:22518866-22518888 TGCGAGAACTTGGGTAATACAGG + Intergenic
1065317961 10:24483116-24483138 AAAGAGACCTTGGAGAATACTGG + Intronic
1067143206 10:43673450-43673472 AGACAGACCTTGGGGAGAAAAGG - Intergenic
1067241371 10:44497494-44497516 TGAGAGACATTGGAGAACCCTGG + Intergenic
1069304756 10:66955548-66955570 TGAGAGGCAATGAGGAAAACTGG - Intronic
1071121147 10:82280651-82280673 TGACAGACCTTGCGGAGAAAAGG - Intronic
1071689530 10:87802259-87802281 TGAAAGCCCCTTGGGAAAACTGG + Intronic
1073704395 10:105966564-105966586 GGAGAGATCCTTGGGAAAACTGG - Intergenic
1073900005 10:108209110-108209132 TGAGACATCTTGGAGAAAATTGG + Intergenic
1074884995 10:117686292-117686314 TGATGGTCCTTGGGGAACACTGG + Intergenic
1075068483 10:119305297-119305319 TCAGAGACCTGGGGGAAGATGGG + Intronic
1076316047 10:129542286-129542308 GGAGAGGCCGTGGGGATAACTGG - Intronic
1076597430 10:131632959-131632981 GGAGAGGCCTTGGGGAAGGCAGG - Intergenic
1076979116 11:195890-195912 TGAGGGAACTTAGGGAAACCTGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080141495 11:28926328-28926350 TTAGTGACCCTGGGGAAACCTGG - Intergenic
1080307093 11:30848482-30848504 TGAGAGACTTTGGAGGAAATGGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084425494 11:69081792-69081814 TCAGAGACCTGGGGGAGCACTGG - Intronic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1086876072 11:92097095-92097117 TGGGAGACCTTGAGGGAACCAGG + Intergenic
1086876164 11:92097950-92097972 TGAGAGACCTCAAGGGAAACAGG - Intergenic
1089045680 11:115500970-115500992 GGAGGGCCATTGGGGAAAACTGG + Intronic
1089185679 11:116613225-116613247 TGAGAGATGAGGGGGAAAACTGG - Intergenic
1090655985 11:128845919-128845941 GAAGAGAGCTTGGGGAAAAAGGG + Intronic
1093644650 12:21571159-21571181 TGAGAGGCCTTGGGGAAGTCGGG + Intronic
1093708454 12:22302128-22302150 TGAAAAACCTTAGGCAAAACTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1095308154 12:40662483-40662505 CCAGAGGCCTTGGGGAAAAATGG + Intergenic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1097902773 12:64889904-64889926 TGGGAGACCTTGAGGAACACAGG - Intergenic
1097903727 12:64899182-64899204 TGAGAGACCTAGGAGTCAACAGG + Intergenic
1098438074 12:70489337-70489359 TGAAAGCCCCTTGGGAAAACTGG - Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1102906027 12:116675828-116675850 TACGTGAACTTGGGGAAAACGGG + Intergenic
1103617672 12:122165049-122165071 TGAGAATCTGTGGGGAAAACAGG + Intergenic
1104252609 12:127109665-127109687 TGAGACAGTTTTGGGAAAACTGG + Intergenic
1104925223 12:132310470-132310492 TGAGAGCCCTCCGGGAAAGCAGG + Intronic
1106420984 13:29585947-29585969 TGAGAAACCCTGGGCAAACCAGG + Intronic
1106482311 13:30146069-30146091 AGAGAGGCCTAGGGGACAACTGG - Intergenic
1106760778 13:32865469-32865491 TAACAGACCTTGGGGGAAAAGGG - Intergenic
1108314323 13:49222410-49222432 TCTAAGACTTTGGGGAAAACAGG + Intergenic
1108432216 13:50365758-50365780 TGTGAGGCCTGGGGGAAATCAGG + Intronic
1109306661 13:60648935-60648957 TGACAAACCTTGGGGAAGAATGG - Intergenic
1113730883 13:112640799-112640821 TGAGGGACCCTGGGAACAACTGG + Intergenic
1113912262 13:113848376-113848398 TGAGAGACCTTTGTGTCAACAGG - Intronic
1115656058 14:35444878-35444900 TGAAAGAACTTGGAGAAACCCGG - Intergenic
1116563515 14:46415258-46415280 TGTGAGGGCTTGGGGAAAAGAGG - Intergenic
1117307671 14:54492241-54492263 TAAGAGTCCTTTAGGAAAACTGG - Intergenic
1117537138 14:56713104-56713126 ACAGACACCCTGGGGAAAACAGG - Intronic
1117665013 14:58047528-58047550 TGAGAGAACTGGGGTAAAAGAGG + Intronic
1118478134 14:66137883-66137905 TGTGAAACTTTGGGGAAAAGGGG - Intergenic
1118520654 14:66580756-66580778 TGAGAGAGCTTGAGAAACACTGG - Intronic
1119178140 14:72584696-72584718 TGAGAGAGACTGGGGAAGACAGG + Intergenic
1119186177 14:72644071-72644093 TGAGAGACTTCAGGGAAAGCTGG - Intronic
1119193128 14:72697798-72697820 TGAGAGAACTTGGTGGAAAAGGG + Intronic
1120912985 14:89684526-89684548 TAAAAGCCCTTTGGGAAAACTGG + Intergenic
1123138543 14:106053103-106053125 TAAGAGCCCCTTGGGAAAACTGG - Intergenic
1202873368 14_GL000225v1_random:185894-185916 TGAGAGGGCTTAGGGAAAAAAGG + Intergenic
1126120470 15:45246974-45246996 AGAAAGACCATGGGCAAAACAGG - Intergenic
1127263445 15:57343013-57343035 TGAGTGTTCTTGGGGCAAACAGG + Intergenic
1129177097 15:73848009-73848031 TGAGAGTCCTGGGGGAAAGAGGG + Intergenic
1129907454 15:79198651-79198673 GGAGAGACCATGTGGAAAAAGGG - Intergenic
1130270120 15:82441794-82441816 TGAGGGACCCTGGGGAAGGCAGG + Intergenic
1130485533 15:84396298-84396320 TGAGGGACCCTGGGGAAGGCAGG + Intergenic
1130490216 15:84425678-84425700 TGAGGGACCCTGGGGAAGGCAGG - Intergenic
1131519455 15:93102456-93102478 TGAGAGACCTTGGGGCCAGCCGG + Intergenic
1132913218 16:2326571-2326593 TGAGAGACATGGAGGAAAAAGGG - Intronic
1133468627 16:6052302-6052324 TGCGTGACCTTGGGCAAAATGGG - Intronic
1135245028 16:20848232-20848254 TGGGAAACGTTGGGGAAAAAAGG + Intronic
1135777356 16:25268558-25268580 TGCGAGAACTCGGGGAAAATGGG - Intergenic
1136449124 16:30342799-30342821 GGAGAGACCTTGGGGAGGGCAGG - Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1142466606 17:140708-140730 TGAGGGAACTTAGGGAAACCTGG + Intergenic
1142787870 17:2238449-2238471 TTAGAGCCCGTGGGGAAAAACGG - Intronic
1142987751 17:3707144-3707166 TGATAGACGGTTGGGAAAACGGG + Intergenic
1143250183 17:5517745-5517767 TGGGAGGCCTTGGTGAAACCAGG - Exonic
1145250428 17:21294163-21294185 TGAGGGACCCTGGGGAATAGAGG + Intronic
1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG + Intronic
1150208072 17:63424207-63424229 TGAGAGACCCTGGGGAGAAGCGG - Exonic
1151140302 17:71985334-71985356 TGGCAGACCTCTGGGAAAACAGG + Intergenic
1151473105 17:74330127-74330149 TCAAAGACCTTGGGGAAAGCAGG + Intronic
1152125436 17:78443864-78443886 TGAGTGTCCTTTGGGAAACCTGG + Intronic
1152824320 17:82454609-82454631 TATGAGACAATGGGGAAAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155329593 18:24701292-24701314 TGAGAGTCTTTGGGGATAATTGG - Intergenic
1155495219 18:26436048-26436070 TGAGAGCCCTTAGGAAAAAGAGG - Intergenic
1156530542 18:37810773-37810795 TGAGAGAGCTTGGGGAGGCCAGG - Intergenic
1156576715 18:38325492-38325514 AGAGTGAGCTTGGGGAAAAGTGG - Intergenic
1156852732 18:41746794-41746816 TGAGAGAGCTGGGGGAAAAGGGG + Intergenic
1157912839 18:51635360-51635382 TGAAAGCCCCTTGGGAAAACTGG + Intergenic
1158552326 18:58446526-58446548 TCAGAAAGCTTGAGGAAAACTGG + Intergenic
1159129998 18:64270555-64270577 GGAGAGACCTTCAGGAACACAGG + Intergenic
1159837843 18:73361198-73361220 TGAAAGAGTTTGGGGAAAATTGG + Intergenic
1160844183 19:1159423-1159445 TGAGAGACCTTGGGGGGACGGGG + Intronic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167368315 19:49065954-49065976 TGAGAGACCCTGAGAAAGACAGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925159212 2:1672031-1672053 TCATAGACCTTAGGAAAAACAGG + Intronic
925243275 2:2353675-2353697 TGAGAGAAGCTGGGGAAAGCTGG - Intergenic
925334012 2:3079961-3079983 TGAGAGGACTTGGGGAAAGGGGG + Intergenic
926046717 2:9715373-9715395 TGAGGGACTTTGGGAAAATCAGG + Intergenic
926927324 2:18000915-18000937 TAAGAGCCCTTTGGGAAAACTGG + Intronic
929712114 2:44275907-44275929 TGAAAGACCTTGGGTAGATCTGG - Exonic
929760921 2:44805619-44805641 TGTGGGCCCTTGGGGAAGACTGG + Intergenic
932196834 2:69791259-69791281 TAAAAGCCCCTGGGGAAAACTGG - Intronic
933402501 2:81816930-81816952 TGAGAGAGTCTGAGGAAAACAGG - Intergenic
936016056 2:108959810-108959832 TGAGAGACCTGTGGAAAAGCTGG - Intronic
937250342 2:120519702-120519724 TGTGAGCCCCTGGGGAACACAGG + Intergenic
940122687 2:150284646-150284668 TGAGAGACTCTGGGGTAAACAGG - Intergenic
940401975 2:153257908-153257930 TAAAAGACCCTTGGGAAAACTGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943043611 2:182832211-182832233 TGAGAAAGCCTGAGGAAAACAGG + Intergenic
945212529 2:207398191-207398213 TGAGAGACCCTGGGACAAAGTGG + Intergenic
945474970 2:210271052-210271074 TTAGAGATATTGTGGAAAACAGG - Intergenic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
947116266 2:226774412-226774434 GGAGAGAACATGGGGAAATCGGG + Intronic
948226946 2:236318772-236318794 TGAGTGACCTTGGGTCAATCTGG - Intergenic
948436731 2:237958812-237958834 AGAGAGGCCTTGGGAGAAACCGG - Intergenic
948438667 2:237971097-237971119 TAAGAGACCTGGGTGAAAAATGG + Intronic
1169613550 20:7411863-7411885 TGATAGATATTGGGGACAACTGG - Intergenic
1169745602 20:8939439-8939461 TGAAAGACGTGGGGGAAAAGGGG - Intronic
1171518624 20:25759152-25759174 AGACAGACCTAGGGGAAAAAAGG + Intergenic
1171558232 20:26097057-26097079 AGACAGACCTAGGGGAAAAAAGG - Intergenic
1172361770 20:34317671-34317693 TGAGAGACCTTGAGCAAGAATGG - Intergenic
1172379550 20:34476690-34476712 TGAGAGAACTTGGCATAAACAGG + Intronic
1172531963 20:35637586-35637608 AGAAAATCCTTGGGGAAAACAGG - Intronic
1172733382 20:37107606-37107628 TGGGAGACCTTAGAGAAAAGTGG + Intronic
1173226657 20:41166154-41166176 TGAGGGAGGCTGGGGAAAACAGG - Intronic
1173557455 20:43976330-43976352 TGAGAGACCATGTGGAACACAGG - Intronic
1173964490 20:47101682-47101704 TGAGAGGCCTGAGGGACAACAGG + Intronic
1174178933 20:48662827-48662849 TGAGAGCCCTTGAGGACATCAGG + Intronic
1176721815 21:10399709-10399731 TGAGAGAGCTTGGGCAAGTCAGG - Intergenic
1177778972 21:25602668-25602690 TGTGAGACCTTAGAGAAAAGAGG + Intronic
1178244706 21:30939158-30939180 TGGGAGACTTTGGAAAAAACTGG + Intergenic
1178689780 21:34741339-34741361 TGGGAGACCTGGAGGAAACCAGG + Intergenic
1178710432 21:34911875-34911897 TGAGCAGCCATGGGGAAAACTGG - Intronic
1179568167 21:42261971-42261993 CGAGAGACCCTGGGGAAGATCGG - Intronic
1180917067 22:19496787-19496809 TAAAAGACCTTGAGGAAGACTGG - Intronic
1182811341 22:33119452-33119474 AAACATACCTTGGGGAAAACAGG - Intergenic
1182841707 22:33395956-33395978 TTAGAGTCCTGGGGGAAAAGGGG - Intronic
1183470573 22:38003884-38003906 AGAGTGAACTTGGGGAAAAAAGG - Intronic
1183710813 22:39502251-39502273 AGAGAGAGCTTGGAGAAGACCGG + Intronic
949608627 3:5681050-5681072 AGAGAGATCTTGGAGAAGACAGG - Intergenic
950675239 3:14550582-14550604 TGGATGACCTTGGGCAAAACCGG + Intergenic
951091032 3:18574089-18574111 AGAGAGACTTGGGGGAACACTGG - Intergenic
951473950 3:23084669-23084691 TGAGATAAAGTGGGGAAAACAGG + Intergenic
951486746 3:23221447-23221469 TGAAAGAGCTGGGGGAAAATGGG - Intronic
952889438 3:38030484-38030506 GGAGAGTCCCTTGGGAAAACTGG + Intergenic
953528103 3:43712291-43712313 TGATTGACCCTGGGGATAACAGG + Intronic
955909423 3:63845055-63845077 TGAGACTCCTTGAGGAACACAGG + Exonic
955911859 3:63865144-63865166 TGAAAGAACTGGGGGAAAACAGG - Intronic
956390160 3:68763194-68763216 AGAGAGACCTTTAGGAAAATTGG + Intronic
957016823 3:75074899-75074921 TAAGAGAAGTTGGGGAGAACTGG + Intergenic
959238234 3:103752539-103752561 TGAAAGACCATGTGGTAAACAGG + Intergenic
959377522 3:105604194-105604216 TCAGATATCTTGGGGACAACTGG - Intergenic
960141856 3:114158933-114158955 TGAGAGCCCTGGGGGAAAGGAGG - Intronic
960620215 3:119630032-119630054 AGAGAGATCTTGGGGAATACAGG + Intergenic
961046651 3:123713102-123713124 TGAGTGAACTTGGGGGAAACCGG + Intronic
961069136 3:123905204-123905226 TGAGAAACCTTTGGGGAGACAGG + Intronic
961452859 3:127010270-127010292 TCAGAGCCTTTGGGGACAACTGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962437815 3:135382824-135382846 TCAGAGGCACTGGGGAAAACAGG + Intergenic
962898021 3:139733416-139733438 GGAGAGACCTTGGAGAAGAGGGG + Intergenic
963086208 3:141438805-141438827 TGAGAGAGCTTGGGAAAGAAGGG - Intronic
963668522 3:148221823-148221845 AGAGAGACCGAGTGGAAAACAGG - Intergenic
963763385 3:149308081-149308103 TGACACACCTTGGGCAAAAAGGG - Intergenic
963896644 3:150693349-150693371 TAAAAGCCCTTTGGGAAAACTGG + Intronic
964107226 3:153052293-153052315 TGTGCTACCTTTGGGAAAACTGG - Intergenic
965862698 3:173166375-173166397 TGAGAGCTCTTGTGGAGAACAGG + Intergenic
966530357 3:180971999-180972021 GTAGAGACATTTGGGAAAACTGG + Intronic
966721488 3:183067141-183067163 TAAAAGCCCCTGGGGAAAACTGG + Intronic
967341051 3:188398399-188398421 TGAGAGACATTTGGAAAAACTGG - Intronic
968253390 3:197244152-197244174 TGAGAGACATGAGGTAAAACTGG + Intronic
968905443 4:3448599-3448621 TGAGAGAACTCGGGGCAAAGGGG - Intronic
969433578 4:7170487-7170509 TGAGAGGCCTAGAGGCAAACGGG - Intergenic
971239900 4:24878969-24878991 TGAGATACCTGGTAGAAAACAGG + Intronic
972697301 4:41459963-41459985 TGAGAGACTTGGGCGAAGACTGG - Intronic
972880711 4:43418501-43418523 TGTTAGATCTTGAGGAAAACCGG + Intergenic
972986945 4:44776658-44776680 TAAAAGCCCTTTGGGAAAACTGG + Intergenic
975769597 4:77707101-77707123 TGGGAGACCTGGAGGGAAACTGG + Intergenic
976600742 4:86935394-86935416 TGGGAGCCCTCGGGGAGAACGGG + Intronic
977376500 4:96211857-96211879 TAAGAGATCTTGGGGAAATATGG + Intergenic
980419717 4:132544267-132544289 AAAGAAACCTTTGGGAAAACTGG + Intergenic
980497714 4:133606728-133606750 TCAGACACTTTGGGGAATACTGG - Intergenic
981101703 4:140836206-140836228 TGAGAGAATTTGGGAAAAAAAGG - Intergenic
982144274 4:152365689-152365711 TGAGATATCTTGGAGATAACTGG + Intronic
982602897 4:157474145-157474167 TGAAAGTCCCTTGGGAAAACTGG + Intergenic
983284358 4:165720562-165720584 TGAGTGACCTTGGCGATAGCAGG + Intergenic
984197392 4:176675639-176675661 TGAGAGAGCTTGTTGAAAAACGG - Intergenic
985791043 5:1926856-1926878 TGGGAGAACTGGGGGAGAACCGG - Intergenic
986041518 5:3998584-3998606 TGTGAGTCCTTGGGGAGGACAGG - Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
990572761 5:57095309-57095331 TCAGAGAGGTTGGGGAAAGCTGG - Intergenic
991239764 5:64444423-64444445 TAAAAGACCCTTGGGAAAACTGG + Intergenic
991483221 5:67106126-67106148 TGAGAAAACTTGTAGAAAACGGG - Intronic
992207168 5:74442225-74442247 TGAGAGAGATTGTGAAAAACTGG - Intergenic
992246952 5:74835639-74835661 TAAGAGACCTGGGGGAATATAGG - Intronic
993190673 5:84675485-84675507 TGAAAGACCTTGGGCAAGAGAGG + Intergenic
993669397 5:90742093-90742115 TGATAGACCCTGGGGAAACAAGG + Intronic
998726163 5:145017166-145017188 TGAGAGACCATGTGGAAAGAAGG + Intergenic
1001251928 5:170153224-170153246 GAAGGGCCCTTGGGGAAAACTGG + Intergenic
1004163190 6:13232700-13232722 TGAGAGAGATTGGGGAAGCCAGG - Intronic
1006725917 6:36198766-36198788 GGAGAGACCTTTGGGGATACAGG - Intronic
1006834395 6:36988197-36988219 TGAGAGAGAATGGGCAAAACAGG + Intergenic
1007328509 6:41083510-41083532 TGAGAGACTGTAGGGAAAAAAGG + Intronic
1007770682 6:44189608-44189630 TGAGAGGTCTGGGGGAAATCAGG - Intergenic
1009274205 6:61654513-61654535 TGTCAGACCTTGGGTCAAACAGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010810247 6:80292157-80292179 TAAAAGACCCTTGGGAAAACTGG - Intronic
1011580789 6:88861793-88861815 TTAAAAACTTTGGGGAAAACTGG - Intronic
1013390971 6:109686120-109686142 GGAGAGTCCTTGGGTAAGACTGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016032998 6:139357031-139357053 AGTGAGACAGTGGGGAAAACTGG + Intergenic
1016212915 6:141562251-141562273 TGAGAAACAGTGGGGAAAAGGGG - Intergenic
1016694234 6:146974234-146974256 TGAGACACCTTGGGTACAAAAGG - Intergenic
1016795789 6:148115790-148115812 TGAGAGACCATGGAAAAATCTGG + Intergenic
1018702828 6:166440867-166440889 TGAGTATTCTTGGGGAAAACGGG + Intronic
1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG + Intergenic
1020030895 7:4932002-4932024 GGAGAGACCTCGGGGAGAATAGG - Intronic
1020879484 7:13741723-13741745 TGAGACACCTGGTGGAAAGCTGG - Intergenic
1021233668 7:18116794-18116816 TGCATGACCTTGGGGAAAATTGG + Intronic
1022071576 7:26921167-26921189 TAAGTGACCTTGACGAAAACTGG - Intronic
1022403589 7:30065052-30065074 TGAGAAACCTTGAGGAGAAAAGG - Intronic
1022995241 7:35748748-35748770 TGAGAAACATTGGATAAAACTGG - Intergenic
1023627439 7:42130010-42130032 TGATAGACCTGGGTGGAAACAGG - Intronic
1023701089 7:42892491-42892513 TGAGAGATTGTGGTGAAAACTGG - Intergenic
1028616952 7:92779322-92779344 TGATAAACCTTGGAGAAAAAAGG + Intronic
1029321430 7:99764208-99764230 TCGAAGACCTTGGGGAAAACTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030929813 7:115508437-115508459 TTACAGACCTTAGGGAAATCGGG - Intergenic
1030956943 7:115864628-115864650 TTAGAATCCTTGGGGAAGACTGG - Intergenic
1031971124 7:128065869-128065891 TGGGAGACCTTTGGGAAGATGGG + Intronic
1032141699 7:129337170-129337192 TGATAGCCTTAGGGGAAAACTGG - Intronic
1032629890 7:133638017-133638039 TGAGAAACAGTAGGGAAAACGGG + Intronic
1032951508 7:136919950-136919972 TGAGAAACATTGAGGAATACAGG - Intronic
1033246600 7:139721746-139721768 TGAGAGACCAGGGGGACTACTGG + Intronic
1034488994 7:151382882-151382904 CCAGGGACCTTGGGGAAAAGGGG + Intronic
1035262190 7:157669146-157669168 TGTGAGACCTCAGGGAACACAGG + Intronic
1036998620 8:13689836-13689858 AGAGATACCCTGGGAAAAACTGG - Intergenic
1038102281 8:24391201-24391223 AGAGTGATCTTAGGGAAAACAGG - Intronic
1039954609 8:42197396-42197418 TGACTGTTCTTGGGGAAAACGGG + Intronic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1042372227 8:68005119-68005141 GGAGAGACCCTGGGGAGGACAGG - Intronic
1042788884 8:72581320-72581342 AGAGAGAACTAGGGGAAAACAGG - Intronic
1043140343 8:76580771-76580793 TCACATACTTTGGGGAAAACAGG + Intergenic
1043629301 8:82308524-82308546 TGAGAGACAATGGGGAAAGTAGG + Intergenic
1044378289 8:91502017-91502039 TAAAAGCCCTTTGGGAAAACTGG - Intergenic
1044439355 8:92205249-92205271 TGAAAGCCCCTTGGGAAAACTGG - Intergenic
1046332535 8:112738560-112738582 TGAGAGACCCTTGGGAAAAGGGG + Intronic
1048251624 8:132871029-132871051 AGAGAGCCCGTGGAGAAAACTGG + Intronic
1048982079 8:139707924-139707946 TGAGAAACATTGGGTTAAACGGG + Intergenic
1049215377 8:141405403-141405425 TGGGTGGTCTTGGGGAAAACTGG - Intronic
1049662518 8:143826055-143826077 TGGGAGAACTTGGAGGAAACCGG + Intronic
1051749361 9:20325372-20325394 GGAGAGACCTGAGGGAAACCTGG + Intergenic
1053467363 9:38318649-38318671 AGAGAGGCCTTGGGGTATACAGG - Intergenic
1053481608 9:38420414-38420436 TGACAAACCTTGGGAAAAACAGG + Intronic
1054730984 9:68702874-68702896 GGAAAGACCTTGGAGAAAAAAGG + Intergenic
1054795242 9:69295482-69295504 ACAGAGACTTTGGGGAAAAAAGG - Intergenic
1057695560 9:97320557-97320579 TGTGTGACCTTGGGAAAATCAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057917958 9:99072059-99072081 TGAGTGACCTTGAGGATACCAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059337972 9:113580980-113581002 TGATAGTCCTTGGGGAAAGACGG - Intronic
1062402990 9:136380567-136380589 TGAGAGGCCCTGGGGAAGTCAGG - Intronic
1203731091 Un_GL000216v2:90644-90666 TGAGAGGGCTTAGGGAAAAAAGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191645416 X:63475415-63475437 AGAGAGACCTCGGGGTAAAGTGG - Intergenic
1191856761 X:65633532-65633554 TGAGAGGCCTGGGGAAATACAGG - Intronic
1193179468 X:78436798-78436820 TAAAAGACCCTTGGGAAAACTGG - Intergenic
1193415230 X:81214230-81214252 TTAGTGACCTTGGAGAAAAGCGG + Intronic
1193440879 X:81538084-81538106 TGAGAGAACTGAGGGAAAGCTGG - Intergenic
1194044788 X:88988999-88989021 TAAAAGCCCCTGGGGAAAACTGG + Intergenic
1195219512 X:102732986-102733008 TAAAAGCCCTTTGGGAAAACTGG - Intronic
1195677378 X:107517382-107517404 TGAGATTTCTTGGGGAAAATGGG + Intergenic
1195693669 X:107650427-107650449 GCATAGACCTTGGGGAGAACTGG - Exonic
1195842220 X:109186630-109186652 TGAGACCCCTTGAGGAACACAGG - Intergenic
1198506855 X:137309510-137309532 TGAATGACCTTGGGTAAAAGAGG - Intergenic
1198830149 X:140741729-140741751 ATAGAGACCTTGGGGAAGTCAGG + Intergenic
1199511977 X:148632591-148632613 TGAGATACTTAGGGGAAAGCTGG + Intronic
1199737542 X:150697660-150697682 CGTGTGACCTTGGGCAAAACTGG + Intronic
1200218798 X:154380534-154380556 TGAGAGTCCTGGGGGCAAAAGGG + Intronic