ID: 911037628

View in Genome Browser
Species Human (GRCh38)
Location 1:93567222-93567244
Sequence CTGTATCGTAATTGAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911037628_911037629 19 Left 911037628 1:93567222-93567244 CCTTCATTTCAATTACGATACAG 0: 1
1: 0
2: 0
3: 12
4: 123
Right 911037629 1:93567264-93567286 AAACCCATCTCTTACCTGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911037628 Original CRISPR CTGTATCGTAATTGAAATGA AGG (reversed) Intronic
908404797 1:63804200-63804222 CTGTATTGTAATTGTAATGGTGG + Intronic
908711677 1:67022772-67022794 CTTTATCGTGATTGTAATGGTGG - Intronic
911037628 1:93567222-93567244 CTGTATCGTAATTGAAATGAAGG - Intronic
911907984 1:103594114-103594136 CTATCTCGTAATTCAATTGAGGG - Intergenic
911913520 1:103666595-103666617 CTATCTCGTAATTCAATTGAGGG - Intronic
911914932 1:103685352-103685374 CTATCTCGTAATTCAATTGAGGG + Intronic
919095514 1:193030105-193030127 CTGTTTGGGAATTTAAATGAGGG - Intronic
921827065 1:219684463-219684485 CTGTATCTTAATTGAGATGGTGG - Intergenic
1063287944 10:4711122-4711144 CAGTATGGTAATTGAAGTTATGG + Intergenic
1064416035 10:15151007-15151029 CTGTACCATATTTGAAATGTGGG + Intronic
1067408679 10:46045881-46045903 CTGCATCGTTTTTGAGATGAGGG - Intronic
1069759969 10:70802853-70802875 ATGTAACGTATTTGAAAAGAAGG - Intergenic
1071107982 10:82121056-82121078 CTGTAGAGTAACTGGAATGATGG - Intronic
1072267073 10:93741147-93741169 CTGTGTCATAAAGGAAATGAAGG - Intergenic
1072933217 10:99686324-99686346 CTGCATAGTAATTGCAATGAAGG - Intronic
1073112513 10:101071037-101071059 CAGTATCTTCACTGAAATGAGGG + Intergenic
1073954142 10:108848501-108848523 CTCAATGGTAATGGAAATGATGG + Intergenic
1078033440 11:7777853-7777875 CTGTATCCTAATTGTGATGGTGG + Intergenic
1079764749 11:24377925-24377947 CTGTCTGGTAATTTGAATGAAGG + Intergenic
1080015678 11:27504445-27504467 CTGTATTGTAATTGTACTGTAGG + Intronic
1080718817 11:34829681-34829703 CTCTATCTTAATTGTGATGATGG + Intergenic
1081832301 11:46123621-46123643 CTGTAATGTATTTAAAATGAGGG + Intergenic
1086376434 11:86205663-86205685 CTTGATCGTAATTGAACTAATGG + Intergenic
1091772228 12:3159693-3159715 CAGTTTCTTAATTGAGATGAGGG - Intronic
1098556821 12:71828369-71828391 CTGTATCTTAATTGTAACTATGG - Intergenic
1098790431 12:74816316-74816338 CTGTATCTAAGTGGAAATGATGG + Intergenic
1098792590 12:74843783-74843805 CTGTATCATGATTTAAAAGATGG + Intergenic
1099857504 12:88185156-88185178 CAGTATCTTAATTGTAATTATGG - Intronic
1102903204 12:116655042-116655064 CTATATCTTAATTGCAGTGATGG + Intergenic
1106155746 13:27154193-27154215 CAGCATAGTAATTTAAATGATGG - Intronic
1108488471 13:50953319-50953341 CTGTATCAGAATTGAAATCTTGG + Intronic
1109129639 13:58566484-58566506 CTGTATCTTTATTGCAATAAAGG - Intergenic
1109720618 13:66271373-66271395 CTGTTTCAAAATTGTAATGATGG - Intergenic
1110087333 13:71397375-71397397 CTGTATCTTGATTGTAGTGATGG + Intergenic
1110911058 13:80964237-80964259 CTGTTGCTTAATTGAAATGAGGG - Intergenic
1110919957 13:81070859-81070881 CTGTATCATATTAGAAATGCAGG + Intergenic
1111659852 13:91195353-91195375 ATGTAAACTAATTGAAATGATGG - Intergenic
1116464606 14:45216685-45216707 CTGTGTAGTAATTGAAAGGAGGG - Intronic
1120224578 14:81776315-81776337 CTGTGAAGTAATTGAAATAAAGG + Intergenic
1127113690 15:55701992-55702014 CTGTATCCTGATTGTAGTGATGG + Intronic
1136545840 16:30954169-30954191 CTGTATAGGAATGGAAATGGTGG - Exonic
1142777547 17:2153421-2153443 CTATATCTTAATTGTAGTGATGG + Intronic
1146221847 17:31031034-31031056 CTGTACTGTAATTGTAATCATGG + Intergenic
1146264492 17:31443129-31443151 CTGTATTATAATTCAAAAGAGGG - Intronic
1156551350 18:38021814-38021836 CTGTATCTTAATTGTCATGGTGG + Intergenic
1157637380 18:49171951-49171973 CTGTATCATTATTGTAGTGATGG - Intronic
1158261112 18:55606771-55606793 CTGAATGACAATTGAAATGATGG + Intronic
1158433427 18:57414390-57414412 CTGTATCTTGATTGTATTGATGG + Intergenic
1161564343 19:4991699-4991721 CTGTATCTTGATTGCAATGGTGG - Intronic
1166420077 19:42630018-42630040 CAGTATCGTAGCTGGAATGAAGG + Intronic
926501415 2:13657964-13657986 CTGTATCCTGATTGTAATGGTGG - Intergenic
931016551 2:57988061-57988083 CTGTATCTTGATTGTAATGGTGG + Intronic
931477544 2:62605069-62605091 CTGTATCTTGATTGTAATGGTGG + Intergenic
933108522 2:78365506-78365528 CTGTATCATAATTCTGATGATGG - Intergenic
935688419 2:105708223-105708245 TTGTATCTTAATCAAAATGAAGG + Intergenic
936625075 2:114140100-114140122 CTTTATCATAATTGAAACAAAGG - Intergenic
939238429 2:139527895-139527917 CTGTATAGTCATTAAAATCATGG + Intergenic
945852223 2:215022717-215022739 CAGAATCGTAAGTGACATGATGG + Intronic
1170008611 20:11695976-11695998 TTGTATTCTAATTGAAAAGAAGG + Intergenic
1175640621 20:60626900-60626922 CGGTGTCGTAATTGAACTGGAGG - Intergenic
1178590285 21:33904035-33904057 CTTTATCTAAATTGAAAGGATGG - Intronic
1182289987 22:29269217-29269239 CTGAAACATAATTCAAATGAAGG - Intronic
1183478354 22:38049148-38049170 CTGTATCTTAATTGTGATGGTGG + Intergenic
1184952385 22:47853171-47853193 TTCTGTCGTAATTGTAATGAGGG - Intergenic
951672784 3:25203871-25203893 CAGATTCATAATTGAAATGAAGG - Intronic
953650042 3:44794290-44794312 CTCTATTGTAATTGTAAAGACGG - Exonic
954311967 3:49776588-49776610 CAGTATGATAATTGAAAAGAAGG + Intronic
956154678 3:66282777-66282799 CTGTATCTTGATTGTGATGATGG - Intronic
959175637 3:102905873-102905895 GTGTAATGCAATTGAAATGAGGG + Intergenic
960359552 3:116695069-116695091 CTTTCACGTAATTGAAAGGAGGG - Intronic
965234561 3:166099627-166099649 CAGTATCATAAATCAAATGAAGG - Intergenic
967833779 3:193943889-193943911 CTGTATGGGGATGGAAATGAAGG + Intergenic
973016360 4:45143500-45143522 CTGTAACTTAATTGCAATAATGG - Intergenic
973086761 4:46073293-46073315 TTGTATCTCAATTAAAATGAGGG - Intronic
973398844 4:49620438-49620460 CTGTATCACAATGGAAATCATGG - Intergenic
980840880 4:138259921-138259943 CAGTATCATGATTGAAATCAAGG - Intergenic
982548551 4:156766238-156766260 TTGTATCTTCATTGAAATGCTGG - Intronic
983330914 4:166327632-166327654 GTGTATGGAAATTGAAATGGGGG + Intergenic
987621229 5:20340188-20340210 CTGTTTCTCAATTCAAATGAAGG + Intronic
989220210 5:38950643-38950665 CTGTATCTTCATTGATATCAAGG + Exonic
992482195 5:77163153-77163175 CAGTTTCGTGATAGAAATGAGGG + Intergenic
993050430 5:82920242-82920264 CTCTATAGATATTGAAATGATGG - Intergenic
993847172 5:92958409-92958431 CTGAATCTTAAGGGAAATGAAGG + Intergenic
995196607 5:109376907-109376929 CTGGATCTGAATTGAAATGAGGG - Intronic
996869508 5:128172443-128172465 CTGTATCTTTATTGCAATGGTGG - Intronic
997728631 5:136145586-136145608 CTGTATGCTTATTGAAATAAAGG + Intronic
999426767 5:151494385-151494407 CTGTATCTTGATTGAGATGGTGG - Intergenic
1000921524 5:167144032-167144054 CTGTATTCACATTGAAATGAGGG + Intergenic
1003275933 6:4653135-4653157 CTGTATCATAATTGTAGTGGTGG + Intergenic
1003905220 6:10693552-10693574 CTGTATCGCACTTGAAATGGAGG + Intronic
1004285836 6:14319801-14319823 CTGAATTGTAATTGAAAAAATGG + Intergenic
1005063781 6:21798460-21798482 CTGTATCCCAATTGCAGTGATGG - Intergenic
1007012718 6:38433234-38433256 CTGAATCTTAACTGACATGAAGG - Intronic
1008426907 6:51369476-51369498 CTGTATCACAATTGTAAAGAAGG - Intergenic
1009557688 6:65194989-65195011 CTGTATGTTAGTTGATATGAGGG + Intronic
1010257184 6:73771732-73771754 CTGTATCGTAATGGTTATGTTGG + Intronic
1012552348 6:100475322-100475344 CTGTATCTTAATTGTAGTGATGG - Intergenic
1012699227 6:102432246-102432268 CTGTATTGTTTTTGCAATGAGGG + Intergenic
1013930322 6:115522684-115522706 CTGTATCTTCCTTGAAAAGAGGG + Intergenic
1013935728 6:115590605-115590627 CTGTTTTTTAATTGAAAAGAAGG + Intergenic
1014619707 6:123651563-123651585 CTGTATCATATTTCAGATGAGGG - Intergenic
1019822830 7:3258383-3258405 CTATATAGTAGTTAAAATGAAGG + Intergenic
1022525937 7:31037336-31037358 ATGGATGGTAATTGAAATCATGG - Intergenic
1022620703 7:31981057-31981079 CAATATGGTAAGTGAAATGATGG - Intronic
1022656171 7:32321197-32321219 CTGTATCACAAAAGAAATGAGGG - Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1023789230 7:43738615-43738637 CTATATCGTAACTGAAAAGACGG - Intergenic
1027931417 7:84539791-84539813 CTGTATTGTGATTTAGATGAAGG - Intergenic
1028064447 7:86364844-86364866 CTGTACCTTAATTGTAATGATGG + Intergenic
1030155009 7:106445891-106445913 CTGTATCTTAATTGTGGTGATGG - Intergenic
1030240894 7:107323051-107323073 CTATATCTTAATTGTAATGATGG + Intronic
1033969643 7:147024264-147024286 CTATATCGCAATTGCAATGGTGG + Intronic
1035416352 7:158691733-158691755 CTGTATTGAAATTTAAATGATGG - Intronic
1042272091 8:66964863-66964885 CTGTATCTTTATTGCATTGATGG - Intronic
1043207260 8:77461946-77461968 CAGTATCCTAATTGAAGTAAGGG + Intergenic
1043820782 8:84860517-84860539 TTGTTTTGTGATTGAAATGAGGG + Intronic
1051910017 9:22142884-22142906 CTGTACCATAATAGAATTGAGGG + Intergenic
1052810273 9:33052039-33052061 CTGTATCCTGATTGTAATGGTGG + Intronic
1053599359 9:39594351-39594373 CTGTATCATCATTGAGATGCAGG + Intergenic
1053649842 9:40156146-40156168 CTGTAACTTAATTGTAATAATGG + Intergenic
1053755906 9:41307796-41307818 CTGTAACTTAATTGTAATAATGG - Intergenic
1054330351 9:63747908-63747930 CTGTAACTTAATTGTAATAATGG + Intergenic
1054534739 9:66220057-66220079 CTGTAACTTAATTGTAATAATGG - Intergenic
1054867095 9:70013884-70013906 CTGTGTTGTGGTTGAAATGATGG - Intergenic
1059722377 9:116973511-116973533 CTGAATCTTCATTGAAATCATGG + Intronic
1202797729 9_KI270719v1_random:140797-140819 CTGTAACTTAATTGTAATAATGG + Intergenic
1203724560 Un_GL000216v2:39259-39281 CTGTAACGGAATGGAATTGAAGG - Intergenic
1189731380 X:44024643-44024665 CTTTATAGAAATTGAAGTGAAGG + Intergenic
1192103235 X:68287945-68287967 CTGTATGTTAATTGAAAGTAAGG - Intronic
1193011849 X:76685298-76685320 ATGTATCCAAATTGAAAAGAAGG - Intergenic
1193348347 X:80429836-80429858 CTATCTCGTAATTCAATTGAGGG - Intronic
1197221923 X:123922449-123922471 CTGTATTGTATTTGGAATCAGGG - Intergenic
1197230266 X:123996470-123996492 CTATATCTTAATTGTAGTGATGG - Intronic
1198320959 X:135518715-135518737 TTGTATCGGAATGGAAATGGGGG + Intergenic
1199041716 X:143122114-143122136 CTTTATCATAAGTGAAATAAGGG - Intergenic
1199849573 X:151715759-151715781 CTGTTTCTTCATAGAAATGATGG + Intergenic