ID: 911039673

View in Genome Browser
Species Human (GRCh38)
Location 1:93582024-93582046
Sequence GAGGGATGGCAGGCTGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 504}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911039673_911039680 18 Left 911039673 1:93582024-93582046 CCGGCAGCAGCCTGCCATCCCTC 0: 1
1: 0
2: 6
3: 34
4: 504
Right 911039680 1:93582065-93582087 TAAGCTTCCTGCTTGGGCAAAGG 0: 1
1: 0
2: 1
3: 13
4: 159
911039673_911039679 12 Left 911039673 1:93582024-93582046 CCGGCAGCAGCCTGCCATCCCTC 0: 1
1: 0
2: 6
3: 34
4: 504
Right 911039679 1:93582059-93582081 ATTTTATAAGCTTCCTGCTTGGG No data
911039673_911039678 11 Left 911039673 1:93582024-93582046 CCGGCAGCAGCCTGCCATCCCTC 0: 1
1: 0
2: 6
3: 34
4: 504
Right 911039678 1:93582058-93582080 AATTTTATAAGCTTCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911039673 Original CRISPR GAGGGATGGCAGGCTGCTGC CGG (reversed) Intronic
900118765 1:1039857-1039879 GAGCGATGGGAGGCTGCAGAAGG + Intronic
900119409 1:1042119-1042141 TGGGGATGGCACGCTGCTGCCGG - Exonic
900236776 1:1596858-1596880 GAGGGAGGGGAGGCTCCTCCAGG + Intergenic
900390482 1:2431807-2431829 GAGGGAGGGCAGTCTTGTGCTGG + Intronic
901233070 1:7652012-7652034 GAGGGATGGCAGGGGGCTGAGGG - Intronic
901674455 1:10874843-10874865 AGGGGAGTGCAGGCTGCTGCTGG + Intergenic
901821552 1:11833598-11833620 GGAGGATGGCAGACTCCTGCGGG - Exonic
902360001 1:15937229-15937251 GAGGGCGGGCAGGGTGGTGCAGG - Exonic
902622899 1:17660673-17660695 GAGGGATGCCAGCCTCCTGAAGG + Intronic
902777823 1:18685881-18685903 GATGGATGGAAGGTTGCTGGGGG - Intronic
902896238 1:19482057-19482079 GAGGGAGGGCAGGCTTCTAACGG + Intronic
902954017 1:19912238-19912260 GATGGCTGGCAGCCTGCCGCAGG - Exonic
903822196 1:26111443-26111465 GAGGGAGGGGAGGCCGCGGCCGG + Intronic
904002892 1:27348927-27348949 CAGGGCTGGCAGCCAGCTGCAGG - Intronic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
906203145 1:43972601-43972623 GGGGGATGGGAGGTTGGTGCAGG - Exonic
906291340 1:44621480-44621502 GAGGGAGGGGAGGTTGCTACTGG - Intronic
906507527 1:46391152-46391174 GAGGGATGGAAGTCGGCGGCGGG + Intergenic
908806255 1:67936352-67936374 GTGGGAAGGCAGGCTGCGGCAGG + Intergenic
909222645 1:72983233-72983255 GAGGAATCCCGGGCTGCTGCGGG + Intergenic
909481508 1:76132321-76132343 GAGGGAAGGCAAGCTGCTGCTGG - Intronic
911039673 1:93582024-93582046 GAGGGATGGCAGGCTGCTGCCGG - Intronic
912468053 1:109887480-109887502 GAGGGCTGGCAGCCTCCTGTGGG - Intergenic
913247029 1:116879080-116879102 GAGGGAGGGCAGGCAGCTGCTGG - Intergenic
913470780 1:119183097-119183119 GAGGGTTGGAAGTCAGCTGCGGG + Intergenic
913502432 1:119483475-119483497 TAGGTGTGGAAGGCTGCTGCTGG - Intergenic
913510233 1:119554637-119554659 TAGGTGTGGAAGGCTGCTGCTGG - Intergenic
913514058 1:119587751-119587773 TAGGTGTGGAAGGCTGCTGCTGG - Intergenic
913517744 1:119618736-119618758 TAGGTGTGGAAGGCTGCTGCTGG - Intergenic
915080075 1:153345912-153345934 TTGGGATGGAAGGCTGGTGCTGG - Intronic
915102022 1:153507612-153507634 GAGGGATGGCAGGGGGCAGCAGG - Intergenic
916439214 1:164806415-164806437 GAGGGATGTCAAGCTGTTGGGGG + Intronic
918241994 1:182628872-182628894 GAGGGAGGCCAGGGTGCTGTTGG - Intergenic
920764771 1:208821667-208821689 AAGGGAAGGCAGGCTGCTGCTGG + Intergenic
920987744 1:210906337-210906359 AGGGGATGGCAAGATGCTGCTGG + Intronic
921054252 1:211532147-211532169 GAGGGACAGCAGGTTGCTGAAGG + Intergenic
922639675 1:227216384-227216406 CAGGAATGCCATGCTGCTGCAGG + Intronic
922835027 1:228620939-228620961 GAGCGGTGGGATGCTGCTGCCGG + Intergenic
922890587 1:229058792-229058814 GAGGGCTGGGAGGCTCCCGCTGG - Intergenic
923107384 1:230865198-230865220 GAGGGGTGGCACCTTGCTGCTGG + Intronic
923526720 1:234778562-234778584 TGGGGCTGGCGGGCTGCTGCTGG + Intergenic
924454086 1:244204226-244204248 CAGGCAGGGCAGGCTGCTGTAGG - Intergenic
1063212404 10:3892951-3892973 GGTGGAGGGCAGGCTGCTGGAGG - Intergenic
1063264601 10:4434169-4434191 GTGGCATGGCAGCCTTCTGCAGG - Intergenic
1063434564 10:6019740-6019762 GAGGGAGAGGAGGCTGCTGTGGG + Intronic
1063591503 10:7400028-7400050 GAGGAATGGGAGGCTCCTCCAGG + Intronic
1065353014 10:24812316-24812338 GAGAGATGGCAAGCGGCTGAGGG + Intergenic
1066673014 10:37859424-37859446 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1067667913 10:48294247-48294269 GAGGCATTGCACACTGCTGCAGG + Intergenic
1069400156 10:68035815-68035837 CAGGGAAGGAAGGCTCCTGCTGG - Intronic
1069678891 10:70269755-70269777 GAGGGTTGGGAGGCTGAGGCAGG - Intronic
1069914825 10:71780995-71781017 GACGGATGGAGGGCTGCAGCAGG + Intronic
1070562883 10:77581191-77581213 CATGGATGGCAGGCAGGTGCTGG - Intronic
1070660392 10:78301677-78301699 GTGGGAAGGCAGGCTCCTCCAGG - Intergenic
1070693623 10:78545491-78545513 AAGGGTTGGCAGGAAGCTGCTGG + Intergenic
1070725341 10:78783901-78783923 GAGGCAGGGCAGGCTGGGGCAGG - Intergenic
1070776529 10:79113103-79113125 AAGGCAGGCCAGGCTGCTGCGGG - Intronic
1070797423 10:79224724-79224746 GGGGAAGGCCAGGCTGCTGCAGG + Intronic
1071129051 10:82370366-82370388 GAGGGATGTCTGGATGCTGAGGG - Intronic
1071331537 10:84565537-84565559 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1071343384 10:84668331-84668353 GAGGGAAGGCAGGCTGGGGGTGG - Intergenic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071608138 10:87012088-87012110 GTGGCATGGCAGGCTGAGGCAGG + Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072378559 10:94841359-94841381 GAGGGATGGAAGTCTGCAGCGGG + Intronic
1072650314 10:97290270-97290292 GAGGGATGGGAGTCAGCAGCGGG - Intronic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1074689926 10:115995108-115995130 AAGGGAAGGCAGGCATCTGCAGG - Intergenic
1075815940 10:125264920-125264942 GAGGGATCACAGGCAGCTGGGGG + Intergenic
1076030332 10:127152445-127152467 GTGCCATGCCAGGCTGCTGCAGG + Intronic
1077382485 11:2250682-2250704 AAGGGAAGGCAGGCGCCTGCAGG + Intergenic
1077938726 11:6817830-6817852 GAGGCATGGCAGAAGGCTGCAGG + Intergenic
1078358721 11:10652087-10652109 GGGGCATGGCAGCCTCCTGCTGG + Exonic
1078867912 11:15315310-15315332 GAGGGATGGGAGGCTGGGGGAGG + Intergenic
1079353500 11:19712824-19712846 AGGGGAGGACAGGCTGCTGCCGG - Intronic
1079692846 11:23441412-23441434 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
1080348387 11:31353312-31353334 TATGTATGGCAGGCTGCTTCAGG - Intronic
1080704861 11:34681031-34681053 GAGGGATGGGAGGCGGCTCTAGG - Intergenic
1081069736 11:38595832-38595854 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1081283902 11:41245424-41245446 AAGGCATGGCAGGCAGCTCCAGG + Intronic
1082001225 11:47394697-47394719 GAGGGATGGTGGCCTGCTGTGGG + Intergenic
1083343082 11:61971495-61971517 GAGGGAAGTCGGTCTGCTGCAGG + Intergenic
1083613197 11:64014139-64014161 GAGGAAGGGCAGGGTGCTGTGGG + Intronic
1083769595 11:64859082-64859104 GAGCGAGCACAGGCTGCTGCGGG - Intronic
1084004271 11:66314963-66314985 GAGGGATGACCGGTGGCTGCTGG - Exonic
1084097002 11:66918041-66918063 GAGGGCTCACAGGCTGCTGTGGG - Intronic
1084674212 11:70624711-70624733 GGGAGAGGCCAGGCTGCTGCTGG + Intronic
1084683240 11:70679364-70679386 GGGGGCTGGCTGGCTGCTGGTGG - Intronic
1084739770 11:71132086-71132108 GAGGCAGGTGAGGCTGCTGCCGG + Intronic
1084755854 11:71238088-71238110 AAGAGCTGGGAGGCTGCTGCTGG + Intronic
1085228363 11:74943005-74943027 GAGGGAGGGCAGGCTCCTTCAGG + Intronic
1085328640 11:75628256-75628278 GAGGGACTGCAGGATGCTGGGGG + Intronic
1085601989 11:77863309-77863331 GAGGGATGGAAGTCAGCAGCGGG + Intronic
1086892188 11:92271064-92271086 CAGGGCTTGGAGGCTGCTGCAGG - Intergenic
1089100925 11:115961795-115961817 AAGGCCTGGCAGGCTGCCGCAGG - Intergenic
1089459103 11:118642329-118642351 GAGTGAGGGGAGGCTGCAGCGGG - Exonic
1090628719 11:128627737-128627759 GAGGGCTGGCATGCTCCTTCTGG - Intergenic
1090636228 11:128692229-128692251 GAGGGCAGGCAGCCTGCCGCGGG + Intronic
1091857861 12:3753416-3753438 GAGTGACGCCGGGCTGCTGCCGG - Intronic
1092014402 12:5145830-5145852 TGGGGAGGGCAGGCTGCTTCAGG - Intergenic
1092489498 12:8932642-8932664 GGTGGATGGCAATCTGCTGCTGG - Exonic
1092996915 12:13959354-13959376 GAGGGAGGTCAGGCTGCAGAGGG + Intronic
1093683516 12:22030399-22030421 GAGGGATGTCTGGATGCTGAGGG + Intergenic
1095194133 12:39292839-39292861 GAGGGTTGGGAGGGTGCTTCTGG - Intergenic
1095509425 12:42933986-42934008 GAGAGCTGGCTGACTGCTGCAGG + Intergenic
1095552475 12:43459199-43459221 GAGGGATGGAAGTCAGCAGCAGG - Intronic
1095893109 12:47253029-47253051 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1096113398 12:49041556-49041578 TAGGGCAGTCAGGCTGCTGCAGG + Intronic
1096939396 12:55325689-55325711 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1096946436 12:55413530-55413552 GGTGGATGGCAATCTGCTGCTGG + Intergenic
1097629510 12:62042891-62042913 GAGGAAAGGCAGGGTGCTGACGG - Intronic
1098486677 12:71029482-71029504 CAGGGCTGGCATGCTGGTGCTGG - Intergenic
1100814688 12:98375022-98375044 GAGGGATGGCGGACAGCTGAAGG - Intergenic
1103395527 12:120604035-120604057 CATGGCTGGCAGGCTGGTGCTGG + Intergenic
1104187865 12:126449641-126449663 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1104614533 12:130256927-130256949 CAGGGCTGGCCGGCTGCTCCGGG + Intergenic
1104713018 12:130998060-130998082 CAGGCATGGCAGGCTGAGGCAGG + Intronic
1104766056 12:131331052-131331074 GATGGATGGATGGATGCTGCTGG - Intergenic
1104877263 12:132044236-132044258 GAGGGAGGCCCGGCTGCGGCTGG + Exonic
1104981242 12:132573939-132573961 GAGGGAGGGCAGGCTGTCCCTGG + Intronic
1105825492 13:24119042-24119064 GAGCGGTGGCAGGCGCCTGCAGG - Intronic
1105837560 13:24224297-24224319 GAGGGGTGGGAGGCTGCTCAGGG - Exonic
1106226292 13:27789678-27789700 GCGGGGTGGGAGGCGGCTGCCGG - Intergenic
1106606234 13:31231792-31231814 GAGAGTTGGCAGGCTGTTGCTGG + Intronic
1107156426 13:37172374-37172396 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1108854439 13:54775586-54775608 TGGGGATGGCAGGCTGATGGTGG - Intergenic
1109594004 13:64525854-64525876 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1109599943 13:64612619-64612641 GGGGGATGGCTGGCGGCTGGCGG - Intergenic
1109680715 13:65748439-65748461 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1109931298 13:69222044-69222066 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
1110608516 13:77461978-77462000 GAGGGAAGGAAGGCAGCTGTGGG - Intergenic
1110938573 13:81321407-81321429 GAGGGATGGGAGGCTGAGGTGGG - Intergenic
1110987074 13:81984411-81984433 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1112573168 13:100612081-100612103 GAGGCCGGGCAGGCTGGTGCAGG - Intronic
1113420213 13:110165266-110165288 GAGGGCTGGCATGAGGCTGCAGG - Intronic
1114254325 14:20988807-20988829 GAGAGCTGGCAGGCTGCAGTCGG + Intergenic
1114383852 14:22236765-22236787 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1114384827 14:22243812-22243834 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1114722604 14:24898390-24898412 AAGGGATGGCTGGGTGCGGCGGG + Intronic
1115282666 14:31681940-31681962 GATGGATCGCATGCTGGTGCTGG - Intronic
1116118805 14:40694723-40694745 GAGGGATGGGAGTCAGCGGCGGG + Intergenic
1117171812 14:53108157-53108179 GAGGGATGGAAGTCAGCGGCAGG - Intronic
1117740765 14:58816924-58816946 GAGGCATAGCAGGCCTCTGCTGG - Intergenic
1118321995 14:64758744-64758766 GAGGGATGGCCAGATGCTGCTGG + Intronic
1118602529 14:67480728-67480750 CAGTCATGTCAGGCTGCTGCAGG - Intronic
1119175090 14:72562949-72562971 GAGGGATGACAGGCGGCGGTGGG - Intronic
1119197904 14:72731323-72731345 GAGGGATGGCTGGGCACTGCTGG + Intronic
1119397521 14:74338305-74338327 GAGGGCTGTCAGGCTGATGCTGG - Intronic
1120318677 14:82930814-82930836 GAGGGATGGGAGGCTAGTGGAGG + Intergenic
1121006963 14:90496569-90496591 GGGGGATGGCAGGCTGAGCCAGG - Intergenic
1121344983 14:93129027-93129049 CAGGCAGGGCTGGCTGCTGCTGG - Intergenic
1121642856 14:95497614-95497636 GAGGGTTGGCAGACTGTTTCTGG + Intergenic
1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG + Intronic
1122505246 14:102227756-102227778 GAGGGAGGGCAGGCTGGAGGAGG - Intronic
1122717491 14:103704264-103704286 AAGGGGAGGCAGGCTGCTGGGGG + Intronic
1122819754 14:104335494-104335516 GAGGGAGGGCAGTTTGGTGCGGG - Intergenic
1123041949 14:105493936-105493958 GAGGGCGGGCAAGCTGCTGCGGG + Intronic
1123045602 14:105512149-105512171 GAGGGAGGGAAAGCTGCAGCTGG - Intergenic
1202928377 14_KI270725v1_random:15159-15181 GAGGGAATGCAGGCTGCTTTGGG + Intergenic
1125089628 15:35774939-35774961 GTTGGAGGGCAGGCTGCTCCCGG - Intergenic
1126177066 15:45745707-45745729 CAGGGAAGGTAGGTTGCTGCTGG + Intergenic
1126728339 15:51655603-51655625 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1126979533 15:54226705-54226727 GAGGCAGGGCAGGCAGCTCCAGG + Intronic
1127074516 15:55312204-55312226 GAGGGATGGAAGTCAGCGGCGGG + Intronic
1127810190 15:62559145-62559167 GAGGGAAGTCAGGCTGCTGGAGG - Intronic
1127996913 15:64158515-64158537 TAGGGCAGGCAGGCTGCTGGGGG - Intronic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129170344 15:73803761-73803783 AAGGGTTTGCAGTCTGCTGCTGG - Intergenic
1129234148 15:74213799-74213821 GGGGGAAGGGAGGCTGCTGCAGG + Intergenic
1129607968 15:77034069-77034091 GAGGGAGGCCTGGCTGCTGGAGG + Intronic
1129661393 15:77554858-77554880 GAGGGAGGAGGGGCTGCTGCTGG + Intergenic
1129776375 15:78239296-78239318 GACGGATGGCAGTCAGCAGCGGG + Intronic
1130577674 15:85106749-85106771 GATGAAAGGCAGGCTGCTGCAGG + Intronic
1131220947 15:90583623-90583645 TAGTGCTGGCAGGCTGCTGGGGG + Intronic
1131571743 15:93544364-93544386 GAGGGAAGGCAGGCCTCTGTTGG + Intergenic
1134388345 16:13795086-13795108 GATGGTTGGCTGGCTGCAGCAGG + Intergenic
1134452787 16:14373669-14373691 GGGGGAAGGCAGGGAGCTGCTGG - Intergenic
1135033917 16:19060745-19060767 GTGGGATGGGAAGCTGCTGAAGG + Intronic
1136097622 16:27968679-27968701 GAGAGCTGGGAGCCTGCTGCAGG - Intronic
1138411184 16:56841620-56841642 GAGGGAGGGTGGGCTGCTCCAGG - Intronic
1138917271 16:61481500-61481522 GACCTATGTCAGGCTGCTGCTGG + Intergenic
1139594863 16:67951604-67951626 TGGGGAAGACAGGCTGCTGCAGG + Intronic
1139659570 16:68411510-68411532 GAGGGATGGGAGGGTGATGGAGG + Intronic
1139963281 16:70730161-70730183 GGGGGATGGGAAGCTGCAGCCGG - Intronic
1140753311 16:78045869-78045891 GAGGGATGGAATGCTGCCCCGGG + Intronic
1141535474 16:84676799-84676821 AAGGTATGGCCGGGTGCTGCTGG + Intergenic
1141897057 16:86964913-86964935 GAGGGAGGGCAGGCAGGGGCCGG - Intergenic
1142557582 17:790243-790265 CAGGCGTCGCAGGCTGCTGCCGG + Intronic
1142594496 17:1022942-1022964 TGGGGAAGGCAGGTTGCTGCGGG - Intronic
1142708311 17:1710006-1710028 GAGGGGTGGGAGGCTGAGGCCGG - Intronic
1143118832 17:4595181-4595203 GAGTTATGGCTGGCGGCTGCGGG - Exonic
1143907982 17:10225086-10225108 CAGGGATGCCAGTCTGCAGCTGG + Intergenic
1144161424 17:12564169-12564191 GAGGGAAGAGAGGCTGGTGCTGG + Intergenic
1144261124 17:13521942-13521964 GAGGGAAGGGAGGTTGCTACTGG - Intronic
1144698467 17:17321579-17321601 GAGAGCTGCCAGGCAGCTGCAGG + Intronic
1145124249 17:20287018-20287040 GAGGCAGGGGAGGCTGCTGACGG - Intronic
1146017608 17:29246659-29246681 TGGGCATGGCTGGCTGCTGCAGG - Intergenic
1146356001 17:32134870-32134892 GAGGGATGGCAGGGTGGGGGTGG + Intergenic
1147168311 17:38604830-38604852 TAGGGAAGGCAGGCGGCTGAGGG - Intronic
1147448084 17:40487229-40487251 GATGGATGGGGGGCAGCTGCTGG + Exonic
1147651997 17:42068062-42068084 CAGGCAGGGCAGGCTGCAGCAGG - Intergenic
1148135625 17:45290010-45290032 CTGGGGCGGCAGGCTGCTGCAGG - Intronic
1148344786 17:46895903-46895925 GAGGGGTGGGAGCCTGGTGCTGG + Intergenic
1148909139 17:50931201-50931223 GAGGGAGGGCGGGCTGAGGCGGG - Intergenic
1149274554 17:55018326-55018348 GAGGGATGGAAGTCAGCAGCGGG + Intronic
1149449654 17:56739728-56739750 GAGGGATGGGAGGCTGATTTAGG - Intergenic
1151235038 17:72713749-72713771 GAGGGATGGCAGGGAGGTGATGG - Intronic
1151852366 17:76698418-76698440 CAGGGAGGGCAGGCTGGGGCAGG + Intronic
1151990387 17:77570655-77570677 GAGGAGTGGGAGGCTGCTACTGG + Intergenic
1152040828 17:77901638-77901660 GCGGGCTGGCTGGCAGCTGCTGG - Intergenic
1152302603 17:79503991-79504013 GCGGGGTGGCAGGGTGCTCCAGG + Intronic
1152456923 17:80422010-80422032 GGGGGAGGGAAGGCTGCTGCAGG + Intronic
1152573074 17:81128944-81128966 GTGGGATGCCAGCCTGCGGCAGG - Intronic
1152717582 17:81907360-81907382 GAGGGAGGGCAGGCGGGTGGTGG - Intronic
1152785169 17:82244009-82244031 TAGGGACCGCAGGCTGCCGCGGG - Exonic
1153783639 18:8515553-8515575 GAAGGATGGCAGGCTGTGCCAGG - Intergenic
1154322668 18:13367612-13367634 GAGGGTGGGCAAGCAGCTGCAGG + Intronic
1155314862 18:24561607-24561629 TAATGATGGCAGGCAGCTGCTGG - Intergenic
1155384845 18:25266591-25266613 GACGGAGGGCAAGCTGATGCAGG + Intronic
1157131656 18:45013170-45013192 CAGGAATGGCAGGAGGCTGCAGG - Intronic
1157934627 18:51859335-51859357 GAGGGTAGGCTGGCTGCTGTTGG - Intergenic
1158470803 18:57735226-57735248 GAGGGATGGAAGTCAGCGGCGGG - Intronic
1159276122 18:66223468-66223490 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1160051844 18:75440977-75440999 GAGGGATGGAGGGTTGCAGCGGG + Intergenic
1160546108 18:79657093-79657115 GAGGGATGGCAGGATGGAGATGG + Intergenic
1160812208 19:1017725-1017747 GAGAGCGGGCAGGCTGCTCCTGG - Intronic
1160873180 19:1286116-1286138 GAAGGCTGGCAGGCGGCGGCCGG + Intergenic
1161154867 19:2727354-2727376 GAGGGAGCACAGGCTGCTGCAGG - Intronic
1161322346 19:3647064-3647086 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322368 19:3647136-3647158 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322377 19:3647170-3647192 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322393 19:3647220-3647242 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161322404 19:3647258-3647280 GAGGGATGGGAGGAGGGTGCAGG + Intronic
1161391517 19:4023681-4023703 GAGGTATGGCAGTGTCCTGCTGG + Intronic
1161849847 19:6732587-6732609 GAGGGGTGGGAGGCTGATGGTGG + Intronic
1163125631 19:15242960-15242982 GAGGCTTGGCAGGCTGCGGCGGG + Exonic
1163196242 19:15723178-15723200 GAGAGGTGGCAGGCGGATGCAGG + Intergenic
1163767428 19:19171207-19171229 GAGGGATGGGAGGCTGGGACAGG + Intronic
1164561641 19:29296437-29296459 GAGAGATGCCTGGCTGCTGATGG + Intergenic
1164742599 19:30587578-30587600 GAGTGATGGCATGCTGGAGCAGG - Intronic
1165213834 19:34255012-34255034 GAGGGAGGGCGGCCTGCTGGCGG + Intronic
1165869925 19:38964445-38964467 AAGGGATGGGAGGCTGAGGCAGG - Intronic
1165994423 19:39833887-39833909 GGGGGGTGGCAGGCAGGTGCGGG - Intronic
1166262176 19:41647965-41647987 GAGAGATGGAAGGCTGCTATTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167125516 19:47545758-47545780 CAGGGACCGCAGGCTGCTGGGGG + Exonic
1168638383 19:58013693-58013715 GAGGGAACTCAGACTGCTGCTGG - Intergenic
927075932 2:19577620-19577642 AAAGGATGGCAGGATGATGCAGG + Intergenic
928112479 2:28521933-28521955 CAGGGAGTGCAGGCTGCTGCAGG - Intronic
928314800 2:30236818-30236840 GAGGGAGGGCAGACTGGGGCTGG + Intronic
928319124 2:30269293-30269315 GAGGGATGGAAGTCAGCGGCGGG - Intronic
928437837 2:31267183-31267205 GAGGGCAGGCGGGCAGCTGCAGG + Exonic
928444133 2:31318126-31318148 GCAGGATGGCTTGCTGCTGCAGG - Intergenic
929542359 2:42832127-42832149 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
929570798 2:43021865-43021887 GCTGGATGGCAGGCGGCGGCGGG - Intergenic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
932496430 2:72147914-72147936 GGGGGAGGGGAGGCTGCGGCCGG + Exonic
933328831 2:80871720-80871742 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
933500207 2:83101797-83101819 GAGGGATGGGAGTCAGCAGCAGG - Intergenic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934657436 2:96123497-96123519 GAGGGATTCCAGGGTTCTGCGGG + Intergenic
936477788 2:112855073-112855095 GAGGCATGGGAGGCTGAGGCAGG - Intergenic
936622673 2:114116832-114116854 GAGGGAAGCCAGGCTGTGGCTGG + Intergenic
936701744 2:115019038-115019060 GAGGGGTGGCAGGTGGGTGCTGG - Intronic
938407721 2:131041781-131041803 CAGAGATGGAAGGCTGCTGCAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938730543 2:134143625-134143647 GAGGGGTGGAAGGGTGGTGCTGG + Intronic
938746863 2:134287514-134287536 GAGTGAGGGCTGGCAGCTGCTGG + Intronic
938760389 2:134420424-134420446 GACTGATGACGGGCTGCTGCTGG + Intronic
940883269 2:158968369-158968391 GAGGGATGGTAGGGTGCTTCAGG + Intergenic
941003046 2:160221424-160221446 GAGAGATGGCTGGCTGCTGCTGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
942679489 2:178462568-178462590 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
943019258 2:182552933-182552955 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
944216844 2:197264691-197264713 CAGAGATGGCAGGATGCTCCTGG + Intronic
945395001 2:209306618-209306640 GAGGGATGGAAGTCAGCGGCCGG - Intergenic
946180712 2:217947289-217947311 GAGGGAGGGCAGGAGGCTGAAGG + Intronic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946228535 2:218277711-218277733 GAAGGAAGGCAGGGTGCTGGGGG + Intronic
946309687 2:218876469-218876491 GAGGGGTGTCAGGCTGCAGTGGG + Intergenic
946461146 2:219869997-219870019 CAGGGATGTCAGGCTTCTGCTGG + Intergenic
946551896 2:220810825-220810847 CATGGCTGGCAGGCTGATGCTGG + Intergenic
947527152 2:230885680-230885702 CAGGGATGGCAGGAAGCTGTAGG + Intergenic
947777790 2:232728120-232728142 GAGGGAGGTCAGGCTTCTGGGGG + Intronic
1169195498 20:3680322-3680344 GGGGGAAGGAGGGCTGCTGCAGG - Intronic
1169254106 20:4084176-4084198 TAGGGATGGCAGGAGGCAGCAGG + Intergenic
1169278648 20:4249454-4249476 GAGGCGTGGGTGGCTGCTGCGGG - Intergenic
1170780610 20:19422318-19422340 GAGAGAGGGCAGGCTGCTACTGG + Intronic
1171500791 20:25591460-25591482 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171990661 20:31694060-31694082 GTGGGAGGGCAGGCAGCAGCTGG + Intronic
1172556831 20:35849452-35849474 GAGGCAGGGCAGGATGGTGCAGG + Intronic
1172830984 20:37834215-37834237 GAGGGAGGGCTGGGTGCTGGTGG - Intronic
1173202052 20:40961468-40961490 GAGGGCTGAGAGGCTGCTGAGGG - Intergenic
1173340685 20:42150108-42150130 GAAGGATGGCAAGCTTCTGTTGG - Intronic
1173374732 20:42473165-42473187 GAGGGATGGAAGACTGTTGTAGG - Intronic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1174551548 20:51366137-51366159 GAGGGGTGGCAGGAGGCTGAAGG - Intergenic
1174607692 20:51772839-51772861 GATGGATGACAGGCTGGAGCCGG + Intergenic
1175144633 20:56886267-56886289 GAGGGGTGGGAAGCTGCTGGAGG + Intergenic
1175597496 20:60246996-60247018 GAGAGATGGCTGGCTTCTGCAGG + Intergenic
1176363990 21:6021581-6021603 CTGGGAGGGCAGGCTGCAGCCGG + Intergenic
1176590403 21:8643802-8643824 GAGGGAATGCAGGCTGCTTTGGG + Intergenic
1177263976 21:18760120-18760142 GAGGGATGGGAGTCAGCGGCAGG + Intergenic
1177531192 21:22360117-22360139 GAGGGATGGCAGTCAGCGGTGGG + Intergenic
1178429903 21:32509888-32509910 GAGGAATGGCAGGCTAGAGCGGG + Intronic
1178672055 21:34600154-34600176 GCTGGGTGGCATGCTGCTGCAGG + Intronic
1178737516 21:35166473-35166495 TAAGGATGGCAGGGTGCTGTTGG - Intronic
1178925715 21:36773351-36773373 GAGGGCTGGCAGTCTGCCACTGG + Intronic
1179189005 21:39107583-39107605 GAGGGAAGGCAGCCTGATGCTGG + Intergenic
1179536338 21:42055254-42055276 GAGGTATGACAGGCTGCAGATGG + Intergenic
1179759528 21:43516964-43516986 CTGGGAGGGCAGGCTGCAGCCGG - Intergenic
1180014923 21:45075333-45075355 GGGGGACGGCAGGCTGCGCCCGG + Intronic
1180036782 21:45254184-45254206 GAGGGGTTGCTCGCTGCTGCTGG + Intergenic
1180075112 21:45458114-45458136 GAGGGAGGGAGGGCTGCAGCGGG + Intronic
1180273233 22:10620835-10620857 GAGGGAATGCAGGCTGCTTTGGG + Intergenic
1180754028 22:18147897-18147919 CAGGGAGGGCAGGGTGCTGGTGG - Intergenic
1181277708 22:21697010-21697032 CAGGGATGACAGGCTGCAGAGGG - Exonic
1182452373 22:30429143-30429165 GTGGGATGCCAGGCACCTGCAGG - Intergenic
1182475027 22:30572633-30572655 GAGGGAAGGCAGGCATCTTCTGG + Intronic
1182895802 22:33858255-33858277 GAGGGATGGAAGTCAGCGGCAGG + Intronic
1184101742 22:42344530-42344552 GGGGTATGGCAGGCTGGGGCGGG - Intergenic
1184499553 22:44863533-44863555 GAGGAGTGGCAGGCCGCTGCAGG + Intergenic
1184993839 22:48188254-48188276 GAGGGATGGGAGGCAGAAGCTGG - Intergenic
1185031893 22:48448441-48448463 ATGGGAGGGCAGGCTGCTGTTGG - Intergenic
1185335236 22:50268316-50268338 GAGGGAGGCCCGTCTGCTGCAGG - Intronic
949136875 3:577873-577895 GAGGGAATGCAGGCTGCTTTGGG - Intergenic
949414201 3:3799186-3799208 AGGGGACGGCAGGCTGCGGCTGG - Intronic
949711661 3:6877468-6877490 AGGGGATGGCAGGTAGCTGCAGG - Intronic
949811671 3:8012939-8012961 GAGGGATGGAAGTCAGCCGCGGG + Intergenic
950107344 3:10396671-10396693 TGGGGGAGGCAGGCTGCTGCAGG + Intronic
950460760 3:13121008-13121030 AAGGGGTTGCAGGGTGCTGCTGG - Intergenic
950647441 3:14385686-14385708 GAGGAATGGCAGGAGGCTGAAGG - Intergenic
950663135 3:14479322-14479344 GAGGGGAGGAAGGCTGCTCCAGG + Intronic
951326072 3:21303102-21303124 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
951837646 3:27001168-27001190 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
957000504 3:74877912-74877934 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
957687045 3:83515320-83515342 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
958424505 3:93965303-93965325 GAGGGATGGGAGTCAGCAGCGGG - Intronic
958629245 3:96666801-96666823 GAGGGATGGTAGTCAGCAGCGGG + Intergenic
959597454 3:108143745-108143767 GAGGGAGAGCAGGCTGCCCCAGG + Intergenic
960965044 3:123098725-123098747 GAGGGATGGCTGGTTCTTGCAGG + Intronic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
962240940 3:133750416-133750438 GAGGGAAGCCAGGCTGCATCTGG - Intronic
962311709 3:134331510-134331532 CAGGGATGGAACTCTGCTGCAGG - Intergenic
962346187 3:134620466-134620488 GACAGAGGGAAGGCTGCTGCTGG + Intronic
963575888 3:147060182-147060204 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
963915313 3:150854403-150854425 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
966202726 3:177374692-177374714 GATGGATGGCAGGCTGTACCAGG + Intergenic
967784161 3:193471878-193471900 GTGGGGTGGCAGGCTGCTCTGGG + Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969685481 4:8671756-8671778 GAAGGATGGCAGAGGGCTGCAGG + Intergenic
970095528 4:12459578-12459600 CAGGGATGGAAGTCTGCGGCGGG - Intergenic
970738111 4:19198109-19198131 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
972462108 4:39314480-39314502 TAGGGGTGGCTGGCTGCTCCTGG - Intronic
972732037 4:41804229-41804251 AAAGAATGGCAGGCTGCTGCGGG - Intergenic
973245874 4:48010807-48010829 GAGGGATGGAAGTCAGCAGCAGG + Intronic
973634793 4:52852000-52852022 TAGGAATGGCAGGCTGGTGGTGG - Intergenic
974190092 4:58493391-58493413 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
975313225 4:72925995-72926017 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975983489 4:80183888-80183910 GAGCGACCGCCGGCTGCTGCCGG - Intronic
977087988 4:92628947-92628969 GTGGGGTGGCAGGTGGCTGCTGG + Intronic
978566241 4:110085237-110085259 GAGGGATGAGAGGCTGCTTCTGG + Intronic
979123453 4:116933287-116933309 GGGGGATGGGAGGCTGCGGGAGG - Intergenic
980190522 4:129519357-129519379 GAGGGATGGAAGTCGGCAGCAGG - Intergenic
980341201 4:131549393-131549415 GAGGGATGTCAAGAAGCTGCAGG + Intergenic
982203660 4:152981306-152981328 CAGGGATGTCAGGCTTCTGGTGG - Intergenic
982391055 4:154864099-154864121 GGGGAATGGCAGGCTGCCACAGG + Intergenic
983777796 4:171629912-171629934 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
985226358 4:187765549-187765571 GAGGGATGGGAGTCAGCAGCGGG - Intergenic
985499674 5:234874-234896 CAGGGATCACAGCCTGCTGCAGG - Intronic
985649410 5:1100375-1100397 GATAGATGACAGGCGGCTGCGGG - Intronic
985725328 5:1513124-1513146 GACCGATGGCAGGCAGGTGCCGG + Intronic
986736588 5:10672958-10672980 CAGGGATGGCAGGAAGCTGGAGG - Intergenic
986742439 5:10715727-10715749 GAGAAAGGGCAGGCTGCTGTAGG + Intronic
986803795 5:11289068-11289090 GGGGGATGGCAGGCTGCAAAAGG - Intronic
987508228 5:18800456-18800478 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
988936861 5:36092588-36092610 GAGCATTGCCAGGCTGCTGCTGG - Intergenic
992957330 5:81923201-81923223 GATGGATGCCAGGCAGCTGAGGG + Intergenic
993054986 5:82970956-82970978 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
993225645 5:85165358-85165380 GAGGGATGGGAGTCAGCGGCAGG - Intergenic
996321587 5:122222796-122222818 CAGGAATGGCAAGATGCTGCCGG - Intergenic
996953567 5:129156997-129157019 GAGTGATGGCTGGCTGCTCTGGG + Intergenic
997232481 5:132254757-132254779 CAGGGCTGGCAGGCTCCAGCAGG - Intronic
997695124 5:135855566-135855588 GAGGCATGGGAGGTTTCTGCAGG + Intronic
998251177 5:140554055-140554077 GGGGGATGACAGGCTGATGTAGG - Intronic
1000095453 5:157967402-157967424 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
1000853480 5:166369501-166369523 GAGTGAAGGCAGGCTGCCGGTGG - Intergenic
1000888175 5:166772263-166772285 CAGGGAAAGCAGGCTGCTGTGGG + Intergenic
1001035077 5:168291741-168291763 GAGGGACGGCACCCGGCTGCAGG + Intronic
1001450757 5:171822660-171822682 GAGGGAGGGCAGGCAGATGCAGG - Intergenic
1001971387 5:175957528-175957550 TGGGGATGGGAGGCTGGTGCAGG - Intronic
1002210425 5:177595703-177595725 CAGGGATGTGAGGCTGCTGTTGG + Exonic
1002210644 5:177596914-177596936 CAGGGATGTGAGGCTGCTGTTGG + Intergenic
1002229744 5:177754094-177754116 AAGGGATGACAGGCTGCACCTGG + Intronic
1002246055 5:177886249-177886271 TGGGGATGGGAGGCTGGTGCAGG + Intergenic
1002328631 5:178426601-178426623 GTGGGGTGGCAGGCTGCAGGGGG - Intronic
1002330515 5:178437461-178437483 GTGGCATGGGAGGCTCCTGCTGG - Intronic
1002837186 6:874828-874850 AAGGGAAAACAGGCTGCTGCTGG - Intergenic
1003154379 6:3578761-3578783 GAGGGTGGACATGCTGCTGCCGG + Intergenic
1003916590 6:10792356-10792378 CAGAGGAGGCAGGCTGCTGCTGG - Intronic
1004160805 6:13211259-13211281 GAGGGGTGGGAGGCTGGTGAGGG - Intronic
1004256413 6:14068840-14068862 GAGGGATGGAAGTCAGCGGCGGG - Intergenic
1005024310 6:21448068-21448090 GTGGGAAGGGAGGCTGCTCCGGG + Intergenic
1005273103 6:24187209-24187231 GAGGGATGGCTGGATGTGGCAGG + Intronic
1005816658 6:29558618-29558640 GAGGGATGGAAGTCAGCCGCGGG - Intronic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1006922263 6:37634744-37634766 GGGGGATGGGGGGATGCTGCTGG - Exonic
1007212412 6:40206072-40206094 CAGGAATGGCAAGATGCTGCGGG + Intergenic
1007399931 6:41597842-41597864 GAGGGGCAGCAGGCTGCTGGCGG - Exonic
1007551385 6:42732619-42732641 AAGGGGAGGCAGGCTGCTTCAGG + Intergenic
1009338651 6:62526312-62526334 CTGGGGTGGCAGGTTGCTGCTGG + Intergenic
1010985028 6:82413713-82413735 GAGGGGTCCCAGGCTGGTGCAGG + Intergenic
1011781150 6:90790706-90790728 GTGTGATGGCAGGCTGCTATAGG - Intergenic
1012433109 6:99186794-99186816 GAGGGATGGCATGCACCTGTTGG - Intergenic
1013108445 6:107046186-107046208 GAAGGAGGGCAGGCTACAGCAGG - Intronic
1016343649 6:143087535-143087557 GAGGGATGGAAGTCAGCGGCGGG + Intronic
1016504552 6:144764271-144764293 GACGGTTTGCTGGCTGCTGCAGG - Intronic
1017869004 6:158470213-158470235 GAGGGATGGGAGTCAGCGGCGGG + Intronic
1018252214 6:161882388-161882410 CAGGGAGGGGAGGCTGCGGCAGG + Intronic
1018373840 6:163192853-163192875 GAGTGATGGCTGCCTACTGCAGG - Intronic
1018700056 6:166419322-166419344 GAGGGAAGGGAGGCTGGTACAGG + Intronic
1018719286 6:166560680-166560702 GAGGGAGGGCAGGCACCAGCAGG + Intronic
1018760552 6:166891225-166891247 GAGGGATGGAAGTCAGCGGCGGG - Intronic
1019212845 6:170420471-170420493 GAGGGTTGCCAGGGTGCTGTGGG + Intergenic
1019469691 7:1212190-1212212 GAGGAATGGGAGGCTGAGGCGGG - Intergenic
1019523113 7:1469339-1469361 GAGGGTGGGCAGGCGGGTGCAGG + Intergenic
1021199303 7:17710502-17710524 CAGGGATGAAAGGCTGTTGCTGG - Intergenic
1021885339 7:25131920-25131942 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1021987291 7:26109068-26109090 GATGGATGGTCTGCTGCTGCGGG - Intergenic
1022989917 7:35696672-35696694 GAGGGATGGAAGTCAGCTGTGGG - Intergenic
1023253679 7:38291484-38291506 CAGGGAGGGCAGGCTCCGGCTGG + Intergenic
1023381180 7:39609885-39609907 CAGGCGGGGCAGGCTGCTGCAGG - Intronic
1024055077 7:45654964-45654986 GGGGGCTTGGAGGCTGCTGCAGG + Intronic
1026213084 7:68324142-68324164 GAGGGATGGGAGTCAGCAGCAGG - Intergenic
1028013988 7:85684138-85684160 GAGGGATGGAAGTCAGCTGCGGG - Intergenic
1028471199 7:91208391-91208413 GAGGGAGGGCTGCCTGATGCAGG + Exonic
1028587725 7:92468278-92468300 GAGGGATGGGAGTCAGCGGCGGG + Intergenic
1028589087 7:92477765-92477787 GAGGGATGGGAGTCAGCGGCAGG + Intronic
1028993390 7:97074823-97074845 GAGGGATGGAAGTCAGCAGCAGG - Intergenic
1029147853 7:98459272-98459294 GAGGCCTGGCTGGCTGCTTCGGG + Intergenic
1031299575 7:120047497-120047519 GAGGGATGGAAGGCAGTGGCGGG - Intergenic
1031742824 7:125455912-125455934 GAGGGATGGAAGTCAGCAGCGGG + Intergenic
1034104810 7:148481381-148481403 GATGGTTGGCAGGATGCTGGAGG - Intergenic
1034965010 7:155385379-155385401 GAGGGATGGAAGTCGGCGGCGGG + Intronic
1034968090 7:155403849-155403871 GAGGTATGGGAGGCTGCAGTGGG - Intergenic
1035010407 7:155710809-155710831 GGGGGATGCAAGGCTGCTACAGG + Intronic
1035021673 7:155804253-155804275 GAGGCGCGGCAGGGTGCTGCGGG - Intronic
1035915068 8:3610054-3610076 GAGGGAAGGCTGGGTGCTGTAGG - Intronic
1037738086 8:21582733-21582755 GAGGGAGGGCAGGATGTGGCTGG - Intergenic
1037748153 8:21662717-21662739 GAGACATGGCAGACTGCGGCTGG - Intergenic
1038642091 8:29337059-29337081 CAGGTAGGGCAGGCTGCTGGGGG + Exonic
1038688961 8:29743720-29743742 GAGAGATGGATGGCAGCTGCTGG + Intergenic
1039370121 8:36975796-36975818 GAGGGAAAGCAGTCTTCTGCTGG + Intergenic
1039888063 8:41666725-41666747 AGGGCCTGGCAGGCTGCTGCCGG - Intronic
1040530875 8:48265476-48265498 GAGGGCTGGCATGCTCCTGATGG - Intergenic
1040746196 8:50645035-50645057 GAGGGATGGCAGGGTGGCTCAGG - Intronic
1040935991 8:52782706-52782728 TAAGGAAGCCAGGCTGCTGCTGG - Intergenic
1041101289 8:54398656-54398678 GAGGGATGTAAGGCTGGAGCAGG - Intergenic
1043284897 8:78516338-78516360 GCGGGAGCGGAGGCTGCTGCTGG + Exonic
1044477717 8:92647637-92647659 GAGGGCTGGCTGGCTGCCTCTGG - Intergenic
1044849825 8:96417552-96417574 GAGGGAAGTCAGGCTGCAGAAGG - Intergenic
1044943271 8:97365357-97365379 GAGGGACGGGTAGCTGCTGCTGG - Intergenic
1045876988 8:106993080-106993102 GAAGGATGTCATGCTGCTCCAGG + Intergenic
1046037771 8:108864656-108864678 GATGTTTGGCAGGCTGCAGCTGG + Intergenic
1047326237 8:123838606-123838628 GAGTGATGCCAGACTCCTGCTGG + Intergenic
1049011408 8:139890068-139890090 GAGGGGTGCCTCGCTGCTGCTGG - Intronic
1049332744 8:142063833-142063855 GGGGGTTCCCAGGCTGCTGCCGG - Intergenic
1049562495 8:143318692-143318714 GAGGGCTGCCATGCTGGTGCTGG - Intronic
1049598204 8:143494343-143494365 GAGGGCTGGCGGGCTGCCACCGG - Intronic
1049600035 8:143503505-143503527 GGGGGATGGCTGGGTGCTGGGGG - Intronic
1049600110 8:143503727-143503749 GGGGGATGGCTGGGTGCTGGAGG - Intronic
1050319095 9:4432885-4432907 GAGGGATGGGAGGATGAGGCGGG - Intergenic
1051699192 9:19801389-19801411 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1051970174 9:22878044-22878066 GAGGGATGGAAGTCAGCGGCAGG + Intergenic
1052904106 9:33818144-33818166 GCGGGAGGGCAGGCTGCACCGGG + Intronic
1053134331 9:35640634-35640656 GAGGGATGGGAGTCAGCAGCAGG + Intronic
1053139395 9:35673476-35673498 GAGGTAGGGCAGGCTGCTAGGGG - Intronic
1055431340 9:76247191-76247213 GAGGGATGGAAGTCAGCGGCAGG + Intronic
1056791692 9:89629643-89629665 GCAGGAAGGCAGGGTGCTGCCGG + Intergenic
1057304147 9:93902786-93902808 GAGGGGTGGCAGGTTGGTGCAGG + Intergenic
1057351617 9:94303464-94303486 GAGGGAAGGCAGCCATCTGCAGG - Intergenic
1057546303 9:96022014-96022036 GAGGAAGGGAAGGCAGCTGCAGG - Intergenic
1059310989 9:113389091-113389113 GAGGGAGGTCAGGGTGCTGCAGG + Exonic
1059338578 9:113584238-113584260 CAGCGAGGGCAGCCTGCTGCAGG + Exonic
1060225448 9:121787316-121787338 TGGAGATGGCAGGCCGCTGCAGG - Intergenic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1061627277 9:131848494-131848516 GAGGGAAGGCAGGCTGCCGCTGG + Intergenic
1061630426 9:131868768-131868790 GGGAGATGGCGGGCAGCTGCTGG - Intronic
1061871788 9:133524788-133524810 GAGGAAGGCCAGGCTGCTGAGGG + Exonic
1061875848 9:133543600-133543622 GAGGGATGGCAGGCGGGTACTGG + Intronic
1062041697 9:134407368-134407390 GCTGGCTGGCAGGCTGCAGCGGG + Intronic
1062425842 9:136505822-136505844 GAGGCAGCGCAGGCTGCCGCAGG + Exonic
1062502547 9:136857627-136857649 AGGGGCTGGCAGGCTGATGCTGG + Intronic
1062710116 9:137970963-137970985 GAGGGAGGGCCAGATGCTGCAGG + Intronic
1203788404 EBV:140830-140852 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788448 EBV:140932-140954 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788492 EBV:141034-141056 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788536 EBV:141136-141158 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788580 EBV:141238-141260 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788624 EBV:141340-141362 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788668 EBV:141442-141464 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788712 EBV:141544-141566 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788756 EBV:141646-141668 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788800 EBV:141748-141770 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788844 EBV:141850-141872 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788888 EBV:141952-141974 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788932 EBV:142054-142076 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203788976 EBV:142156-142178 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789020 EBV:142258-142280 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789064 EBV:142360-142382 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789108 EBV:142462-142484 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789152 EBV:142564-142586 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789196 EBV:142666-142688 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789240 EBV:142768-142790 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789284 EBV:142870-142892 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789328 EBV:142972-142994 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789372 EBV:143074-143096 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203789416 EBV:143176-143198 GGGGGGTGGCCGGCTGCAGCCGG + Intergenic
1203620411 Un_KI270749v1:122467-122489 GAGGGAATGCAGGCTGCTTTGGG + Intergenic
1185871468 X:3668281-3668303 GAGTGAAGGCAGGCAGCTCCTGG - Intronic
1186673183 X:11787928-11787950 GAGGGCTACCCGGCTGCTGCTGG - Intergenic
1187613820 X:20971887-20971909 GAGGGATGGAAGTCAGCAGCGGG - Intergenic
1189094195 X:38120748-38120770 GGGGGAAGGCAGGCTGCTGGAGG + Intronic
1190266212 X:48828643-48828665 GAGGGAGGGCAGGATTTTGCCGG - Intergenic
1190576788 X:51847586-51847608 GTGAGATGGGAGCCTGCTGCTGG - Intronic
1191846375 X:65550672-65550694 AAGGGAGGGCAGGCTGCAGAGGG + Intergenic
1192246582 X:69378141-69378163 GCTGGAGGCCAGGCTGCTGCTGG - Intergenic
1193295493 X:79827537-79827559 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1194103278 X:89734556-89734578 GAGGGATGGAAGTCAGCGGCTGG + Intergenic
1195504976 X:105646494-105646516 GTGGGAAGGCAGACTGCTGTTGG + Intronic
1195584606 X:106551422-106551444 GAGGGATGGAAGTCAGCGGCAGG - Intergenic
1196287276 X:113897440-113897462 GAGGGATGGGAGTCAGCAGCAGG + Intergenic
1198566838 X:137913880-137913902 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1199268784 X:145858474-145858496 GAGGGATGGAAGTCAGCGGCGGG + Intergenic
1199368809 X:147020934-147020956 GAGGGATGGGAGTCAGCGGCGGG - Intergenic
1199895002 X:152119527-152119549 CAGGGTTGGCAGGGTGCTGGGGG + Intergenic