ID: 911044809

View in Genome Browser
Species Human (GRCh38)
Location 1:93619629-93619651
Sequence GCATGGGAGGGACCTCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 444}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911044809_911044820 23 Left 911044809 1:93619629-93619651 CCCTTCAGAGGTCCCTCCCATGC 0: 1
1: 0
2: 1
3: 20
4: 444
Right 911044820 1:93619675-93619697 CGGGCATCTGCGAGGCCCTCTGG No data
911044809_911044817 3 Left 911044809 1:93619629-93619651 CCCTTCAGAGGTCCCTCCCATGC 0: 1
1: 0
2: 1
3: 20
4: 444
Right 911044817 1:93619655-93619677 GTGCTGCAGAAATGGGCAGACGG 0: 1
1: 0
2: 4
3: 31
4: 325
911044809_911044818 4 Left 911044809 1:93619629-93619651 CCCTTCAGAGGTCCCTCCCATGC 0: 1
1: 0
2: 1
3: 20
4: 444
Right 911044818 1:93619656-93619678 TGCTGCAGAAATGGGCAGACGGG 0: 1
1: 0
2: 3
3: 25
4: 242
911044809_911044819 15 Left 911044809 1:93619629-93619651 CCCTTCAGAGGTCCCTCCCATGC 0: 1
1: 0
2: 1
3: 20
4: 444
Right 911044819 1:93619667-93619689 TGGGCAGACGGGCATCTGCGAGG No data
911044809_911044821 26 Left 911044809 1:93619629-93619651 CCCTTCAGAGGTCCCTCCCATGC 0: 1
1: 0
2: 1
3: 20
4: 444
Right 911044821 1:93619678-93619700 GCATCTGCGAGGCCCTCTGGAGG No data
911044809_911044815 -5 Left 911044809 1:93619629-93619651 CCCTTCAGAGGTCCCTCCCATGC 0: 1
1: 0
2: 1
3: 20
4: 444
Right 911044815 1:93619647-93619669 CATGCAGAGTGCTGCAGAAATGG No data
911044809_911044816 -4 Left 911044809 1:93619629-93619651 CCCTTCAGAGGTCCCTCCCATGC 0: 1
1: 0
2: 1
3: 20
4: 444
Right 911044816 1:93619648-93619670 ATGCAGAGTGCTGCAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911044809 Original CRISPR GCATGGGAGGGACCTCTGAA GGG (reversed) Intronic
900238319 1:1603042-1603064 GGCTGGGTGGGACCTCTGAGGGG - Intergenic
901161179 1:7177586-7177608 GTATGGGAGGGGCCTCGGTATGG - Intronic
901668188 1:10838387-10838409 GCCTGGGAGGGACCTGGGAGTGG - Intergenic
902112686 1:14095962-14095984 GCATAGGAGAGAGTTCTGAAAGG + Intergenic
904328667 1:29744130-29744152 GCATGGGAGGTGCCACTGCAGGG + Intergenic
906531111 1:46524629-46524651 GCATGGGAAGAAGCTCTGAATGG - Intergenic
906565209 1:46795288-46795310 GGATGGGAAGGACCTCTTCAAGG - Intronic
906574972 1:46880509-46880531 GGATGTGAAGGACCTCTTAAAGG + Intergenic
906917036 1:50023375-50023397 GCATGGGAGAGATCCCTAAAGGG - Intronic
908612946 1:65883353-65883375 GGATGTGAGGGACCTCTTCAAGG - Intronic
909200448 1:72685350-72685372 TCATGGGAGGGACCCATGGAAGG + Intergenic
909303716 1:74045901-74045923 GGATGTGAGGGACCTCTTCAAGG + Intronic
909739939 1:79015559-79015581 GGATGTGAAGGACCTCTTAAAGG - Intergenic
910531587 1:88242215-88242237 GCATGTGAAGGACCTCTTCAAGG + Intergenic
911044809 1:93619629-93619651 GCATGGGAGGGACCTCTGAAGGG - Intronic
911170161 1:94762911-94762933 GGATGTGAAGGACCTCTTAAAGG + Intergenic
911240256 1:95457577-95457599 GGATGTGAAGGACCTCTTAAAGG + Intergenic
911633077 1:100204397-100204419 GGATGTGAGGGACCTCTTCAAGG + Intronic
911823264 1:102446509-102446531 GGATGGGAAGGACCTCTTCAAGG + Intergenic
912684280 1:111749735-111749757 GCAGGGAGGGGAACTCTGAATGG - Intronic
913525914 1:119692791-119692813 GGATGGGAAGGACCTCTTCAAGG - Intronic
913593187 1:120349082-120349104 GCAGGAGAGGGATCTCTGGAAGG + Intergenic
913930902 1:124963536-124963558 GGATGTGAGGGACCTCTTCAAGG - Intergenic
914002872 1:143707419-143707441 GCAGGAGAGGGATCTCTGGAAGG - Intergenic
914094070 1:144529908-144529930 GCAGGAGAGGGATCTCTGGAAGG - Intergenic
914304456 1:146403998-146404020 GCAGGAGAGGGATCTCTGGAAGG + Intergenic
914515236 1:148368685-148368707 GCAGGAGAGGGATCTCTGGAAGG - Intergenic
914597600 1:149168830-149168852 GCAGGAGAGGGATCTCTGGAAGG - Intergenic
916560446 1:165930190-165930212 GCATGAGAGGGGCTTCAGAATGG + Intergenic
916993916 1:170275098-170275120 AAATGAGAGGGACATCTGAATGG - Intergenic
917158450 1:172029850-172029872 GCATGTGAAGGACCTCTTCAAGG + Intronic
917662025 1:177186213-177186235 GCATGGGAGGTATCCCTGAAGGG + Intronic
920081627 1:203378813-203378835 GTGTGGGAGGGGGCTCTGAAGGG - Intergenic
921221816 1:212978877-212978899 GGTTGGGAGGGAACTCTGGAGGG + Intronic
922147478 1:222962227-222962249 GGATGGGAAGGACCTCTTGAAGG + Intronic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
1062889784 10:1049381-1049403 CCATGGGAGCGACCTCCGCATGG + Intergenic
1062902173 10:1154741-1154763 GGATGGGAGGGACCTCCAAGGGG - Intergenic
1063905591 10:10777241-10777263 GCATGGGACAGAGCTCTGGATGG - Intergenic
1064904927 10:20335537-20335559 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1065230021 10:23588582-23588604 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1066487655 10:35862974-35862996 GGATGTGAAGGACCTCTTAAAGG + Intergenic
1067172176 10:43916495-43916517 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1068197005 10:53730122-53730144 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1068664725 10:59661441-59661463 GCATGTGAAGGACCTCTTCAAGG + Intronic
1068718544 10:60216045-60216067 GGATGTGAAGGACCTCTGCAAGG - Intronic
1069809779 10:71149765-71149787 GGATGGGAGGGACCTGATAAAGG + Intergenic
1071190487 10:83093620-83093642 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1071562511 10:86655211-86655233 GCATCCGAGCAACCTCTGAAAGG - Intronic
1073757981 10:106601530-106601552 TCTTGGGAGGGACCTGTGACAGG + Intronic
1073869855 10:107850788-107850810 GGATGTGAAGGACCTCTTAAAGG + Intergenic
1073949894 10:108795336-108795358 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1074017678 10:109550735-109550757 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1076908897 10:133377804-133377826 GCATGCCAGGGACCTCAGAATGG + Intergenic
1077464425 11:2726853-2726875 ACTTGGGAGGGGCCTCTGGAAGG - Intronic
1079174271 11:18123885-18123907 GGATGTGAGGGACCTCTTCAAGG - Intronic
1079653694 11:22962486-22962508 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1079671600 11:23177856-23177878 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1079675279 11:23219048-23219070 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1079678357 11:23261393-23261415 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1079683338 11:23325403-23325425 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1079765636 11:24388696-24388718 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1080346455 11:31331086-31331108 GGATGTGAAGGACCTCTTAAAGG - Intronic
1080817792 11:35775166-35775188 GGATGTGAGGGACCTCTTCAAGG - Intronic
1082240885 11:49869339-49869361 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1082867052 11:57909969-57909991 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1083011589 11:59406314-59406336 GGATGTGAAGGACCTCTGCAAGG + Intergenic
1083346543 11:61997304-61997326 GCATTGGAGGGGCCTCTGGCAGG + Intergenic
1083497262 11:63067002-63067024 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1083521472 11:63317421-63317443 GGATGTGAGGGACCTCTTCAAGG + Intronic
1084645939 11:70457925-70457947 GGATGGGAGGGACTGCTGATGGG - Intergenic
1085155644 11:74291142-74291164 GGATGGGAAGGACCTCTTCAAGG - Intronic
1085471784 11:76763176-76763198 GCATGAGAGAGAACCCTGAAGGG - Intergenic
1086085645 11:82952073-82952095 GCATGTGAAGGACCTCTTCAAGG - Intronic
1086522788 11:87689693-87689715 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1086761620 11:90638139-90638161 GGATGTGAAGGACCTCTTAAAGG + Intergenic
1086849659 11:91794377-91794399 AAATGGGAGGTACCTCTGATTGG - Intergenic
1087719528 11:101646482-101646504 GGATGTGAAGGACCTCTTAAAGG + Intronic
1087780659 11:102298330-102298352 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1088391002 11:109315041-109315063 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1088399125 11:109403599-109403621 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1089175697 11:116547525-116547547 GCCTGGGAGGGACCAGAGAAGGG - Intergenic
1090897216 11:130988571-130988593 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1090946619 11:131435487-131435509 GGATGTGAGGGACCTCTTCAAGG - Intronic
1091369401 11:135046149-135046171 GGAGGTGAGGGACGTCTGAACGG + Intergenic
1092321118 12:7476031-7476053 GGATGTGAAGGACCTCTTAAAGG + Intronic
1093309410 12:17560797-17560819 GCATGGGAAGGACCTCTTCAGGG - Intergenic
1093355734 12:18164596-18164618 TCATGGGAGGGACCAGTGAGAGG - Intronic
1093355769 12:18164904-18164926 TCATGGGAGGGACCAGTGAGAGG - Intronic
1094728094 12:33143462-33143484 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1095406698 12:41874587-41874609 GAATGTGAAGGACCTCTGCAAGG + Intergenic
1097797541 12:63880007-63880029 TCATGGGAGGGACCTGGGGAAGG + Intronic
1098064132 12:66594164-66594186 ACTTGGGAGGGGCCTCTGCATGG + Intronic
1098151459 12:67551407-67551429 GGATGTGAAGGACCTCTGCAAGG - Intergenic
1099427887 12:82546881-82546903 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1101102973 12:101412652-101412674 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1102576165 12:113857452-113857474 CCGTGGGTGGGAGCTCTGAAAGG + Intronic
1103151224 12:118640700-118640722 GCATGTGAGAGATCTGTGAAAGG + Intergenic
1105226897 13:18443983-18444005 GGATGTGAAGGACCTCTTAAAGG + Intergenic
1109884756 13:68527582-68527604 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1110586885 13:77203339-77203361 GGATGGGAAGGACCTCTTCAAGG + Intronic
1111767192 13:92546461-92546483 GGATGGGAAGGACCTCTTCAAGG + Intronic
1113405947 13:110040456-110040478 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1113406998 13:110050725-110050747 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1113590686 13:111497801-111497823 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1114342291 14:21757474-21757496 GGATGTGAAGGACCTCTGCAAGG - Intergenic
1114386212 14:22258056-22258078 GGATGTGAAGGACCTCTGCAAGG - Intergenic
1114395292 14:22353313-22353335 GGATGTGAAGGACCTCTGCAAGG + Intergenic
1114433378 14:22682242-22682264 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1114816241 14:25961965-25961987 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1114868798 14:26630967-26630989 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1115690556 14:35839568-35839590 GGATGTGAAGGACCTCTTAAAGG - Intronic
1116052467 14:39821725-39821747 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1116432089 14:44857858-44857880 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1116728449 14:48592178-48592200 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1117538265 14:56721903-56721925 GCAAGGGAGGATGCTCTGAAGGG + Intronic
1117614073 14:57515165-57515187 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1117616637 14:57540494-57540516 GCATGGGAAGGACCTCTTCAAGG - Intergenic
1117893031 14:60447487-60447509 GCATGTGAAGGACCTCTTCAAGG + Intronic
1118668099 14:68092396-68092418 GCATGTGAAGGACCTCTTCAAGG - Intronic
1119008789 14:70960959-70960981 GGATGTGAAGGACCTCTTAATGG + Intronic
1119264905 14:73258971-73258993 GCATGCTGGGGACCTCTGCAGGG - Exonic
1123111041 14:105866954-105866976 GCCTGGGAGGCACCTGTGAGGGG + Intergenic
1124084606 15:26535838-26535860 GGATGTGAAGGACCTCTTAAAGG + Intergenic
1125357656 15:38833254-38833276 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1125489941 15:40139323-40139345 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1127021493 15:54753698-54753720 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1127260707 15:57324326-57324348 GGAGGGGAGGGACCTGTGATGGG - Intergenic
1127260719 15:57324360-57324382 GGAGGGGAGGGACCTGTGATGGG - Intergenic
1127325788 15:57894051-57894073 GCATGAGAGGCAGTTCTGAATGG + Intergenic
1128696991 15:69773502-69773524 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1128930800 15:71703506-71703528 GCAAGGGAGGAACCTATGAGTGG + Intronic
1130006861 15:80107883-80107905 GAGGGGGAAGGACCTCTGAAAGG + Intronic
1130177142 15:81585291-81585313 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1130184781 15:81670179-81670201 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1130198336 15:81802242-81802264 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1130205868 15:81874978-81875000 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1132122114 15:99184881-99184903 TCATGGGAGGGACCTGTGGGAGG + Intronic
1132974898 16:2706312-2706334 GCATGGCAGTGACCTCTGGGAGG + Intronic
1132989373 16:2785178-2785200 GAAGAGGAGGGACCTCTGAGAGG + Intronic
1134978189 16:18587367-18587389 GCATGGGATTGGCCCCTGAAAGG - Intergenic
1137007526 16:35291620-35291642 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1137025794 16:35472979-35473001 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1137495568 16:48966787-48966809 GCATGTGAGGGCCCTGGGAAGGG + Intergenic
1137877330 16:52009295-52009317 GGATGTGAAGGACCTCTGCAAGG - Intronic
1140249350 16:73281653-73281675 GCATGGGAGGAAACTTTGAGAGG + Intergenic
1140349064 16:74244313-74244335 GCATGGTAAGCAACTCTGAATGG - Intergenic
1140914850 16:79484058-79484080 GAATGGGAGGAAGCTCTCAAAGG - Intergenic
1140990376 16:80205217-80205239 GAATGGGTGGGACCTCTGTCTGG - Intergenic
1141737008 16:85860580-85860602 GCATGGGAGGTCCCTCTGACGGG + Intergenic
1142199093 16:88752733-88752755 GCATGGGAGGCACCTTGGCAGGG + Intronic
1144128928 17:12227085-12227107 GGATGGGAGGAAACTTTGAAAGG - Intergenic
1144506362 17:15834621-15834643 GCATGGGAGTGACCTGTGCAAGG - Intergenic
1145118368 17:20232751-20232773 GCATGGGAGTGACCTGTACAAGG - Intronic
1145170539 17:20652554-20652576 GCATGGGAGTGACCTGTGCAAGG - Intergenic
1147388291 17:40094542-40094564 GGGTGGGCAGGACCTCTGAAAGG - Intronic
1148236385 17:45971954-45971976 GCATGGAGGGGGCGTCTGAAGGG - Intronic
1148493188 17:48036719-48036741 GGATGAGAAGGACCTCTGGAGGG + Intronic
1149450310 17:56744982-56745004 CCATGGCAGGGACAGCTGAAAGG + Intergenic
1150466508 17:65397459-65397481 AGTTGGGAGGGACCACTGAATGG - Intergenic
1150945534 17:69742100-69742122 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1152000363 17:77641450-77641472 GCCGGGGAGTGACCCCTGAAGGG + Intergenic
1152217291 17:79041218-79041240 GCATGGGAGGGACAGCTGGCTGG + Intronic
1152545791 17:80999576-80999598 CCAAGGGAGGGACCCCTTAACGG - Exonic
1154401196 18:14039285-14039307 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1155754525 18:29473889-29473911 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1156167680 18:34442953-34442975 GCATGTGTGGCACCTGTGAAAGG + Intergenic
1158472176 18:57746877-57746899 GCATGGAAGTGAGCTCAGAAGGG + Intronic
1159427160 18:68304798-68304820 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1161115876 19:2496038-2496060 GGAGGGAAGGGAGCTCTGAAGGG + Intergenic
1161759592 19:6161400-6161422 GCAAGGGTGGGAACTCTCAAAGG + Intronic
1161847229 19:6718856-6718878 GAAGGGGAGGAACCTCAGAAGGG + Intronic
1164093417 19:21981991-21982013 GGATGGGAAGGACCTCTTCAAGG + Intronic
1164248229 19:23453444-23453466 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1164367162 19:27598069-27598091 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1164748575 19:30634447-30634469 GCATGGCAGGAACTTCTCAAGGG - Intronic
1165350442 19:35272339-35272361 GCATGGTAGTGTGCTCTGAAGGG + Intronic
1165929132 19:39344686-39344708 GAATGTTGGGGACCTCTGAAGGG - Intronic
1167156675 19:47743069-47743091 GGCTGGGAGGGGCCTCTGAACGG + Exonic
1168141804 19:54392992-54393014 TCATGGGAGGGACCTGTGGGAGG + Intergenic
925062596 2:904902-904924 GCATGGGAGGGAGCATAGAAGGG + Intergenic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926408676 2:12579751-12579773 TCAGGGGAGTGACCTCTGAATGG - Intergenic
926460453 2:13123545-13123567 GCATGTGAAGGACCTCTTCAAGG - Intergenic
927183215 2:20463070-20463092 GGATGTGAGGGACCTCTTCAAGG + Intergenic
927221627 2:20715824-20715846 GGATGTGAGGGACCTCTTAAAGG + Intronic
929358608 2:41056010-41056032 GGATGTGAGGGACCTCTTCATGG - Intergenic
929399319 2:41561874-41561896 GCTTGGGAGGGACATCGGATGGG - Intergenic
932080805 2:68713206-68713228 GGATGGGAAGGACCTCTTCAAGG - Intronic
933784687 2:85829066-85829088 GCATGGGCGGGACGGCTGAGGGG + Intergenic
934890756 2:98066991-98067013 TCATGGGAGGGGCAGCTGAATGG + Intergenic
935552651 2:104474743-104474765 AAATGAGAGGGAGCTCTGAAGGG - Intergenic
936474041 2:112824230-112824252 GCCAGGGAAGGCCCTCTGAAAGG - Intergenic
936578319 2:113673612-113673634 GCCTGGGAGGGAAGTCTGAATGG - Intergenic
937193018 2:120122871-120122893 GCATGTGAAGGACCTCTTCAAGG - Intronic
937567263 2:123309793-123309815 GCATGTGAAGGACCTCTTCATGG + Intergenic
939206181 2:139106817-139106839 GAATGTGAGGGACCTCTTCAAGG - Intergenic
942200321 2:173564359-173564381 GGATGGGAAGGACCTCTTCAAGG + Intergenic
942365437 2:175221413-175221435 GTATGGGGAGGACCTCAGAAGGG + Intergenic
942952436 2:181736111-181736133 GGATGTGAGGGACCTCTTCAAGG + Intergenic
943407531 2:187508506-187508528 GGATGTGAGGGACCTCTTCAAGG - Intronic
943775970 2:191766158-191766180 GGATGTGAAGGACCTCTGCAAGG + Intergenic
943816157 2:192258396-192258418 GCATAGTAGGGTCCTCTGTAAGG + Intergenic
943823737 2:192361485-192361507 GGATGTGAAGGACCTCTGCAAGG + Intergenic
943929580 2:193832568-193832590 GGATGGGAAGGACCTCTTCAAGG - Intergenic
944009435 2:194955731-194955753 GGATGTGAAGGACCTCTGCAAGG - Intergenic
944249199 2:197564188-197564210 GGATGGGAAGGACCTCTTCAAGG - Intergenic
944262128 2:197689233-197689255 GGATGGGAAGGACCTCTTCAAGG - Intergenic
944970954 2:204992775-204992797 GGATGGGAAGGACCTCTTCAAGG - Intronic
944988687 2:205208663-205208685 GGATGGGAAGGACCTCTTCAAGG + Intronic
945343165 2:208682046-208682068 GCATGTGAAGGACCTCTTCAAGG - Intronic
945626397 2:212212357-212212379 GCATGTGAAGGACCTCTTCAAGG + Intronic
946085877 2:217170860-217170882 GCATGTGAAGGACCTCTTCAAGG - Intergenic
946553488 2:220828981-220829003 GGATGGGAAGGACCTCTTCAAGG + Intergenic
947449357 2:230192578-230192600 GGATGGGAAGGACCTCTTCAAGG + Intronic
947890427 2:233613750-233613772 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1170706092 20:18745818-18745840 GGGCGGGAGGGACCTCTGAAAGG + Intronic
1170979362 20:21196487-21196509 CCATTGGTGGGACCTCTTAAGGG + Intronic
1171284955 20:23929391-23929413 GCATGAGAAGGACCTAGGAAGGG - Intergenic
1171356916 20:24554006-24554028 GCATGTGAAGGACCTCTTCAAGG - Intronic
1172766982 20:37356185-37356207 GGATGGGAGGGACCTCTGAGGGG + Intronic
1175041351 20:56054328-56054350 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1176892183 21:14331603-14331625 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1177025392 21:15916278-15916300 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1177033823 21:16016428-16016450 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1177116711 21:17094815-17094837 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1177810752 21:25922672-25922694 GGATGTGAAGGACCTCTTAAAGG + Intronic
1178190920 21:30279767-30279789 GCATGGAAGTGACATCTGAATGG - Intergenic
1179731516 21:43370545-43370567 CCAGGGGAGGGACCACTGAGTGG - Intergenic
1180848168 22:18995579-18995601 GCATTGAAGGGACCTCAGAAGGG + Intergenic
1184130380 22:42513663-42513685 GCATGGGAGGGTCCTGTGCGGGG + Intronic
1184140558 22:42575491-42575513 GCATGGGAGGGTCCTGTGCGGGG + Intergenic
1184287759 22:43481622-43481644 GCCTGGGAGGAACCCCAGAAAGG - Intronic
1185112028 22:48905478-48905500 GAGTGGGAGGGACACCTGAACGG - Intergenic
950131005 3:10546609-10546631 GGAAGGTAGGGACCTCAGAAGGG - Intronic
950603353 3:14056256-14056278 GCATGTGAAGGACCTCTTCAAGG + Intronic
951431083 3:22607779-22607801 GCTTGGGAGAGACAGCTGAAAGG - Intergenic
952010052 3:28890306-28890328 GGATGGGAAGGACCTCTTCAAGG - Intergenic
952505575 3:34004285-34004307 GAATGAGAGGGACATCTGCAAGG + Intergenic
952849558 3:37716251-37716273 GCATGGTAGAGACCCCTGGATGG + Intronic
953214367 3:40904103-40904125 GGATGTGAGGGACCTCTTCAAGG - Intergenic
953494208 3:43372407-43372429 GCATGGTAGGGACCTTGGAGTGG - Intronic
953671268 3:44964279-44964301 TCATGGCAAGGACTTCTGAAGGG + Intronic
953983499 3:47424653-47424675 GGAAGGGAGGGCCCTGTGAAGGG + Intronic
954507786 3:51093378-51093400 GGATGTGAAGGACCTCTGCATGG - Intronic
956584291 3:70847932-70847954 GCATGTGAAGGACCTCTTCAAGG - Intergenic
956606396 3:71077238-71077260 GAATGGGAGTGACATGTGAAAGG - Intronic
956900151 3:73707158-73707180 GCATGGGAGGAAACTCTGCGAGG + Intergenic
957130588 3:76218607-76218629 GGATGTGAGGGACCTCTTCAAGG + Intronic
957366434 3:79230431-79230453 ACATGGGAGGGGACTCTGCAAGG - Intronic
957760432 3:84548577-84548599 GCCAGGGAGGGACCTTGGAAGGG + Intergenic
957787340 3:84900226-84900248 GGATGTGAAGGACCTCTTAAGGG - Intergenic
957942392 3:87021510-87021532 GGATGTGAGGGACCTCTTCAAGG + Intergenic
958832920 3:99111278-99111300 TCATGGGAGGGACCAGTGGAAGG - Intergenic
958853997 3:99362494-99362516 GGATGTGAGGGACCTCTTCAAGG + Intergenic
959880810 3:111442840-111442862 GCATGTGAAGGACCTCTTCAAGG - Intronic
959903794 3:111688558-111688580 GCATGGGCTTAACCTCTGAAGGG - Intronic
960973248 3:123154126-123154148 GCAGGGTAGGGACCTCTGTGGGG - Intronic
961018128 3:123482843-123482865 GCGTGGAAGGGGCCTCAGAATGG - Intergenic
961895290 3:130162139-130162161 GCATGTGAAGGACCTCTTCAAGG - Intergenic
962624842 3:137215460-137215482 GGATGTGAAGGACCTCTTAAAGG + Intergenic
962904556 3:139789950-139789972 GCTTGGGAAGGACCTCTAACTGG + Intergenic
964783153 3:160363308-160363330 GGATGTGAGGGACCTCTTAAAGG + Intronic
965271939 3:166628437-166628459 GGATGGGAAGGACCTCTTCAAGG - Intergenic
965651126 3:170934625-170934647 GGATGTGAAGGACCTCTTAAAGG - Intergenic
966063057 3:175783403-175783425 GGATGGGAAGGACCTCTTCAAGG - Intronic
966082424 3:176020432-176020454 GGATGGGAAGGACCTCTTCAAGG + Intergenic
966147818 3:176831347-176831369 GGATGGGAAGGACCTCTTCAAGG + Intergenic
966263966 3:178015375-178015397 GGATGGGAAGGACCTCTTCAAGG - Intergenic
967422827 3:189292906-189292928 GGATGAGAGGGGCCTCTGCAGGG + Intronic
968837529 4:2976052-2976074 GCAAGGGAAGTAACTCTGAAAGG + Intronic
969055393 4:4398424-4398446 GCATGGGAGTGACTGCTTAATGG - Intronic
969970620 4:11043970-11043992 GGATGGGAAGGACCTCTTCAAGG - Intergenic
971466761 4:26971937-26971959 GGATGGGAAGGACCTCTTCAAGG - Intronic
971974316 4:33663842-33663864 GGATGTGAGGGACCTCTTCAAGG - Intergenic
972914447 4:43858511-43858533 GGATGTGAAGGACCTCTTAAAGG - Intergenic
973563060 4:52155906-52155928 GTATGGGAAGGACCTCTTCAAGG + Intergenic
973746671 4:53970144-53970166 GGATGTGAAGGACCTCTTAAGGG - Intronic
973799677 4:54464563-54464585 GGATGGGAGGGAACTCTTCAAGG + Intergenic
973834985 4:54800623-54800645 GGATGTGAGGGACCTCTTCAAGG + Intergenic
973837894 4:54829216-54829238 GGATGTGAGGGACCTCTTCAAGG + Intergenic
975625672 4:76344298-76344320 GGATGTGAGGGACCTCTCCAAGG + Intronic
976003260 4:80398131-80398153 GCATGTGAAGGACCTCTTCAAGG + Intronic
976063602 4:81158374-81158396 GCATGTGAAGGACCTCTTCAAGG + Intronic
977185257 4:93928616-93928638 GCATGTGAAGGACCTCTTCAAGG - Intergenic
978166460 4:105614335-105614357 GCATTGGAGGGATATATGAAAGG - Intronic
978209936 4:106123316-106123338 GCATGTGAAGGACCTCTTCAAGG + Intronic
978775188 4:112498658-112498680 GGATGTGAGGGACCTCTTCAAGG - Intergenic
979085969 4:116410009-116410031 GGATGTGAAGGACCTCTGCAAGG + Intergenic
979114777 4:116809690-116809712 GGATGTGAAGGACCTCTGCAAGG - Intergenic
979148222 4:117274023-117274045 GGATGTGAGGGACCTCTTCAAGG + Intergenic
979512641 4:121571748-121571770 GGATGTGAGGGACCTCTTCAAGG + Intergenic
979659953 4:123242071-123242093 GGATGGGAAGGACCTCTTCAAGG + Intronic
979775836 4:124587539-124587561 GGATGTGAGGGACCTCTTCAAGG + Intergenic
980055853 4:128078999-128079021 GCATGGGAGGGAACATTTAATGG + Intronic
980626107 4:135376598-135376620 AGATGTGAAGGACCTCTGAAAGG - Intergenic
981211985 4:142118087-142118109 GGATGTGAAGGACCTCTGCAAGG + Intronic
981479627 4:145224777-145224799 GGATGGGAAGGACCTCTTCAAGG - Intergenic
982295712 4:153826664-153826686 GGATGTGAAGGACCTCTTAAAGG + Intergenic
982638174 4:157923342-157923364 GCATGTGAAGGACCTCTTCAAGG - Intergenic
982826647 4:160010906-160010928 GCATTGGAGGAACCTCTGGGAGG - Intergenic
982875157 4:160639090-160639112 GGATGTGAAGGACCTCTGCAAGG + Intergenic
982888948 4:160822506-160822528 GGATGGGAAGGACCTCTTCAAGG + Intergenic
984268754 4:177525391-177525413 GGATGTGAAGGACCTCTGCAAGG + Intergenic
984625723 4:182005766-182005788 GGATGTGAGGGACCTCTTCAAGG - Intergenic
986306429 5:6520140-6520162 GCACGGGAAGGACCCCTGAAGGG + Intergenic
986465629 5:8019895-8019917 TCATGGGAGGGACCAGTGGAAGG + Intergenic
986956110 5:13151876-13151898 GCATGTGAAGGACCTCTTCAAGG - Intergenic
987455888 5:18146168-18146190 TCATGGGAGGGACCAGTGGAAGG - Intergenic
987698759 5:21367435-21367457 GGATGGGAAGGACCTCTTCAAGG - Intergenic
987903097 5:24038895-24038917 GGATGTGAGGGACCTCTTTAAGG - Intronic
988944804 5:36185950-36185972 GGATGGGAAGGACCTCTTCAAGG - Intergenic
989349531 5:40470437-40470459 GGATGTGAGGGACCTCTTCAAGG - Intergenic
989683827 5:44061587-44061609 GGATGGGAAGGACCTCTTCAAGG - Intergenic
989716808 5:44472991-44473013 GCATGGGCTGAACCTTTGAAAGG + Intergenic
989998357 5:50862631-50862653 CCATGGCAGGGAGCTCTGAAAGG - Intergenic
990619579 5:57545341-57545363 GGATGTGAAGGACCTCTTAAAGG - Intergenic
992032117 5:72732034-72732056 GGATGGGAAGGACCTCTTCAAGG + Intergenic
992054282 5:72972398-72972420 GGATGGGAAGGACCTCTTCAAGG - Intronic
992329378 5:75700012-75700034 GGATGGGAAGGACCTCTTCAAGG + Intronic
992360572 5:76033945-76033967 GGATGGGAAGGACCTCTTCAAGG - Intergenic
992513989 5:77472714-77472736 GGATGGGAAGGACCTCTTCAAGG + Intronic
992514650 5:77479116-77479138 GGATGGGAAGGACCTCTTCAAGG + Intronic
992576877 5:78122640-78122662 GGATGGGAAGGACCTCTTCAAGG + Intronic
992619755 5:78581044-78581066 GGATGGGAAGGACCTCTTCAAGG - Intronic
993371459 5:87097801-87097823 ACATGTGAGGAACATCTGAACGG - Intergenic
993544630 5:89196014-89196036 GAATGTGAGGGACCTCTTCAAGG - Intergenic
994280691 5:97898851-97898873 GCATGTGAAGGACCTCTTCAAGG - Intergenic
994452546 5:99960611-99960633 GGATGTGAAGGACCTCTTAAAGG - Intergenic
995262855 5:110125609-110125631 GGACGTGAGAGACCTCTGAAAGG - Intergenic
995268049 5:110187813-110187835 GGATGGGAAGGACCTCTTCAAGG - Intergenic
995309699 5:110696743-110696765 GGATGGGAAGGACCTCTTCAAGG + Intronic
995416403 5:111918151-111918173 GCATGTGAAGGACCTCTTCAAGG + Intronic
996090732 5:119349078-119349100 GCATGAGAGGGGCCACAGAAGGG - Intronic
1000521898 5:162305599-162305621 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1001148801 5:169208347-169208369 GAATGTGAAGGACCTCTGCAAGG - Intronic
1001178300 5:169493748-169493770 CCAGAGGAGGGACCTCTGGAGGG - Intergenic
1002113305 5:176936521-176936543 GCAAGGGAGGAACCACTGGAGGG - Intronic
1003249157 6:4410181-4410203 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1003924327 6:10862569-10862591 GCCTGGGAGGGATCTCAGCAGGG - Intronic
1005791832 6:29310806-29310828 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1005870658 6:29972239-29972261 GAATGGGCAGGACCTCAGAAGGG - Intergenic
1006313818 6:33278904-33278926 GCATGGGAAGGACATCTCCAGGG + Intronic
1006424301 6:33954648-33954670 GCATGGCAGGCACGTGTGAATGG - Intergenic
1008088952 6:47273932-47273954 GGATGTGAGGGACCTCTTCAAGG + Intronic
1008388090 6:50917530-50917552 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1009374514 6:62950844-62950866 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1009664082 6:66653547-66653569 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1010620676 6:78070374-78070396 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1010631133 6:78199701-78199723 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1010724816 6:79321343-79321365 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1010844443 6:80687644-80687666 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1010858053 6:80868254-80868276 GCATGTGAAAGACCTCTGCAGGG - Intergenic
1011563231 6:88645297-88645319 GGATGTGAAGGACCTCTTAAAGG + Intronic
1013895683 6:115085012-115085034 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1014704577 6:124730003-124730025 GCATGTGAAGGACCTCTTCAAGG + Intronic
1015673545 6:135719722-135719744 GGATGTGAAGGACCTCTTAATGG + Intergenic
1017384549 6:153868331-153868353 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1018086443 6:160305042-160305064 TCATGGGAGGGACCTGGGAAAGG - Intergenic
1018114347 6:160568926-160568948 GGATGGGAAGGACCTCTTCAAGG + Intronic
1019376752 7:696894-696916 GCATGGGGGTGACCTCTCACGGG + Intronic
1020823383 7:12998413-12998435 GGATGTGAAGGACCTCTTAAAGG - Intergenic
1020928187 7:14358746-14358768 GGATGGGAAGGACCTCTTCAAGG + Intronic
1021011504 7:15473995-15474017 GGATGTGAGGGACCTCTTCAAGG + Intronic
1021021169 7:15600114-15600136 GCATGGGAGGGAGGGCTGAGAGG - Intergenic
1022058435 7:26766168-26766190 GCATGTGAAGGACCTCTTCAAGG - Intronic
1022304817 7:29137260-29137282 GCAAGAGAGGGGCATCTGAATGG + Intronic
1022818924 7:33939489-33939511 TCATGAGAGGGACTCCTGAATGG + Intronic
1023090115 7:36609428-36609450 GCATGGGAGGCAGATCTCAAAGG - Intronic
1024048313 7:45600284-45600306 CCATGGAGGGGACCTCTGACAGG + Intronic
1024074557 7:45811908-45811930 GCATGGGAGGGGCCGGTGCAAGG - Intergenic
1024210535 7:47199500-47199522 ACATGGCAGAGACCTCAGAAGGG + Intergenic
1026649877 7:72207344-72207366 TCAAGGGAGGGACATTTGAAGGG - Intronic
1030708274 7:112717964-112717986 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1031664167 7:124464429-124464451 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1031968650 7:128047312-128047334 GCAGGGAAGGGACCACTGAGTGG - Intronic
1032295495 7:130634418-130634440 GGATGGGAAGGACCTCTTCAAGG - Intronic
1032312145 7:130798004-130798026 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1034162148 7:149001712-149001734 ACCTGTGAGGGACCTCAGAAAGG - Intergenic
1034722417 7:153306634-153306656 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1034722970 7:153312041-153312063 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1035177604 7:157063101-157063123 GCATGGGAAGCACATCTCAAAGG + Intergenic
1035915452 8:3616211-3616233 TCATGGGAGGGACCGGTGAGAGG + Intronic
1037945332 8:22986108-22986130 CCATGGGAGGGAACACTGCAAGG + Intronic
1039285213 8:36032492-36032514 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1039305623 8:36259224-36259246 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1040316050 8:46261446-46261468 GAATGGGAGAGACCTTTGAGGGG - Intergenic
1040438631 8:47418320-47418342 GGATGGGAAGGACCTCTTCAAGG - Intronic
1040993114 8:53373431-53373453 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1041335268 8:56774944-56774966 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1041385073 8:57292624-57292646 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1042070400 8:64927013-64927035 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1043748170 8:83902199-83902221 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1044292376 8:90487701-90487723 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1045162154 8:99560104-99560126 GGATGGGAAGGACCTCTTTAAGG - Intronic
1045163310 8:99573997-99574019 GGATGGGAAGGACCTCTTCAAGG - Intronic
1045293831 8:100856746-100856768 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1045554529 8:103202854-103202876 GGAAGGGAGGCACCTCTGAGAGG + Intronic
1046175285 8:110567980-110568002 GCAAGTGAGGGAACTCAGAATGG + Intergenic
1046322630 8:112598312-112598334 GGATGGGAAGGACCTCTTCAAGG + Intronic
1046683299 8:117195855-117195877 GGATGTGAAGGACCTCTGCAAGG + Intergenic
1046828609 8:118719413-118719435 GGATGTGAAGGACCTCTGCAAGG - Intergenic
1047736576 8:127770842-127770864 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1047772329 8:128039402-128039424 GGAAGGGAGGGAACACTGAAAGG - Intergenic
1048063466 8:130944305-130944327 TCATCTCAGGGACCTCTGAAAGG + Intronic
1048075420 8:131064677-131064699 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1049092448 8:140526377-140526399 GCATGGGAGGGTTCTCTGCACGG - Intergenic
1049249744 8:141581941-141581963 ACAGGGGAGGGACCAGTGAAGGG + Intergenic
1049463140 8:142739319-142739341 GCCAGGGAGGGACCTCGGGAGGG - Intergenic
1049526145 8:143127798-143127820 GCATGGGAGGGACATAGGAGGGG + Intergenic
1049526153 8:143127820-143127842 GCATGGGAGGGACATAGGAGGGG + Intergenic
1049526192 8:143127935-143127957 GCATGGGAGGGACATAGGAGGGG + Intergenic
1050700735 9:8335906-8335928 GCATGTGAAGGACCTCTTCAAGG + Intronic
1051102802 9:13541240-13541262 GGATGGGAAGGACCTCTTTAAGG - Intergenic
1051676666 9:19565409-19565431 GGATGTGAAGGACCTCTGCAAGG + Intronic
1051956574 9:22702284-22702306 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1053069789 9:35094440-35094462 GCATGGTTGGGACTTCTGATGGG - Intronic
1053121614 9:35551428-35551450 GCATGGGAGGGAGATCTCTAGGG + Intronic
1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG + Intronic
1053899247 9:42776832-42776854 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1054794758 9:69290216-69290238 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1056049512 9:82753541-82753563 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1056051182 9:82771068-82771090 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1057164450 9:92914853-92914875 GAATGTGTGGGACTTCTGAAAGG + Intergenic
1057819636 9:98321299-98321321 GCATGGAGGGGGCCTCTGAGGGG - Intronic
1058072055 9:100611227-100611249 GGAAGGGAAGGACCTCAGAAAGG - Intergenic
1058182959 9:101820274-101820296 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1059455570 9:114398220-114398242 GAATGGGAGGGAGCCCTGGACGG - Intergenic
1060113824 9:120925873-120925895 GCCAGGGAGGGACCCCTGATGGG - Intronic
1060589611 9:124808569-124808591 GCATTAGAGGGAGCACTGAAGGG + Intronic
1061887414 9:133598878-133598900 GCCTGAGAGGGGCCACTGAAAGG - Intergenic
1186816781 X:13246061-13246083 GAATGGGAAACACCTCTGAAAGG + Intergenic
1186968448 X:14813619-14813641 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1188195437 X:27226759-27226781 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189687152 X:43576314-43576336 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1190591722 X:52009437-52009459 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1191230861 X:58092860-58092882 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1191588682 X:62857225-62857247 GGATGAGAGGGACCTCTTCAAGG + Intergenic
1191609260 X:63093953-63093975 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1191652095 X:63550417-63550439 GGATGTGAAGGACCTCTTAAAGG - Intergenic
1191824566 X:65350763-65350785 GGATGTGAAGGACCTCTTAAAGG + Intergenic
1192834680 X:74786884-74786906 GCATGGGAGGGACTAGTGATAGG - Intronic
1192982471 X:76360744-76360766 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1193878948 X:86898158-86898180 ACAAGGGAAGGACCTCTTAAAGG - Intergenic
1194230948 X:91323010-91323032 GGATGTGAAGGACCTCTTAAAGG + Intergenic
1194913473 X:99675981-99676003 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1195442646 X:104916266-104916288 GGATGGGAAGGACCTCTTCAAGG - Intronic
1197258270 X:124287981-124288003 GAAAGGGAGAGATCTCTGAAAGG - Intronic
1198164932 X:134045864-134045886 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1198592801 X:138202716-138202738 GGATGGGAAGGACCTCTTCAAGG + Intergenic
1198856312 X:141020797-141020819 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1198906380 X:141566570-141566592 GGATGTGAGGGACCTCTTCAAGG - Intergenic
1199359556 X:146903048-146903070 GCATGTGAAGGACCTCTTCAAGG + Intergenic
1199378746 X:147143713-147143735 GCATGTGAAGGACCTCTTCAAGG - Intergenic
1199522664 X:148753873-148753895 GAATGGGAGAGATGTCTGAAAGG - Intronic
1200774268 Y:7155802-7155824 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1200810144 Y:7475868-7475890 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1201524193 Y:14913079-14913101 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1201586929 Y:15571345-15571367 GGATGGGAAGGACCTCTTCAAGG - Intergenic
1201783700 Y:17750215-17750237 GGATGTGAGGGACCTCTTCAGGG + Intergenic
1201817853 Y:18155772-18155794 GGATGTGAGGGACCTCTTCAGGG - Intergenic
1201957547 Y:19642526-19642548 GCATGTGAAGGACCTCTTCAGGG - Intergenic
1202026793 Y:20532627-20532649 GGATGTGAGGGACCTCTTCAAGG + Intergenic
1202043340 Y:20710878-20710900 GGATGTGAGGGACCTCTTCAAGG + Intergenic