ID: 911046316

View in Genome Browser
Species Human (GRCh38)
Location 1:93631651-93631673
Sequence CTCAGTCATCCCTACAGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911046311_911046316 28 Left 911046311 1:93631600-93631622 CCGTCAGAAGCCACAGTTTCAAT 0: 1
1: 0
2: 3
3: 15
4: 251
Right 911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 127
911046314_911046316 -4 Left 911046314 1:93631632-93631654 CCTGTTAGTTTTTGAGTCTCTCA 0: 1
1: 0
2: 1
3: 14
4: 186
Right 911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 127
911046310_911046316 29 Left 911046310 1:93631599-93631621 CCCGTCAGAAGCCACAGTTTCAA No data
Right 911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 127
911046312_911046316 18 Left 911046312 1:93631610-93631632 CCACAGTTTCAATTCTTGCCTGC 0: 1
1: 0
2: 3
3: 21
4: 386
Right 911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 127
911046313_911046316 0 Left 911046313 1:93631628-93631650 CCTGCCTGTTAGTTTTTGAGTCT No data
Right 911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911046316 Original CRISPR CTCAGTCATCCCTACAGTTC GGG Intronic
900357280 1:2270986-2271008 CTCAGTCATCCCCACAGCCCAGG - Intronic
903015806 1:20361256-20361278 CGAAGTCAGCCCGACAGTTCAGG + Intergenic
903710996 1:25324171-25324193 CTCAGTAATCCCCAAAGTGCTGG - Intronic
903715951 1:25367258-25367280 CTCAGTAATCCCCAAAGTGCTGG + Intronic
910264235 1:85321713-85321735 CACAGTCATCCCTATAGAGCTGG + Intronic
911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG + Intronic
913601125 1:120421855-120421877 CTCAGTCATCTAGACAGTGCAGG - Intergenic
913695062 1:121316904-121316926 TTCATTCCTCCCTATAGTTCTGG + Intronic
914085920 1:144454746-144454768 CTCAGTCATCTAGACAGTGCAGG + Intronic
914142499 1:144963154-144963176 TTCATTCCTCCCTATAGTTCTGG - Intronic
914191817 1:145418726-145418748 CTCAGTCATCTAGACAGTGCAGG + Intergenic
914362313 1:146945411-146945433 CTCAGTCATCTAGACAGTGCAGG - Intronic
914489361 1:148141672-148141694 CTCAGTCATCTAGACAGTTCAGG + Intronic
914589742 1:149096727-149096749 CTCAGTCATCTAGACAGTGCAGG + Intronic
916363423 1:163996965-163996987 TCCATTCAGCCCTACAGTTCAGG - Intergenic
918587450 1:186204125-186204147 CTAAGTCATCTCTACAGCCCAGG + Intergenic
919077530 1:192831370-192831392 CTGAAGCATCTCTACAGTTCTGG + Intergenic
919727507 1:200893823-200893845 CTCTGTCATCCCTGCACTTGGGG + Intronic
920482395 1:206335289-206335311 TTCATTCCTCCCTATAGTTCTGG + Intronic
922576662 1:226665436-226665458 CCTAGTCCTCCCTACAGTTTTGG - Intronic
923074586 1:230598413-230598435 CTCTGCAATCCCTATAGTTCAGG + Intergenic
1063338695 10:5242665-5242687 CCCAGTCATCTCTTCAGTCCTGG - Intergenic
1063356541 10:5404813-5404835 CTCAGTCATTACTACAGGGCAGG - Exonic
1064659019 10:17587240-17587262 CCCTGTCATCCCAACTGTTCAGG - Intergenic
1065544914 10:26809296-26809318 CACAGTAATCCCTACACTTTGGG + Intronic
1065818332 10:29501918-29501940 CTCAGGCATCTCAACAGTCCAGG + Intronic
1065954580 10:30682586-30682608 CTCAGGCATCTCGACAGTCCGGG - Intergenic
1068105838 10:52614785-52614807 CTGAATCATCCTTACATTTCAGG + Intergenic
1071063827 10:81606808-81606830 CTCATTCATCCTTACATTTTGGG + Intergenic
1072359599 10:94646876-94646898 CCCAGTAATCCCAACACTTCGGG - Intergenic
1072425472 10:95326430-95326452 CCCAGTCATCCCTACCTCTCAGG - Intronic
1073768047 10:106705160-106705182 CACAGACATACATACAGTTCTGG + Intronic
1074866294 10:117546078-117546100 CTAAGACATCCCTGCATTTCTGG + Intronic
1074944610 10:118269439-118269461 CTCAATCTTCCCAACAGTGCTGG - Intergenic
1077836525 11:5931642-5931664 GGCAGTCATCCCTACAGTCCCGG + Intronic
1087834435 11:102858429-102858451 CTCAGTTATTCCTACAGATAAGG - Intergenic
1088999329 11:115037842-115037864 CAAACTCATCCCTTCAGTTCTGG - Intergenic
1089978285 11:122751574-122751596 CTCAGCCAGCACAACAGTTCTGG - Intronic
1091283572 11:134395898-134395920 CTCAGTCAGCCCTCCAGATGAGG - Intronic
1091363058 11:134993473-134993495 CTCAGTCATGCCAACAATTATGG - Intergenic
1091802826 12:3335155-3335177 CGCTGTCATCCCCACAGTGCAGG + Intergenic
1092810246 12:12266387-12266409 CTCAGTCATCCCGACAGCATGGG + Intronic
1093016258 12:14157385-14157407 CTCACTCCTCTCTCCAGTTCAGG - Intergenic
1093656419 12:21699763-21699785 TTCAGTCTTTCCTACAGTTTCGG + Intronic
1096167913 12:49439729-49439751 AGCAGTCATCCCTTCTGTTCAGG + Intronic
1099912923 12:88855302-88855324 CTCAGACTTCTCTACAGTTCAGG + Intergenic
1101709669 12:107253428-107253450 CTATGTTATGCCTACAGTTCAGG - Intergenic
1102326725 12:111992078-111992100 CACAGTTATCCCAACTGTTCTGG + Intronic
1102872794 12:116427093-116427115 CACAGTCATGCCTACTGTTAAGG + Intergenic
1105773826 13:23638403-23638425 TTCAGTCAGCCCTGCAGTTAGGG + Intronic
1106537528 13:30660397-30660419 CTCAGGCATCCCTGCACTTTTGG - Intronic
1107981532 13:45738549-45738571 GTCAGTCATCCCTACATCCCTGG - Intergenic
1110064080 13:71080138-71080160 CTCAGTCTCCTCTTCAGTTCGGG - Intergenic
1112326673 13:98446361-98446383 GTCAGTCTTCCCTAGAGTTGAGG - Intronic
1119678387 14:76573442-76573464 CTCTGCCCTCCCTACAGGTCTGG - Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1121824732 14:97000906-97000928 CTCAGGCATCCCTGCACTCCTGG - Intergenic
1122314187 14:100815936-100815958 CTGAGTCATGCCTGCTGTTCAGG + Intergenic
1122509838 14:102257435-102257457 TTCAGTCCTCCCAACAATTCTGG + Intronic
1127734819 15:61830807-61830829 CTCAGTCATCACTGCAGCCCTGG + Intergenic
1128313135 15:66644227-66644249 CTTAGTCCTCCCAACACTTCAGG + Intronic
1134624958 16:15717005-15717027 CTCTGTGATGCCTACAGTGCAGG - Intronic
1138394732 16:56695383-56695405 CTCAGGCATCCCTTCACTCCTGG + Intronic
1139138427 16:64233237-64233259 CCCAGGCATCCCTACACTACTGG + Intergenic
1139422464 16:66857022-66857044 CACAGTCTTCCCTCCAGTGCAGG + Intronic
1140413032 16:74752892-74752914 CTGAGTCATCCCTCCAGGCCTGG - Intronic
1142303168 16:89270599-89270621 CTCAGTCTTCCCTTCTGTCCCGG - Intronic
1145221825 17:21095876-21095898 CTCACTCAGCCCTAAAGGTCAGG + Intergenic
1149184643 17:53983018-53983040 CCCAGTCATTCCTAAAGTTCTGG + Intergenic
1149722015 17:58854720-58854742 TTGAGGCATCCTTACAGTTCCGG + Intronic
1150101348 17:62426149-62426171 CTCAGAAATGCCTTCAGTTCTGG + Intronic
1156251255 18:35354522-35354544 CTGAGTCAACCTTACAGTTCTGG + Intergenic
1156496098 18:37526054-37526076 CTCAATTATCCCTGCAGTTCAGG + Intronic
1166280574 19:41790060-41790082 CTCAGCCATCCCCAGAGATCAGG + Intergenic
927186850 2:20488187-20488209 CTGTGTCCTCCCTACAGTTGTGG + Intergenic
927325642 2:21802014-21802036 CTCAGTTATCCCTTCTGTTTTGG + Intergenic
927611638 2:24547463-24547485 GTCAGTAAGCCCTCCAGTTCAGG - Intronic
930921426 2:56759675-56759697 CTCAGTGAATCCTACTGTTCTGG + Intergenic
932777238 2:74535653-74535675 CCCAGTCATCCCCACAGATGAGG + Exonic
935478283 2:103552975-103552997 CTGAGTCATCCTTGCATTTCTGG + Intergenic
939560996 2:143731498-143731520 CACACTCGTCCCTCCAGTTCAGG + Intronic
941022012 2:160418269-160418291 ATCAGTCATCAGTACTGTTCCGG + Intronic
1171438597 20:25142970-25142992 CTCAGTGTTCCCTACACTACTGG - Intergenic
1176687174 21:9860401-9860423 CTCTGTCATTACTATAGTTCAGG + Intergenic
1177927182 21:27232924-27232946 CCCAGACATCCATACAGTTAGGG + Intergenic
1180999663 22:19982129-19982151 CTCAGTCACCCCTGGAGTGCAGG + Intronic
1181953320 22:26570555-26570577 CTCTCTCCTCCCTCCAGTTCAGG + Intronic
951114895 3:18848092-18848114 CTCAGAAATCCCTCCAGATCTGG + Intergenic
959504528 3:107143046-107143068 CTCAATTATCCCGGCAGTTCTGG + Intergenic
966616546 3:181919581-181919603 CTGAGTCATCCCACCAGTACTGG + Intergenic
967688737 3:192448490-192448512 CTCTGTCCTGCTTACAGTTCTGG - Intronic
967853557 3:194099951-194099973 GACAGCCATCCCTACTGTTCAGG - Intergenic
970232242 4:13922661-13922683 TTCAGTCATGCCAACAGTTCTGG - Intergenic
971396844 4:26236364-26236386 AATAGTCATCCCTATAGTTCAGG + Intronic
975209085 4:71678211-71678233 CTCAGAGAACCCTTCAGTTCTGG - Intergenic
976485568 4:85599316-85599338 CTCAGCCACTTCTACAGTTCTGG - Intronic
977471788 4:97452183-97452205 CTCAGGCATCCCTACACACCTGG + Intronic
980252780 4:130338910-130338932 CTGAGTCATACTCACAGTTCAGG - Intergenic
984396617 4:179210053-179210075 CTCAGTCAACTCCACATTTCGGG + Intergenic
984785468 4:183563643-183563665 CTCATTCATCCCTGCTGCTCAGG - Intergenic
985126553 4:186700747-186700769 CTCTGTTATCCCTACATTACAGG - Intronic
985790400 5:1923838-1923860 CCCAGGCATCCCCACAGCTCAGG + Intergenic
986473402 5:8097930-8097952 CTCAGGCATCCCCACAGCTGGGG + Intergenic
987001991 5:13669033-13669055 CACACTCATCCCTACAGGTCTGG + Intergenic
987206043 5:15627192-15627214 CCCAGTAATTGCTACAGTTCTGG - Intronic
990659924 5:58001958-58001980 CACAGTCATCCCTGCACTACAGG + Intergenic
991025137 5:62020845-62020867 CTCAGATATCACTATAGTTCTGG - Intergenic
992436271 5:76758732-76758754 CCTCGTCATCCCTCCAGTTCAGG - Intergenic
995989288 5:118216801-118216823 ATCTGTAATCCCAACAGTTCGGG + Intergenic
997248877 5:132373758-132373780 CTCAGTCATCCCTGGGGTACTGG + Intronic
997940229 5:138150768-138150790 CTCAGTTATTTGTACAGTTCAGG - Exonic
1000545169 5:162591190-162591212 ATCAGTCGTCCATATAGTTCTGG - Intergenic
1001894917 5:175370435-175370457 CTCAGTCATCACATCAGATCTGG - Intergenic
1009892429 6:69703506-69703528 GTCAGTCATCTCTACAGATTTGG - Intronic
1010997875 6:82554291-82554313 CTAAGGAATCCCTACAGTGCTGG + Intergenic
1012062817 6:94510856-94510878 CTCTGACATACCTACAGTGCGGG + Intergenic
1013327826 6:109065199-109065221 CTCAGACATGCCTAAAGTTAAGG - Intronic
1016885518 6:148956173-148956195 CTCAGTCATCCCTACCATATAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1022948479 7:35312983-35313005 CAAAGGCATCCCGACAGTTCAGG - Intergenic
1023057633 7:36302618-36302640 GTCAGTCACCCCTGCAGTGCCGG - Intergenic
1026442982 7:70460031-70460053 TTCAGTCATCCCCACAGCCCCGG + Intronic
1030814480 7:114018320-114018342 CTCAGTGATGGCCACAGTTCAGG + Intronic
1032030499 7:128479008-128479030 CTCAGAAATGCCTTCAGTTCTGG + Intronic
1033186467 7:139231471-139231493 CTCCGCCATCCCCACTGTTCTGG - Exonic
1036158246 8:6362493-6362515 CTCAGCTTTCCCTCCAGTTCTGG + Intergenic
1036591631 8:10173880-10173902 CTCAGTCTTCCGTGCAGTCCAGG - Intronic
1041268860 8:56091191-56091213 CTCTGTAATCCCAACATTTCGGG + Intergenic
1045069582 8:98487786-98487808 CTCAGTAATCACTATAGTTGGGG + Intronic
1047278125 8:123421337-123421359 ATCTGTAATCCCAACAGTTCGGG - Intronic
1049381367 8:142318020-142318042 CACAGCCATCACTACCGTTCCGG - Intronic
1058956680 9:109955208-109955230 CTCATTCATCCAAAGAGTTCAGG - Intronic
1186648137 X:11529229-11529251 CTCAGTGTTCCCTATAGTTTAGG + Intronic
1192271346 X:69582635-69582657 CTCATTCATTCCTATATTTCTGG - Intergenic
1194195312 X:90884277-90884299 CTCAGTCACACCTAAAGTCCTGG - Intergenic
1195544762 X:106101821-106101843 CTCTTTCATCCCTGGAGTTCAGG + Intergenic